SNP molecular marker ITPR3 related to breeding traits of goats and application of SNP molecular marker ITPR3

Abstract

The invention discloses an SNP molecular marker ITPR3 related to breeding traits of goats and application thereof, and belongs to the field of biotechnology and livestock breeding. According to the invention, an SNP (Single Nucleotide Polymorphism) site which is remarkably associated with the breeding traits of the goats is screened, and the SNP site is ITPR3g. 40886054Agt; the G is positioned at the 40886054bp base of the 23rd chromosome of the goat genome, and the polymorphism of the G is A or G. The genotype of the SNP site is obviously related to the lambing number of the second birth and the third birth of the goat; the lambing number of the second birth of the GG genotype ewes is obviously higher than that of the AG genotype ewes; the lambing number of the GG genotype ewes in the third birth is obviously higher than that of AA genotype ewes. When the molecular marker is used for screening the goats, the screening method is simple and rapid, high in accuracy and low in price, the breeding efficiency of the goats can be improved, and the molecular marker has very high application value.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and livestock breeding, and relates to a SNP molecular marker related to goat reproductive traits and an application thereof. Background Art

[0002] With the rapid development of modern biotechnology, the research on improving the economic traits of livestock using some modern molecular breeding technologies such as molecular marker-assisted selection technology has become more and more extensive, which plays an important role in promoting the high-quality development of animal husbandry. By using modern molecular biological methods to explore effective SNP sites in goat populations and selectively selecting goats with better economic traits such as the number of lambs, the efficiency of breeding can be effectively improved, the blindness in the breeding process can be reduced, and strong technical support can be provided for the breeding of high-fertility traits of goats, which has a far-reaching impact on promoting the sustainable development of the goat industry.

[0003] Single nucleotide polymorphism (SNP) refers to DNA sequence polymorphism caused by the variation of a single nucleotide at the genomic level. SNP is a genetic polymorphism marker with a wide distribution, large number and high marker density, and has the characteristics of high genetic stability, good reproducibility and accuracy of genetic analysis, and easy rapid high-throughput genotyping (Wang Zhonghua, 2008). The allele frequency of SNP genetic markers varies in different populations. This feature can be used to analyze population genetic diversity, analyze and mine candidate genes for variety-specific traits, and identify varieties (Zhou Xiaomin, Dai Xilin, 2020).

[0004] Inositol 1,4,5-triphosphate (IP3) receptors (IP3Rs) are intracellular Ca2+ receptors located on the endoplasmic reticulum (ER) membrane. 2+ A family of release channels, IP3Rs mediate the movement of Ca2+ from the ER to the cytoplasm when the receptor binds to the second messenger IP3 (BerridgeMJ et al., 1993). Three different subtypes of IP3Rs (IP3R1, IP3R2, and IP3R3) have been found in mammals. Through gene knockout mouse models, IP3Rs have been shown to play an important role in regulating a variety of physiological processes, including brain function, taste perception, embryonic survival, extraembryonic vascular development, exocrine secretion, T cell development, B cell function, gastrointestinal motility, vasoconstriction, and hypertension (Feili Yang et al., 2020).

[0005] José E. Mesonero et al. studied the regulation of phospholipase C (PLC) and the expression of inositol 1,4,5-triphosphate receptors (IP3Rs) in the myometrium and endometrium of rats at mid-pregnancy (day 12) and term (day 21) in terms of mRNA, protein and binding capacity, and compared them with estrogen-treated tissues (day 0). The mRNA encoding the three isoforms of IP3R and their corresponding proteins IP3R1, IP3R2 and IP3R3 are co-expressed in the myometrium and endometrium, and the expression of IP3Rs increases with the extension of gestation (José E. Mesonero et al., 2000). KEGG enrichment analysis found that ITPR3, namely IT3R3, plays a role in the oxytocin signaling pathway, oocyte meiosis, GnRH signaling pathway, estrogen signaling pathway and Ca2 + The protein is enriched in multiple reproduction-related signaling pathways, such as the mitochondrial signaling pathway, suggesting that it is widely involved in the reproductive regulation of the body. However, no study has reported that ITPR3 has molecular markers related to high reproductive traits in goats. Summary of the invention

[0006] In order to overcome the shortcomings of the prior art in goat reproductive trait selection, the object of the present invention is to provide a SNP molecular marker related to goat reproductive traits and its application in different goat populations.

