Application of HOXD1 in diagnosis, prognosis and treatment of liver cancer

Abstract

The invention discloses application of HOXD1 in diagnosis, prognosis and treatment of liver cancer, and particularly relates to application of a reagent for detecting expression of a biomarker HOXD1 in preparation of a product for diagnosing a liver cancer object. The invention discloses application of a reagent for detecting expression of a biomarker HOXD1 in preparation of a product for prognosis of a liver cancer object. The invention discloses an application of HOXD1 as a target in screening medicines for treating liver cancer. The HOXD1 expression inhibitor is applied to preparation of a medicine for treating liver cancer. Differential expression of the HOXD1 in hepatocellular carcinoma tissues and normal hepatocellular carcinoma tissues is clear through research, high expression of the HOXD1 is closely related to the survival reduction period of clinical hepatocellular carcinoma patients, specific knock-down of the HOXD1 can obviously reduce the proliferation capacity of the hepatocellular carcinoma, and a new diagnosis / prognosis marker and a treatment target are provided for early discovery, early treatment and prognosis of the hepatocellular carcinoma. And a new treatment strategy and direction are provided.

Description

Technical Field

[0001] The present invention relates to the technical field of biopharmaceuticals, and in particular to an application of HOXD1 in the diagnosis, prognosis and treatment of liver cancer. Background Art

[0002] Hepatocellular carcinoma (HCC) is the sixth most common cancer in the world, the third leading cause of cancer-related death worldwide, and the second most lethal cancer after pancreatic cancer. According to statistics, there are more than 800,000 new cases and more than 750,000 deaths each year. Despite significant clinical progress in surgical resection, immunotherapy, and liver transplantation, the prognosis of HCC remains unfavorable, with a low five-year survival rate and a high rate of postoperative recurrence and metastasis. Therefore, determining the mechanism of HCC progression and identifying new promising therapeutic targets are urgent goals.

[0003] Homeobox genes are a type of transcriptional regulatory genes that regulate embryonic development and cell differentiation. These genes all have a highly conserved homeobox sequence consisting of 183 base pairs (bp). HOX genes are a large class of homeobox genes. The proteins they express are a type of transcriptional regulatory factors. They all have a homeodomain structure consisting of about 61 amino acids encoded by the corresponding homeobox sequence. This structure combines with cis-regulatory elements to achieve the regulation of HOX genes on target genes.

[0004] In the past decade, with the deepening of research, a large number of studies have shown that HOX family transcription factors are closely related to the occurrence and development of tumors. HOX genes are abnormally expressed in many primary tumors and play an important role in regulating tumor cell growth, apoptosis, differentiation, invasion, migration and angiogenesis.

[0005] Humans contain 39 HOX genes, forming 4 gene clusters (HOXA-HOXD), which are distributed on 4 chromosomes. HOXD transcription factors are widely considered to be tumor activators or suppressors, regulating the biological functions of tumors. The HOXD gene cluster is located on human chromosome 2, and the genes in this gene cluster are divided into 13 different families, each of which encodes a transcription factor protein. In the study of HCC, for example, HOXD3 and several TF genes containing homeoboxes are considered to be oncogenes regulating HCC. At the same time, YY1 inhibits HCC proliferation by recruiting HDAC1 by targeting the HOXD3 promoter. In addition, multiple studies also support that HOXD9 plays an oncogenic role in HCC. The expression of HOXD9 in liver cancer tissues is significantly higher than that in non-cancerous liver tissues, and its expression is negatively correlated with the survival rate of HCC patients. On the contrary, HOXD8 and HOXD10, for example, play a tumor suppressor role in HCC. Studies have found that the expression level of HOXD8 in liver metastasis tissue is lower than that in primary tissue. At the same time, the oncogene miR-5692a targets HOXD8 to promote HCC proliferation and inhibit cell apoptosis. Studies have reported that HOXD1 plays a role as an inhibitor in renal clear cell carcinoma. However, the role of HOXD1 in hepatocellular carcinoma and its specific molecular mechanism remain to be studied. Summary of the invention

[0006] The purpose of the present invention is to provide an application of HOXD1 in the diagnosis, prognosis and treatment of liver cancer in view of the above problems.

[0007] In order to achieve its purpose, the present invention adopts the following technical solution:

[0008] The first aspect of the present invention provides use of a reagent for detecting the expression of the biomarker HOXD1 in the preparation of a product for diagnosing liver cancer subjects.

[0009] The diagnostic method comprises: obtaining a test sample from a subject suspected of having liver cancer, determining the expression level of HOXD1 in the test sample, and if the expression of HOXD1 is higher than that of a normal control, it indicates that the subject is a liver cancer patient.

[0010] The second aspect of the present invention provides use of a reagent for detecting the expression of the biomarker HOXD1 in the preparation of a product for prognosing a subject with liver cancer.