[0007] In order to achieve the above object, the present invention adopts the following technical solutions:

[0008] In the first aspect, the present invention claims the use of a substance for detecting the polymorphism or genotype of the SNP site ITPR3 g.40886054A>G in the goat genome in any of the following:

[0009] (a1) Application in identification or auxiliary identification of reproductive traits of goats;

[0010] (a2) Use in the preparation of products for identifying or assisting in identifying reproductive traits of goats;

[0011] (a3) Application in screening or assisting in screening goats with high reproductive traits;

[0012] (a4) Use in preparing products for screening or assisting in screening goats with reproductive traits of highland goats;

[0013] (a5) Application of reproductive traits of mountain goats in goat breeding;

[0014] The SNP site ITPR3 g.40886054A>G is located at the 40886054bp base of chromosome 23 of the goat genome, and its polymorphism is A or G. The physical position of the SNP site ITPR3 g.40886054A>G is determined based on the whole genome sequence of the goat, and the accession number of the whole genome of the goat is NC_030830.1.

[0015] Furthermore, the reproductive trait is the number of lambs born, and the genotype of the SNP site ITPR3 g.40886054A>G is significantly correlated with the number of lambs born in the second and third litters of goats; the number of lambs born in the second litter of ewes with GG genotype is significantly higher than that of ewes with AG genotype; the number of lambs born in the third litter of ewes with GG genotype is significantly higher than that of ewes with AA genotype.

[0016] Furthermore, the substance is the following (b1) or (b2) or (b3):

[0017] (b1) PCR primers for amplifying a goat genomic DNA fragment containing the SNP site ITPR3 g.40886054A>G;

[0018] (b2) a PCR reagent containing the PCR primers described in (b1);

[0019] (b2) A kit containing the PCR primers described in (b1) or the PCR reagents described in (b2).

[0020] Furthermore, the PCR primers include an upstream primer F1 and a downstream primer R1;

[0021] Upstream primer F1: 5'-AACTTGCACGTACTCTGCGC-3' (SEQ ID NO. 2);

[0022] Downstream primer R1: 5'-TGTCTCGCACACCAGGTTGT-3' (SEQ ID NO. 3).

[0023] In a second aspect, the present invention claims to protect the use of the above-mentioned PCR primers in the preparation of a product for detecting the polymorphism or genotype of the aforementioned SNP site ITPR3g.40886054A>G.

[0024] In a third aspect, the present invention claims a product for detecting the polymorphism or genotype of the SNP site ITPR3 g.40886054A>G in the goat genome, the product containing the aforementioned PCR primer or the aforementioned substance. The product can be a PCR reagent or a kit.

[0025] In a fourth aspect, the present invention claims a method for identifying or assisting in identifying goat reproductive traits, detecting the polymorphism or genotype of the SNP site ITPR3 g.40886054A>G in the goat genome; the number of lambs born in the second litter of the GG genotype ewe is significantly higher than that of the AG genotype ewe; the number of lambs born in the third litter of the GG genotype ewe is significantly higher than that of the AA genotype ewe. Selecting GG genotype individuals as parents in goat breeding can improve goat reproductive performance.

[0026] In the fifth aspect, the present invention claims protection for a breeding method for goats with high reproductive traits, detecting the polymorphism or genotype of the SNP site ITPR3 g.40886054A>G in the goat genome; retaining GG homozygous genotype individuals, eliminating AA homozygous genotype individuals and AG heterozygous genotype individuals, and increasing the number of lambs born by goats generation by generation.

[0027] Further in the above method, the method for detecting the polymorphism or genotype of the SNP site ITPR3 g.40886054A>G in the goat genome is: using the genomic DNA of the goat blood to be tested as a template, using the above-mentioned PCR primers or the above-mentioned products to perform PCR amplification, and using the method of direct sequencing of the PCR amplification products to determine the polymorphism or genotype of the SNP site ITPR3g.40886054A>G in the goat genome.

[0028] In a specific embodiment of the present invention, the PCR product is directly sequenced to determine the genotype; the ITPR3 g.40886054A>G genotype is determined based on the sequencing peak graph: when the peak graph shows a single peak A, the genotype is AA; when the peak graph shows a single peak G, the genotype is GG; when the peak graph shows a double peak of A and G, the genotype is AG.

[0029] In a specific embodiment of the present invention, the reaction system of the PCR amplification is 20 μL, comprising: 2×Taq Plus Master MixⅡ10 μL; 0.6 μL of upstream and downstream primers; 1 μL of template DNA; 7.8 μL of deionized water; the reaction procedure of the PCR amplification is: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 30 s, for a total of 35 cycles; extension at 72°C for 7 min; and storage at 4°C after the completion of PCR.

[0030] In a sixth aspect, the present invention claims protection for a molecular marker containing the above-mentioned SNP site ITPR3 g.40886054A>G, the nucleotide sequence of which is shown in SEQ ID NO.1, and the SNP site ITPR3 g.40886054A>G is located at the 138 bp of the nucleotide sequence shown in SEQ ID NO.1.

[0031] Compared with the prior art, the present invention has the following beneficial effects:

[0032] The present invention has discovered for the first time an effective SNP molecular marker that affects the number of lambs born in goats in the ITPR3 gene. The kit provided by the present invention is used to detect the genotype of the molecular marker by PCR amplification and direct product sequencing. The method is simple, rapid, highly accurate and inexpensive. The molecular markers of the present invention are used to screen goats, retain GG homozygous genotype individuals, and eliminate AA homozygous genotype individuals and AG heterozygous genotype individuals, thereby improving the reproductive performance of goats and accelerating the breeding progress of goats, and having high application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 This is the result of 2% agarose gel electrophoresis of the mixed PCR amplification products of ITPR3 g.40886054A>G site (primer P1), where M represents DL100 Plus DNA Marker and 1 represents ITPR3 g.40886054A>G.

[0034] Figure 2 This is the sequencing diagram of the PCR amplification product of ITPR3 g.40886054A>G site (primer is P1); the arrow indicates the mutation site.

[0035] Figure 3 This is the association analysis diagram between ITPR3 g.40886054A>G and the number of second-born lambs of Haimen goats.

[0036] Figure 4 This is the association analysis diagram between ITPR3 g.40886054A>G and the number of lambs born in the third litter of Haimen goats. DETAILED DESCRIPTION

[0037] The technical solution of the present invention is further described in detail below in conjunction with the embodiments and related drawings. However, it is worth noting that the implementation of the present invention is not limited to this, and relevant personnel can implement it in other different forms without violating the purpose and spirit of the present invention.

[0038] Example 1 Typing and Identification of SNP Molecular Markers of ITPR3 Gene in Goats

[0039] 1. Experimental animals and sample collection

[0040] In this experiment, the lambing information of the first three parities of 1100 purebred Haimen goats from Haimen goat farms such as the Yangtze River Delta White Goat Conservation and Reproduction Institute in Haimen District, Nantong City and Jiangsu Jinsheng Goat Breeding Technology Development Co., Ltd. was collected, and the lambing information of 220 Boer hybrid goats (Haimen goats × Boer goats) from Jiangsu Jinsheng Goat Breeding Technology Development Co., Ltd. and 324 purebred Hainan black goats from Xueguli Happy Ecological Ranch in Sanya, Hainan were collected. 10 mL of jugular vein blood samples were collected, placed in anticoagulant tubes containing EDTA, and stored at -20°C.

[0041] 2. Main instruments

[0042] Pipette (Eppendorf), electronic balance (HENGJI), microwave oven (Galanz), refrigerator (Haier), handheld centrifuge (SCILOGEX, S1010E), vortexer (Dalong), digital constant temperature water bath (Changzhou Putian, HH-G2), high-speed refrigerated centrifuge (Eppendorf, 5424R), micro-spectrophotometer (NANODROP2000), PCR instrument (Applied Biosystems), electrophoresis instrument (Beijing Liuyi, DYY-6C), automatic digital gel imaging system (Tanon, Tanon-4100).

[0043] 3. Main Reagents

[0044] TIANGEN blood genomic DNA extraction kit (centrifugal column type), 50×TAE (Solarbio), agarose (BIOWEST), 2×Taq Plus Master MixⅡ (Dye Plus) (Vazyme, P213-03), 10000×TS-GelRed nucleic acid gel dye (TSINGKE, TSJ003), DL2000 Plus DNA Marker (Vazyme, MD102-02).

[0045] 4. Methods

[0046] 4.1 Extraction of genomic DNA from goat blood

[0047] Five hours in advance, the goat blood was taken out of the -20°C refrigerator and placed in a 4°C refrigerator for thawing. After the blood was completely thawed, DNA was extracted from the whole blood according to the instructions of the TIANGEN blood genomic DNA extraction kit.

[0048] DNA concentration and quality were measured using a micro-spectrophotometer. 260 / 280 Should be between 1.80 and 2.00, OD 260 / 230It should be between 1.80 and 2.20. DNA samples that pass the test should be stored in a -20℃ refrigerator.