[0011] The prognosis method comprises: obtaining a test sample from a subject suffering from liver cancer, and determining the expression level of HOXD1 in the test sample. Patients with high expression of HOXD1 show poor prognosis.

[0012] The third aspect of the present invention provides the use of HOXD1 as a target in screening drugs for treating liver cancer.

[0013] The drug inhibits the expression of HOXD1, thereby inhibiting the proliferation of liver cancer cells, and further slowing down or preventing the development of liver cancer.

[0014] A fourth aspect of the present invention provides use of a HOXD1 expression inhibitor in the preparation of a drug for treating liver cancer.

[0015] The expression inhibitor comprises siRNA and / or shRNA, and the shRNA is shRNA-1 or shRNA-2;

[0016] The target nucleotide sequence of the shRNA-1 is (SEQ ID NO.11): 5'-CCACTTGTTTGGTTATGATTT-3';

[0017] The nucleotide sequence of the positive strand of shRNA-1 is:

[0018] 5'-CCGGCCACTTGTTTGGTTATGATTTCTCGAGAAATCATAACCAAACAAGTGG TTTTTG-3',

[0019] The nucleotide sequence of the antisense strand of shRNA-1 is:

[0020] 5'-AATTCAAAAACCACTTGTTTGGTTATGATTTCTCGAGAAATCATAACCAAAC AAGTGG-3';

[0021] The target nucleotide sequence of the shRNA-2 is (SEQ ID NO.12):

[0022] 5'-CCAGACTATATGTCCAGATAT-3';

[0023] The nucleotide sequence of the positive strand of shRNA-2 is:

[0024] 5'-CCGGCCAGACTATATGTCCAGATATCTCGAGATATCTGGACATATAGTCTGG TTTTTG-3',

[0025] The nucleotide sequence of the antisense strand of shRNA-2 is:

[0026] 5'-AATTCAAAAACCAGACTATATGTCCAGATATCTCGAGATATCTGGACATATA GTCTGG-3'.

[0027] In any of the above application technology solutions, the liver cancer is hepatocellular carcinoma.

[0028] In any of the above application technology solutions, inhibiting HOXD1 downregulates the expression of TYMS, and low expression of TYMS weakens the proliferation ability of hepatocellular carcinoma cells.

[0029] The beneficial effects of the present invention are:

[0030] The present invention uses bioinformatics, cell biology, molecular biology and other technologies, through clinical sample analysis and in vitro cell model research, based on existing work, to carry out research on the molecular mechanism of HOXD1 promoting the proliferation of hepatocellular carcinoma. It is clear that HOXD1 is differentially expressed in hepatocellular carcinoma tissue and normal liver tissue, and its high expression is closely related to the reduced survival period of clinical hepatocellular carcinoma patients. Specific knockdown of HOXD1 can significantly reduce the proliferation ability of hepatocellular carcinoma. By studying the relationship between HOXD1 and liver cancer and the potential mechanism of action, the present invention provides new diagnostic / prognostic markers and therapeutic targets for the early detection, early treatment and prognosis of liver cancer, and provides new treatment strategies and directions. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 The results show that HOXD1 is upregulated in liver cancer tissues: Figure A shows the expression of HOXD1 mRNA in liver cancer tissues in TCGA data, NT represents paracancerous tissue, and T represents cancer tissue; Figure B shows the expression of HOXD1 mRNA in liver cancer tissues of different clinical stages in TCGA database, NT represents paracancerous tissue, and T represents cancer tissue; Figure C is divided into low expression group and high expression group accordingly, and the Kaplan-Meier method was used to analyze the relationship between HOXD1 expression and the prognosis of liver cancer patients. The results showed that patients with high expression of HOXD1 had a poor prognosis (p=0.028); Figure D shows the expression difference of HOXD between liver cancer tissues and normal liver tissues in GEO database GSE112221 sequencing data; Data analysis is represented by the mean or mean±SD in (A, B), *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

[0032] Figure 2 The results show that HOXD1 is upregulated in liver cancer tissues of patients with hepatocellular carcinoma: Figure A shows the expression of HOXD1 mRNA in liver cancer tissues and paired adjacent cancer tissues from 16 patients with hepatocellular carcinoma collected clinically; Figure B shows the expression of HOXD1 protein in liver cancer tissues and paired adjacent cancer tissues from 12 patients with hepatocellular carcinoma collected clinically; experimental data are expressed as mean or mean ± SD in (A), *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

[0033] Figure 3The results show that knocking down HOXD1 inhibits the proliferation of liver cancer cell lines HepG2 and Huh7: Figure A shows the expression of HOXD1 mRNA in HOXD knockdown liver cancer cell lines detected by qPCR; Figure B shows the expression of HOXD1 protein in HOXD1 knockdown liver cancer cell lines detected by Western blot; Figure C shows the results of EdU experiment showing that knocking down HOXD1 inhibits the proliferation of Huh7 and HepG2 cells; Scale bar = 50μm; Figure D shows the results of CCK8 experiment showing that knocking down HOXD1 inhibits the proliferation of Huh7 and HepG2 cells; Figure E shows the results of clone formation experiment showing that knocking down HOXD1 inhibits the proliferation of Huh7 and HepG2 cells.

[0034] Figure 4 The results show that overexpression of HOXD1 promotes the proliferation of liver cancer cell lines HepG2 and Huh7: Figure A shows the expression of HOXD1 mRNA in HOXD1 overexpressing liver cancer cell lines detected by qPCR; Figure B shows the expression of HOXD1 protein in HOXD1 overexpressing liver cancer cell lines detected by Western blot; Figure C shows the results of EdU experiment showing that overexpression of HOXD1 inhibits the proliferation of Huh7 and HepG2 cells; Scale bar = 50μm; Figure D shows the results of CCK8 experiment showing that overexpression of HOXD1 inhibits the proliferation of Huh7 and HepG2 cells; Figure E shows the results of clone formation experiment showing that overexpression of HOXD1 inhibits the proliferation of Huh7 and HepG2 cells; Experimental data are expressed as mean or mean±SD in (AE), *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

[0035] Figure 5 The correlation between HOXD1 and its downstream target TYMS is shown: Figure A shows the expression of HOXD1 and TYMS mRNA in HOXD1 knockdown liver cancer cell lines detected by qPCR; Figure B shows the expression of HOXD1 and TYMS proteins in HOXD1 knockdown liver cancer cell lines detected by Western blot; Figure C shows the expression of HOXD1 and TYMS mRNA in HOXD1 overexpression liver cancer cell lines detected by qPCR; Figure D shows the expression of HOXD1 and TYMS proteins in HOXD1 overexpression liver cancer cell lines detected by Western blot; Experimental data are expressed as mean or mean ± SD in (A, C), *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

[0036] Figure 6HOXD1 promotes HCC progression in vivo: A shows subcutaneous injection of nude mice with knockdown of HOXD1 in Huh7 cells. Two weeks later, the animals were sacrificed and subcutaneous tumors were taken and photographed; B shows quantitative statistical analysis of subcutaneous tumor mass in nude mice; C shows quantitative statistical analysis of subcutaneous tumor volume in nude mice; D shows subcutaneous tumors in nude mice, and immunohistochemistry was used to detect the expression of Ki67 and HOXD1 downstream target gene TYMS; Scale bar = 100 μm; Experimental data are expressed as mean or mean ± SD in (AJ), *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. DETAILED DESCRIPTION

[0037] The present invention will be further described below in conjunction with embodiments, but the present invention is not limited thereto.

[0038] The experimental methods in the following examples are conventional methods unless otherwise specified.

[0039] The research process of the present invention is as follows:

[0040] First, the expression difference of HOXD1 was analyzed: using the clinical database, the expression of HOXD1 in adjacent tissues and cancer tissues, as well as the survival rate of patients, was statistically analyzed. The clinical correlation between HOXD1 and liver cancer was clarified. At the same time, liver cancer and adjacent tissue samples from clinical surgical resection were collected. The expression levels of HOXD1 mRNA transcription and protein in liver cancer tissues and adjacent normal tissues were detected, and immunohistochemical staining was performed to clarify the expression of HOXD1 in clinical hepatocellular carcinoma.

[0041] Second, clarify the role of HOXD1 in liver cancer proliferation: First, construct a cell model and conduct a tumor proliferation experiment, and then use a nude mouse subcutaneous transplant tumor experiment to verify the function of HOXD1. Using lentivirus, a cell model with specific knockdown or overexpression of HOXD1 was constructed in two liver cancer cell lines, HepG2 and Huh7. Using the constructed cell model, the CCK-8 method, EdU method and clone formation experiment were used to detect the effect of knockdown or overexpression of HOXD1 on cell proliferation, and the biological role of HOXD1 in hepatocellular carcinoma cells in vitro was clarified. Using the nude mouse subcutaneous transplant tumor experiment, the Huh7 cells with knockdown of HOXD1 were subjected to a nude mouse subcutaneous tumor formation experiment to clarify whether the knockdown of HOXD1 inhibits tumor growth in vivo.

[0042] Third, explore the mechanism of action of HOXD1: perform transcriptome sequencing on HepG2 cells with HOXD1 knockdown, and preliminarily identify the downstream targets of HOXD1 through enrichment analysis of differentially expressed genes. Through relevant experiments, clarify the mechanism of action.