[0049] 4.2 Primer design for candidate SNP sites

[0050] The Ensembl database (https: / / asia.ensembl.org / index.html) was used to search for SNP loci related to the ITPR3 gene, and PrimerPremier5 software was used to design genotyping primers. The SNP loci and primer information are shown in Tables 1 and 2.

[0051] Table 1 ITPR3 gene SNP site information

[0052]

[0053] Table 2 ITPR3 SNP genotyping primer sequences

[0054]

[0055] 4.3 Primer verification of candidate SNP sites

[0056] 4.3.1 Mixing pool production

[0057] Randomly select 50 samples from the 1100 DNA samples of Haimen goats, take 1 μL from each sample and add it to the same 1.5 mL centrifuge tube to make a DNA pool for subsequent candidate SNP site polymorphism and primer verification. Repeat the above operation in 220 DNA samples of Bo-za sheep and 324 DNA samples of Hainan black goats to make a total of 3 DNA pools.

[0058] 4.3.2 Pooled PCR amplification

[0059] (1) PCR amplification system (20 μL): 2× Taq Plus Master Mix II 10 μL; upstream and downstream primers 0.6 μL each; template DNA 1 μL; deionized water 7.8 μL.

[0060] (2) PCR amplification procedure: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 30 s, for a total of 35 cycles; extension at 72°C for 7 min; storage at 4°C after PCR.

[0061] 4.3.3 Agarose gel electrophoresis of mixed PCR products

[0062] (1) Prepare 2% agarose gel: Measure 1g agarose and 50mL 1×TAE and pour into a conical flask. Heat in a microwave oven on high for 3min until the solution is clear and transparent. Otherwise, extend the heating time appropriately. Let the solution stand until it is no longer hot, then add 5μL nucleic acid dye, mix thoroughly, pour on a plate, and wait for it to solidify.

[0063] (2) After the agarose gel solidifies, the sample loading operation is performed, where the PCR product loading volume is 6 μL and the DNA marker loading volume is 4 μL. Gently place the agarose gel into an electrophoresis tank filled with 1×TAE (the 1×TAE liquid level must cover the gel surface) and perform electrophoresis at 140V300mA for 35 minutes.

[0064] (3) After electrophoresis, transfer the gel to a fully automatic digital gel imaging system for observation.

[0065] The mixed pool DNA was subjected to agarose gel electrophoresis, and the results were as follows Figure 1 As shown in the figure, there is a clear band at the 238bp position of the ITPR3 SNP site, which is consistent with the expected fragment size and has no nonspecific miscellaneous bands, indicating that the primers have good specificity and can be used for subsequent operations.

[0066] 4.4 Genotyping

[0067] 4.4.1 Sample PCR amplification

[0068] (1) PCR amplification system (20 μL): 2× Taq Plus Master Mix II 10 μL; upstream and downstream primers 0.6 μL each; template DNA 1 μL; deionized water 7.8 μL.

[0069] (2) PCR amplification procedure: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 30 s, for a total of 35 cycles; extension at 72°C for 7 min; storage at 4°C after PCR.

[0070] 4.4.2 Sequencing of sample PCR products and result determination

[0071] The above PCR product and primer P1 were sent to Universal Biotechnology for sequencing. The sequencing results showed that the PCR product sequence was as shown in SEQ ID NO.1, and the SNP site ITPR3 g.40886054A>G was located at the 138bp of the nucleotide sequence shown in SEQ ID NO.1.

[0072] TGTCTCGCACACCAGGTTGTAGTTTTGTCTTATTGTTCTGGCAGCGCAGGAAGTTCTGC

[0073] AGAGGATGGGGAGGGATGCGCATGGCGCCGCTGCAGCACGGAGGGAGGGCCTGCCCAGGGAGGGAGGGCCTGCCCAGGG[A / G]CCACAATCACATGGGCAGCAGGGATGGG GCCTCGCCGGCCTCGGAGCCACACATGCCATGGTGCCCAGGCCTGATGCCGGGCGC AGAGTACGTGCAAGTT(SEQ ID NO.1).

[0074] The sequencing results were compared and analyzed using SnapGene software. The genotype of ITPR3 g.40886054A>G was determined according to the sequencing peak diagram: when the peak diagram showed a single peak of A, the genotype was AA; when the peak diagram showed a single peak of G, the genotype was GG; when the peak diagram showed a double peak of A and G, the genotype was AG( Figure 2 ).