[0043] The specific research process is as follows:

[0044] Example 1

[0045] 1 Experimental Materials and Reagents

[0046] 1.1 Experimental Materials

[0047] 1.1.1 Cells

[0048] The human hepatoma cell line HepG2 was purchased from the Shanghai Cell Bank of the Chinese Academy of Sciences, the human embryonic kidney cell line HEK-293T was purchased from the Shanghai Cell Bank of the Chinese Academy of Sciences, and the human hepatoma cell line Huh7 was generously donated by Professor Lin Yong of Chongqing Medical University.

[0049] 1.1.2 Liver cancer tissue

[0050] Liver cancer and paired adjacent adjacent tissues were collected from tissue samples removed during clinical surgery in the Department of Hepatobiliary Surgery, The First Affiliated Hospital of Chongqing Medical University and stored in liquid nitrogen.

[0051] 1.2 Main Reagents

[0052]

[0053]

[0054] 2 Experimental methods

[0055] 2.1 Cell culture

[0056] All cell experiments in this study were performed at 37°C and 5% CO 2 The cells were cultured in an incubator under saturated humidity (70% to 75%). The culture medium was a high glucose cell culture medium (DMEM) containing 100 μg / mL streptomycin, 100 IU / mL penicillin and 10% fetal bovine serum (FBS). 1% non-essential amino acids (NEAA) were added to HepG2 and Huh7 cells, and 1% GlutaMAX was added to HEK293T cells.

[0057] 2.2 Cell recovery

[0058] (1) Take out the cell cryopreservation tube and immediately place it in a 37℃ water bath. Shake it gently and take it out when the liquid melts and only a few crystals remain.

[0059] (2) Pipette the cell suspension into a 15 mL sterile centrifuge tube containing 3 mL of culture medium and centrifuge at 1000 rpm for 3 minutes.

[0060] (3) Aspirate the supernatant, add 1 mL of fresh culture medium to suspend the cells, and pipette the cell suspension into a 6 cm culture dish prepared in advance. Gently shake the dish to ensure that the cells are evenly distributed.

[0061] (4) Place in 37°C, 5% CO2 Continue culturing the cells in the incubator.

[0062] 2.3 Cell passaging

[0063] (1) Discard the culture medium, add 1 mL of pancreatic enzyme substitute to a 6 cm culture dish, and place in a CO 2 Incubate different cells for different digestion times and terminate with 1 mL of culture medium. Gently blow down the cells with a pipette tip, transfer them to a 15 mL sterile centrifuge tube, and centrifuge at 1000 rpm for 3 minutes.

[0064] (2) Discard the supernatant, add 1 mL of fresh culture medium to suspend the cells, transfer to a culture dish, and shake to mix.

[0065] (3) Place in 37°C, 5% CO 2 Continue culturing the cells in the incubator.

[0066] 2.4 Cell cryopreservation

[0067] (1) Preparation of freezing solution: dimethyl sulfoxide: serum in a ratio of 8:92, and then precool at 4°C.

[0068] (2) Digest the cells. After the culture medium stops, transfer the culture medium into a 15 mL sterile centrifuge tube and centrifuge at 1000 rpm for 3 minutes.

[0069] (3) Discard the supernatant, add pre-cooled cryopreservation solution, pipette gently to mix, transfer to a labeled 2 mL cryopreservation tube, and place in a cryopreservation box.

[0070] (4) Place in a -80°C freezer and transfer to a liquid nitrogen tank after 24 hours.

[0071] 2.5 RNA extraction

[0072] Conventional method.

[0073] 2.6 Reverse transcription

[0074] The reverse transcription experiment was completed using the Fastking cDNA First-Strand Synthesis Kit (Genomic-free) from TIANGEN (China) according to the kit's operating instructions.

[0075] 2.7 Fluorescence quantitative PCR

[0076] Take the PCR tube and add the sample according to the following system:

[0077]

[0078]

[0079] After the sample is added, place it in a quantitative PCR instrument and amplify according to the following procedure.

[0080]

[0081] PCR reactions were performed in a Bio-Rad (USA) Real-Time PCR CFX96 instrument.

[0082] The 2^(-ΔΔCT) method was used for relative quantitative analysis, with 4 replicate wells for each sample and β-Tubulin as an internal reference. The primer sequences are shown in the following table:

[0083]

[0084] 2.8Western Blot

[0085] (1) Digest the cells to be harvested with trypsin analogs, collect the cells into a 1.5 mL centrifuge tube, centrifuge at 5000 rpm for 3 minutes, and discard the supernatant. Add 500 μL of PBS to resuspend the cells, centrifuge at 5000 rpm for 3 minutes, and discard the supernatant.

[0086] (2) Add a certain volume of 1× SDS Loading Buffer, blow the cell pellet several times, boil it in a 95℃ metal bath for 10 minutes, and store it at -20℃.

[0087] (3) Assemble the glass plate and use the 12% CFAS PAGE rapid gel preparation reagent from Zhonghui Hecai Company to make gel. After the gel is made, put it into the electrophoresis tank with electrophoresis solution and load the sample. Keep the voltage at 80V for 40 minutes, then change the voltage to 110V for 50 minutes.

[0088] (4) Place the gel block and PVDF membrane after electrophoresis into a transfer chuck and wet transfer for 70 minutes at a constant voltage of 100 V in a transfer tank placed on ice.

[0089] (5) After the transfer, the PVDF membrane was placed in 5% freshly prepared skim milk and blocked by shaking slowly at room temperature for 70 minutes.

[0090] (6) After blocking, the membrane was placed in dry TBST solution (1 mL of 0.1% Tween 20 in 1 L of 1×TBS) to remove residual milk and then washed.

[0091] (7) Dilute the antibody to an appropriate ratio using blocking buffer according to the antibody instructions and incubate the membrane in a 4°C refrigerator overnight.

[0092] (8) The next day, wash the membrane three times with TBST solution for 5 minutes each time. After washing, incubate with horseradish peroxidase-labeled secondary antibody (mouse antibody or rabbit antibody) at room temperature for 70 minutes.

[0093] (9) After incubation with the secondary antibody, wash the membrane with TBST solution for 5 minutes each time, three times in total.

[0094] (10) On a chemiluminescent imager, add ECL developer onto the strips, adjust the exposure time to an appropriate level, save the photo, and analyze the strips.

[0095] 2.9 Construction of cell models with knockdown or overexpression of HOXD1

[0096] 2.9.1 Knockdown plasmid construction

[0097] (1) HOXD1 knockdown shRNA-1 / 2 was synthesized by Shanghai Bioengineering Co., Ltd. The specific sequence is as follows:

[0098]

[0099]

[0100] (2) Oligonucleotide annealing: Dissolve the above primers to a concentration of 50 μM, take 20 μL of each of the forward and reverse primers, mix well, place in a 95°C water bath for 5 minutes, turn off the power of the water bath and cool it down overnight. Take out the annealing product and store it at -20°C.

[0101] (3) Knockdown plasmid vector pLKO.1-puro double enzyme digestion, the reaction system is as follows:

[0102]

[0103] Incubate in water bath at 37°C for 3-5 hours.

[0104] (4) According to the instructions of the Novozyme DNA Gel Recovery Kit, the enzyme digestion product in the previous step was recovered by gel recovery and the concentration was measured.

[0105] (5) Connect and add samples according to the following system:

[0106]

[0107] After adding the sample, place it in the PCR instrument, react at 22℃ for 30-60 minutes, and store at -20℃.

[0108] (6) Transformation and clone selection

[0109] 1) Take 50 μL of cloning competent cells, add 2 μL of the above recombinant product, mix well, and place on ice for 30 minutes;

[0110] 2) Heat shock in a 42°C water bath for 30 seconds and immediately cool on ice for 3 minutes;

[0111] 3) Add 450 μL of LB medium without ampicillin resistance and shake at 37°C for 50 minutes;

[0112] 4) Take the shaken product, centrifuge at 5000 rpm for 3 minutes, discard the supernatant of about 70 μL, mix well, add to the LB plate with ampicillin resistance, spread the plate with the triangular glass rod coating method, and culture in a 37°C incubator for 8-9 hours;

[0113] 5) Add 3 ml of LB medium containing ampicillin resistance to the shaking tube, pick up a single clone with a pipette tip and transfer it to the shaking tube, and shake the tube at 37°C for 12 hours;

[0114] 6) Use the TIANGEN endotoxin-free plasmid extraction kit to perform plasmid extraction according to the instructions. After the plasmid extraction is completed, send it to the company for sequencing.

[0115] 2.9.2 Overexpression plasmid construction

[0116] The overexpression plasmid PCDH-3×FLAG-HOXD1 was synthesized by Shanghai Bioengineering Co., Ltd. The nucleotide sequence of HOXD1 in this study can be found in NCBI GenBank sequence number NM_024501.3.

[0117] 2.9.3 Lentiviral packaging

[0118] (1) HEK293T cells were seeded at a moderate density in a 6 cm dish and allowed to grow to a confluency of about 90% the next day for plasmid transfection.

[0119] (2) Lentiviral packaging plasmids PMD2.G and PSPAX2 were generously donated by Professor Wen Bo of Chongqing Medical University.

[0120] Knockdown lentivirus packaging is loaded according to the following system:

[0121]

[0122] Overexpression lentivirus packaging is loaded according to the following system:

[0123]

[0124] After adding the sample, mix well and let stand for 20 minutes.