[0075] The above results showed that by using primer P1 to perform PCR amplification on goat genomic DNA and interpreting the genotype by direct sequencing, the SNP locus of the goat ITPR3 gene could be rapidly and accurately genotyped and identified. Example 2 Statistical analysis of the polymorphism of the ITPR3 gene SNP locus and its relationship with the high fecundity traits of goats

[0076] 1. Statistical analysis of genetic parameters of different goat populations at the ITPR3 g.40886054A>G locus

[0077] Genotyping was performed on 1100 Haimen goats, 220 Bo crossbred goats and 324 Hainan black goats according to the primers and methods designed in Example 1, and the population genetic parameters of this locus were calculated, including genotype frequency, allele frequency, homozygosity, heterozygosity, effective number of alleles, polymorphism information content and Hardy-Weinberg equilibrium P value.

[0078] The results are shown in Table 3. There were three genotypes of AA, AG and GG at the ITPR3 g.40886054A>G locus in goats. Among them, the AG genotype was the dominant genotype, and A was the dominant allele, showing moderate polymorphism (0.25 < PIC < 0.5). It was in Hardy-Weinberg equilibrium state (P > 0.05) in Bo crossbred goats and Hainan black goats, and not in Hardy-Weinberg equilibrium state (P < 0.05) in Haimen goats

[0079] Table 3 Genetic parameters of different goat populations of the ITPR3 gene

[0080]

[0081] 2. Association between ITPR3g.40886054A>G locus and high fertility traits in goats

[0082] SAS (9.4) software was used to perform least squares statistical analysis using the GLM procedure to analyze the association between different genotypes of ITPR3g.40886054A>G and the number of lambs born in different goat populations.

[0083] Taking genotype and season as fixed effects, the model is: ijk =μ+G i +S j +e ijk In the formula, Y ijk is the phenotypic value of individual lambing number; μ is the population mean; G i is the genotype effect; S j is the seasonal effect; e ijk is a random error.

[0084] 2.1 Analysis of association between ITPR3g.40886054A>G locus and litter size in Haimen goats

[0085] Fixed effects that had no significant association with individual phenotypic values ​​except for genotype effects were deleted, and the association analysis between ITPR3 gene SNP loci and the litter size of Haimen goats was performed. The results were expressed as "least square mean ± standard error".

[0086] The results are shown in Table 4. Figure 3 and Figure 4 As shown, the ITPR3g.40886054A>G locus was significantly correlated with the number of lambs born in the second and third litters of Haimen goats. The number of lambs born in the second litter of ewes with GG genotype was significantly higher than that of ewes with AG genotype; the number of lambs born in the third litter of ewes with GG genotype was significantly higher than that of ewes with AA genotype.

[0087] Table 4 The association results between ITPR3 gene SNP loci and litter size of Haimen goats

[0088]

[0089] Note: Different lowercase letters in the same column indicate significant differences (P<0.05).

[0090] 2.2 Association analysis between ITPR3g.40886054A>G locus and average litter size in different goat populations

[0091] Fixed effects that had no significant association with individual phenotypic values ​​except for genotype effects were deleted, and association analysis between ITPR3 gene SNP loci and the average lamb number of Haimen goats, Bo-za goats and Hainan black goats was performed. The results were expressed as "least square mean ± standard error".

[0092] The results are shown in Table 5. The trend of association analysis results between the ITPR3g.40886054A>G locus and the average lamb number of the corresponding groups in Haimen goats, Bo-za sheep and Hainan black goats was consistent.

[0093] Table 5 The association results between ITPR3 gene SNP loci and the average litter size in different goat populations

[0094]

[0095] Example 3 Method for improving reproductive traits of goats

[0096] The method for improving goat reproductive traits mainly includes the following steps:

[0097] 1. Collect blood from the goat to be tested and extract blood genomic DNA.

[0098] 2. Using the primer P1 described in Example 1, PCR amplification was performed with blood genomic DNA as a template, and the genotype was determined by direct sequencing of the PCR amplification product.

[0099] in:

[0100] (1) PCR amplification system (20 μL): 2× Taq Plus Master Mix II 10 μL; upstream and downstream primers 0.6 μL each; template DNA 1 μL; deionized water 7.8 μL.

[0101] (2) PCR amplification procedure: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 30 s, for a total of 35 cycles; extension at 72°C for 7 min; storage at 4°C after PCR.