[0125] (3) Remove the cells, add the prepared transfection mixture to the culture medium, mix gently, and place at 37°C and 5% CO 2 Incubator. After 24 hours, change the medium, collect the virus supernatant at 48 hours and 72 hours, filter with a 0.45 μm filter membrane, and store in aliquots or concentrate the virus for storage.

[0126] 2.9.4 Screening of stable transgenic lines with knockdown or overexpression of HOXD1

[0127] (1) HepG2 and Huh7 liver cancer cell lines were plated in 12-well plates, and lentivirus was added. The mixture was evenly mixed and placed in an incubator for infection for 48 hours.

[0128] (2) After 48 hours, discard the culture medium, add puromycin and complete culture medium, with the final concentration of puromycin being 1 μg / ml, and place the cells in the incubator for further culture.

[0129] (3) The medium was changed every 24 hours and the puromycin concentration was maintained. The HepG2 and Huh7 stable transfectants were successfully obtained when there was no cell death and the qPCR and WB results showed that the HOXD1 protein was successfully knocked down or overexpressed.

[0130] 2.10 Cell proliferation assay (CCK8 assay)

[0131] (1) Take out the stable hepatocellular carcinoma cell line cultured in a 37°C constant temperature incubator, digest it with trypsin, take 10 μL of the cell resuspension, dilute it at a certain multiple, mix it thoroughly, and then take 10 μL and add it to the counting plate for counting. Because different hepatocellular carcinoma cell lines have different growth rates, different cell densities are inoculated in a 96-well plate, ranging from 800 to 3000 cells per well.

[0132] Six wells were inoculated in each column, for a total of six columns for six days of measurement.

[0133] (2) On the second day, prepare a culture medium containing CCK8 reagent (100 μL culture medium + 10 μL CCK8 solution). Add 110 μL of culture medium CCK8 solution to each of the 6 wells in the first column, place the cells back into the 37°C constant temperature incubator, incubate for 2 hours, take them out, select 450 nm wavelength in the microplate reader, and measure their absorbance value.

[0134] (3) On the third day, repeat step 2 and measure the absorbance values ​​for 6 consecutive days, and draw a growth curve based on the absorbance values.

[0135] 2.11 Clone formation experiment

[0136] (1) Take out the stable hepatocellular carcinoma cell line grown in a 37°C constant temperature incubator. After trypsin digestion, count the cells in the same way as the CCK8 experiment. Depending on the growth rate of different hepatocellular carcinoma cells, inoculate 1,000 to 3,000 cells per well in a sterile 6-well plate culture dish, repeat three wells, and return to the 37°C constant temperature incubator.

[0137] (2) The culture medium was changed every three days. After about two weeks of culture, the size of the cell clones in the six-well plate was observed and the culture was terminated when the size and density were appropriate.

[0138] (3) Discard the culture medium, wash twice with 1×PBS, wash away the residual culture medium, add 4% paraformaldehyde solution and fix at room temperature for 15 minutes. Aspirate and discard the paraformaldehyde, wash twice with 1×PBS. Add 1mL crystal violet staining solution and stain for 1 hour. After staining is completed, recover the staining solution.

[0139] (4) Carefully wash away the excess crystal violet stain with distilled water and invert to dry at room temperature. After taking pictures, use Image J software to count the number of colonies formed.

[0140] 2.11EdU cell proliferation assay

[0141] (1) Take out the stable hepatocellular carcinoma cell line grown in a 37°C constant temperature incubator. After trypsin digestion, the counting method is the same as the CCK8 experiment. According to the growth rate of different hepatocellular carcinoma cells, 200,000 to 400,000 cells are plated in each well of a sterile 12-well plate culture dish and returned to the 37°C constant temperature incubator.

[0142] (2) Take the cells from the 12-well plate, remove 500 μL of the culture medium, leaving 500 μL in the 12-well plate culture dish, add 500 μL of 2× EdU working solution (20 μM) preheated at 37°C, and return to the incubator for incubation for 2 hours.

[0143] (3) After EdU labeling, the culture medium was removed, 500 μL of fixative (4% paraformaldehyde) was added, and the cells were fixed at room temperature for 15 minutes.

[0144] (4) Remove the fixative solution, add 500 μL PBS, place on a shaker at room temperature for 5 minutes, and wash 3 times. Remove the wash solution, add 500 μL permeabilization solution (0.3% TritonX-100), and incubate at room temperature for 10 minutes. Remove the permeabilization solution, add 500 μL PBS, place on a shaker at room temperature for 5 minutes, and wash 2 times. Prepare the Click additive Solution according to the instructions of the Bio-Tech kit, remove the wash solution, add 0.5 mL Click reaction solution, and incubate at room temperature in the dark for 30 minutes.

[0145] (5) Remove the Click reaction solution and wash with PBS three times, 5 minutes each time. Remove the washing solution, add 500 μL of 1× Hoechst solution, and incubate at room temperature in the dark for 10 minutes. After aspirating the 1× Hoechst, wash with PBS three times, 5 minutes each time.

[0146] (6) Use a fluorescent inverted microscope to detect and take pictures, and use Image J software for analysis.

[0147] 2.12 Nude mouse subcutaneous transplant tumor experiment

[0148] (1) The pre-prepared Huh7 knockdown cells were harvested, diluted with 1× PBS, counted under a microscope, and the inoculation volume was calculated.

[0149] (2) Prepare alcohol cotton balls, syringes, tweezers, etc., and perform subcutaneous inoculation of nude mice in a clean bench. Inoculate 3×10^6 cells per mouse, mark and record, and continue to feed the mice after inoculation. Observe the growth status and tumor size of the nude mice every three days.

[0150] (3) About 15 days after inoculation, the nude mice were killed under isoflurane anesthesia and tumor tissues were obtained. Tumor tissue images were collected and the volume and weight of tumor tissues were measured. Some tissues were fixed with formaldehyde and sent to the company for immunohistochemistry, and the rest of the tissues were stored in liquid nitrogen.

[0151] 2.12 Immunohistochemistry (IHC)

[0152] The IHC experiment was performed by Wuhan Sewell Biotechnology Co., Ltd.

[0153] 3 Experimental results

[0154] 3.1HOXD1 is highly expressed in liver cancer tissues and is associated with poor prognosis in patients with liver cancer

[0155] In order to study the potential significance of HOXD1 in HCC, we first analyzed the TCGA database and compared the differential expression of HOXD1 in HCC and normal samples. We found that the transcription level of HOXD1 was significantly increased in liver cancer tissues ( Figure 1 A) and was positively correlated with tumor stage ( Figure 1 B). According to the expression level of HOXD1 in 316 liver cancer tissues, they were divided into HOXD1 low expression group and high expression group. The Kaplan-Meier method was used to analyze the relationship between HOXD1 expression and the prognosis of liver cancer patients. The results showed that patients with high expression of HOXD1 had a poor prognosis (p = 0.028) ( Figure 1 C). By analyzing the sequencing data of normal human liver tissue and HCC tissue in the GEO database (GSE112221), it was determined that the expression level of HOXD1 was upregulated in HCC ( Figure 1 D).

[0156] Furthermore, clinical tissue samples from patients with liver cancer who underwent tumor resection at the First Affiliated Hospital of Chongqing Medical University were collected. The expression levels of HOXD1 mRNA and protein in liver cancer tissues of clinical patients were detected by qPCR and Western Blot. The results showed that the expression of HOXD1 in liver cancer tissues was higher than that in the corresponding adjacent cancer tissues ( Figure 2 ).

[0157] The above results indicate that HOXD1 is highly expressed in HCC and is associated with a poor prognosis of HCC, and may serve as a potential biomarker for HCC.

[0158] 3.2HOXD1 promotes liver cancer cell proliferation in vivo and in vitro

[0159] To study the biological role of HOXD1 in HCC, we selected liver cancer cell lines Huh7 and HepG2, used lentivirus to knock down or overexpress HOXD1, and screened out knockdown (shHOXD1-1 / 2)( Figure 3 A, B) or overexpression (3×flag-HOXD1) ( Figure 4 A, B) stable transfected lines and control cells (sh-Ctrl, pCDH). The results of CCK-8 experiment and EdU experiment showed that knocking down HOXD1 significantly reduced the proliferation activity of HepG2 and Huh7 cells ( Figure 3 C, D), on the contrary, overexpression of HOXD1 enhanced the proliferation activity of cells ( Figure 4 C, D).

[0160] Furthermore, we tested the effect of HOXD1 on the proliferation of liver cancer cells through clone formation experiments. The results showed that compared with the control group, knocking down HOXD1 significantly inhibited the clone formation ability of HepG2 and Huh7 cells ( Figure 3 E). In contrast, specific overexpression of HOXD1 in both cell types effectively enhanced their clonogenic ability ( Figure 4 E).

[0161] The above results indicate that HOXD1 can promote the proliferation of liver cancer cells in vitro.

[0162] 3.3 HOXD1 is associated with TYMS expression

[0163] Based on the existing research foundation, we analyzed the correlation between HOXD1 and its downstream related protein thymidylate synthase (TYMS) expression in vitro. In the liver cancer cell lines Huh7 and HepG2, HOXD1 was knocked down or overexpressed, and the expression levels of HOXD1 and TYMS mRNA and protein were detected by qPCR and Western Blot experiments. The test results showed that in the HepG2 and Huh7 cell lines with knockdown of HOXD1 expression, the expression of TYMS was significantly downregulated ( Figure 5 A, B). In contrast, overexpression of HOXD1 upregulated the expression of TYMS in both cell lines ( Figure 5 C, D).