[0102] (3) Sequencing: The PCR product and primer P1 were sent to General Biotech for direct sequencing.

[0103] (4) Genotype determination: SnapGene software was used to compare and analyze the peak graphs of the ITPR3g.40886054A>G site sequencing. When the peak graph showed a single peak A, the genotype was AA; when the peak graph showed a single peak G, the genotype was GG; when the peak graph showed a double peak of A and G, the genotype was AG.

[0104] 3.The GG genotype of ITPR3g.40886054A>G can be used as an effective molecular marker to improve the reproductive traits of goats.

[0105] Selecting GG genotype individuals as parents in goat breeding can increase the number of lambs born in the second and third litters.

[0106] By using the SNP molecular markers of the present invention to screen goats, GG homozygous genotype individuals are retained, and AA homozygous genotype individuals and AG heterozygous genotype individuals are eliminated, the breeding goal of improving the reproductive performance of goats can be achieved.

Claims

1. Use of a substance for detecting the polymorphism or genotype of the SNP site ITPR3 g.40886054A>G in the goat genome in any of the following: (a1) Application in identification or auxiliary identification of reproductive traits of goats; (a2) Use in the preparation of products for identifying or assisting in identifying reproductive traits of goats; (a3) Application in screening or assisting in screening goats with high reproductive traits; (a4) Use in preparing products for screening or assisting in screening goats with reproductive traits of highland goats; (a5) Application of reproductive traits of mountain goats in goat breeding; The SNP site ITPR3 g.40886054A>G is located at the 40886054bp base of chromosome 23 of the goat genome, and its polymorphism is A or G.

2. The use according to claim 1, characterized in that: The reproductive trait is the number of lambs born, and the genotype of the SNP site ITPR3 g.40886054A>G is significantly correlated with the number of lambs born in the second and third litters of goats; the number of lambs born in the second litter of ewes with GG genotype is significantly higher than that of ewes with AG genotype; the number of lambs born in the third litter of ewes with GG genotype is significantly higher than that of ewes with AA genotype.

3. The use according to claim 1, characterized in that: The substance is (b1) or (b2) or (b3) as follows: (b1) PCR primers for amplifying a goat genomic DNA fragment containing the SNP site ITPR3 g.40886054A>G; (b2) a PCR reagent containing the PCR primers described in (b1); (b2) A kit containing the PCR primers described in (b1) or the PCR reagents described in (b2).

4. The use according to claim 3, characterized in that: The PCR primers include an upstream primer F1 and a downstream primer R1; Upstream primer F1: 5′-AACTTGCACGTACTCTGCGC-3′; Downstream primer R1: 5′-TGTCTCGCACACCAGGTTGT-3′.

5. Use of the PCR primers described in claim 3 or 4 in the preparation of a product for detecting the polymorphism or genotype of the SNP site ITPR3g.40886054A>G described in claim 1.

6. A product, characterized in that The product contains the substance described in claim 3 or the PCR primer described in claim 4.

7. A method for identifying or assisting in identifying reproductive traits of goats, characterized in that: The polymorphism or genotype of the SNP site ITPR3 g.40886054A>G in the goat genome described in claim 1 is detected; the number of lambs born in the second litter of ewes with GG genotype is significantly higher than that of ewes with AG genotype; the number of lambs born in the third litter of ewes with GG genotype is significantly higher than that of ewes with AA genotype.

8. A method for breeding goats with high reproductive traits, characterized in that: Detect the polymorphism or genotype of the SNP site ITPR3 g.40886054A>G in the goat genome described in claim 1; retain the GG homozygous genotype individuals, eliminate the AA homozygous genotype individuals and the AG heterozygous genotype individuals, and increase the number of goats born from generation to generation.

9. The method according to claim 7 or 8, characterized in that: The method for detecting the polymorphism or genotype of the SNP site ITPR3g.40886054A>G in the goat genome is: using the genomic DNA of the goat blood to be tested as a template, using the PCR primers described in claim 3 or 4 or the product described in claim 6 to perform PCR amplification, and using a method of direct sequencing of the PCR amplification product to determine the polymorphism or genotype of the SNP site ITPR3 g.40886054A>G in the goat genome described in claim 1.

10. A molecular marker comprising the SNP site ITPR3 g.40886054A>G of claim 1, characterized in that: The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1, and the SNP site ITPR3g.40886054A>G is located at the 138th bp of the nucleotide sequence shown in SEQ ID NO.1.

Images