[0164] These results suggest that HOXD1 may regulate the proliferation of liver cancer cells by regulating the expression of thymidylate synthase.

[0165] 3.4HOXD1 promotes tumorigenesis of liver cancer cells in vivo

[0166] Furthermore, in order to evaluate the effect of HOXD1 on liver cancer proliferation in vivo, we used Huh7 cells with stable knockdown of HOXD1 and control cells, injected them into the subcutaneous part of the axilla of nude mice, and obtained tumor tissues 2 weeks later ( Figure 6 A).

[0167] By measuring the volume and mass of tumors in nude mice, the analysis results showed that compared with the control group, the tumor growth in the knockdown group was significantly slowed down ( Figure 6 AB). Similarly, the tumor mass generated by HOXD1 knockdown cells was significantly lower than that of the control group ( Figure 6 B). The removed tumor tissue was then subjected to immunohistochemical staining to detect Ki67 and TYMS. Ki67 is a marker of cell proliferation. The higher its expression level, the stronger the proliferation activity of tumor cells. The immunohistochemical results showed that compared with the control group, knocking down HOXD1 significantly reduced the expression of Ki67, a cell proliferation indicator, and also downregulated the expression of TYMS, a downstream protein of HOXD1 ( Figure 6 D).

[0168] These results indicate that HOXD1 can promote tumorigenesis of liver cancer cells in vivo and promote HCC progression.

[0169] The present study shows that the mechanism by which transcription factor HOXD1 promotes the proliferation of hepatocellular carcinoma is that transcription factor HOXD1 is positively correlated with the expression of TYMS, knocking down HOXD1 can downregulate the expression of TYMS, and it has been confirmed that low expression of TYMS can weaken the proliferation of hepatocellular carcinoma cells. Therefore, knocking down transcription factor HOXD1 can inhibit the proliferation of hepatocellular carcinoma. Transcription factor HOXD1 may serve as a drug target for inhibiting the proliferation of hepatocellular carcinoma.

Claims

1. Use of a reagent for detecting the expression of the biomarker HOXD1 in the preparation of a product for diagnosing liver cancer subjects.

2. The use according to claim 1, characterized in that: The diagnostic method comprises: obtaining a test sample from a subject suspected of having liver cancer, determining the expression level of HOXD1 in the test sample, and if the expression of HOXD1 is higher than that of a normal control, it indicates that the subject is a liver cancer patient.

3. Use of a reagent for detecting the expression of the biomarker HOXD1 in the preparation of a product for prognosis of liver cancer subjects.

4. The use according to claim 3, characterized in that: The prognosis method comprises: obtaining a test sample from a subject suffering from liver cancer, and determining the expression level of HOXD1 in the test sample. Patients with high expression of HOXD1 show poor prognosis.

5. Application of HOXD1 as a target in screening drugs for the treatment of liver cancer.

6. The use according to claim 5, characterized in that: The drug inhibits the expression of HOXD1, thereby inhibiting the proliferation of liver cancer cells, and further slowing down or preventing the development of liver cancer.

7. Application of HOXD1 expression inhibitors in the preparation of drugs for the treatment of liver cancer.

8. The use according to claim 7, characterized in that: The expression inhibitor comprises siRNA and / or shRNA, and the shRNA is shRNA-1 or shRNA-2; The target nucleotide sequence of the shRNA-1 is: 5'-CCACTTGTTTGGTTATGATTT-3'; The nucleotide sequence of the positive strand of shRNA-1 is: 5'-CCGGCCACTTGTTTGGTTATGATTTCTCGAGAAATCATAACCAAACAAGTGGTTTTTG-3', The nucleotide sequence of the antisense strand of shRNA-1 is: 5'-AATTCAAAAACCACTTGTTTGGTTATGATTTCTCGAGAAATCATAACCAAACAAGTGG-3'; The target nucleotide sequence of the shRNA-2 is: 5'-CCAGACTATATGTCCAGATAT-3'; The nucleotide sequence of the positive strand of shRNA-2 is: 5'-CCGGCCAGACTATATGTCCAGATATCTCGAGATATCTGGACATATAGTCTGGTTTTTG-3', The nucleotide sequence of the antisense strand of shRNA-2 is: 5'-AATTCAAAAACCAGACTATATGTCCAGATATCTCGAGATATCTGGACATATAGTCTGG-3'.

9. The use according to any one of claims 1 to 8, characterized in that: The liver cancer is hepatocellular carcinoma.

10. The use according to any one of claims 5 to 8, characterized in that: Inhibition of HOXD1 downregulates the expression of TYMS, and low TYMS expression weakens the proliferation ability of hepatocellular carcinoma cells.

Images