Wheat plant height related SNP site 353A / C and application thereof

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) site related to wheat plant height and application thereof. The SNP site corresponds to the 353 basic group from the 5'tail end of a nucleotide sequence shown as SEQ ID NO.1, and the nucleotide polymorphism at the site is shown as R = C or A; the site has a C / C homozygous genotype and an A / A homozygous genotype, and the plant height of a C / C genotype wheat material is obviously higher than that of an A / A genotype wheat material. The SNP locus disclosed by the invention not only expands gene resource tools of wheat, but also has good and wide application potential through scientific research test and data statistics verification.

Description

Technical Field

[0001] The invention relates to the technical field of molecular biology, in particular to a SNP site associated with wheat plant height and an application thereof. Background Art

[0002] Wheat (Triticum aestivum L) is one of the most important food crops in my country and even in the world. Its output is second only to rice and corn, accounting for about 35% of the world's total grain output, and provides the largest source of protein for human diet. With the rapid growth of the global population, it is necessary to continuously increase wheat production to ensure the global food supply. Plant height is an important agronomic trait that affects the increase of wheat yield. Therefore, determining the locus or gene of the plant height trait is of great significance for marker-assisted selection in wheat breeding.

[0003] Plant height of wheat is closely related to lodging resistance, which will affect yield. Zhou et al. used a recombinant inbred line population of Yangmai 158 and Xifeng to molecularly locate the QTL affecting plant height of the population. Chen et al. used a wild two-grain wheat chromosome arm replacement line CASL7AS as the female parent and Zhejiang Agricultural Forestry 12 as the male parent to obtain a DH population. They used a 55K SNP chip to construct a high-density genetic map and performed QTL analysis on wheat plant height traits. A total of 53 QTL loci were detected on chromosomes 1A, 3A, 5A, 7A, 1B, 3B, 4B, 5B, 7B, 2D, 4D, 6D and 7D.

[0004] Although a large number of plant height-related QTLs have been identified, the genetic effects of most QTLs are still unclear and the phenotypic contribution of QTLs is small, with poor repeatability between different years and environments; therefore, most QTLs are difficult to apply to the genetic improvement of wheat plant height. In other words, it is of great significance to develop stable major SNP functional sites and develop molecular markers with practical significance based on them and use them for molecular improvement of wheat plant height. Summary of the invention

[0005] The technical problem to be solved by the present invention is to provide a SNP site related to wheat plant height, and at the same time to conduct technical research and application expansion on its potential applications in wheat molecular breeding, agricultural production increase, etc.

[0006] In order to solve the above technical problems, the technical solutions adopted by the present invention are as follows.

[0007] The SNP site associated with wheat plant height corresponds to the 353rd base from the 5' end of the nucleotide sequence shown in SEQ ID NO.1 in the sequence table, and the nucleotide polymorphism at this site is R=C or A.

[0008] As a preferred technical solution of the present invention, when the nucleotide at the SNP site is homozygous for C / C, the corresponding genotype is type A or type I; when the nucleotide at the SNP site is homozygous for A / A, the corresponding genotype is type B or type II; and the plant height of type A or type I wheat is significantly greater than / candidate greater than the plant height of type B or type II wheat.

[0009] The use of the SNP site is to conduct theoretical research on the principles of wheat plant height development based on the SNP site, and / or to study the molecular regulatory pathway of wheat plant height development based on the SNP site; including: based on the SNP site, confirming, identifying and / or distinguishing the downstream associated effector molecules through site genotype differences, and constructing a wheat plant height molecular regulatory pathway; the effector molecules include but are not limited to messenger RNA, proteins, associated biological enzymes, various molecular regulatory components, and various molecular signal components; further, on the basis of constructing the wheat plant height molecular regulatory pathway, identifying and confirming the main effect or key regulatory nodes and their corresponding biological macromolecules or small molecule components.

[0010] The use of the SNP site is to develop molecular markers based on the SNP site and existing molecular biological techniques, and further screen or assist in screening wheat plant height phenotypes in the early stages of molecular marker-assisted selection breeding.

[0011] The use of the SNP site is to regulate the wheat plant height according to production needs in the agricultural industry based on the SNP site, including: increasing the wheat plant height or reducing the wheat plant height.

[0012] A gene detection kit for detecting the SNP site described in claim 1, wherein the gene detection kit comprises a PCR amplification specific primer combination and a specific restriction endonuclease, as well as template DNA, 2×Taqmix, dNTPs and other necessary components for gene detection.

[0013] The PCR amplification specific primer combination includes: primer pair 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3 in the sequence list, and / or primer pair 2F and 2R composed of SEQ ID NO.4 and SEQ ID NO.5 in the sequence list; the specific restriction endonuclease is specifically: restriction endonuclease EcoRII.

[0014] The molecular marker combination related to wheat plant height traits includes: molecular marker A obtained by amplifying the 5' end 173-698 sequence in SEQ ID NO.1 using 1F and 1R as primer pair; and / or molecular marker B obtained by amplifying the 5' end 328-574 sequence in SEQ ID NO.1 using 2F and 2R as primer pair.

[0015] The primer combination is used to detect the genotype of the SNP site of claim 1, specifically comprising: primer pair 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3 in the sequence list, and / or primer pair 2F and 2R composed of SEQ ID NO.4 and SEQ ID NO.5 in the sequence list.

[0016] A method for identifying or assisting in identifying wheat plant height in the early stage of breeding, wherein in the early stage of molecular marker-assisted selection breeding, primers are designed to perform PCR amplification on any DNA fragment containing the SNP site in the wheat genomic DNA to be tested, the wheat genotype is identified by enzyme digestion of the PCR amplification product, and the wheat plant height phenotype is identified or assisting in identifying based on the following correlation between genotype and phenotype: when the nucleotide at the SNP site is homozygous for C / C, the corresponding genotype is type A or type I, and when the nucleotide at the SNP site is homozygous for A / A, the corresponding genotype is type B or type II, and the plant height of type A or type I wheat is significantly greater than / candidate greater than the plant height of type B or type II wheat.

[0017] The beneficial effect of adopting the above technical solution is that the high-density gene data information analysis of the genetic wheat population by the research group of the present invention is associated with multiple quantitative gene loci, and on this basis, SNP sites related to wheat plant height with multi-environment stable main effect value potential are further developed and confirmed. Experiments have shown that by detecting the SNP, wheat with relatively high or low plant height can be found. The SNP site provides genetic resources and molecular markers for wheat genetic improvement, and further provides a new method for molecular marker-assisted selection breeding of wheat, which is of great significance in the breeding of high-yield wheat varieties and research. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 It is the electrophoresis detection result of the SNP development dCAPS labeling enzyme cleavage product of the present invention; wherein, lane M is the molecular weight standard; lane A is the band cleaved by EcoRII, and lane C is the band that cannot be cleaved by EcoRII.

[0019] Figure 2 These are the results of the analysis of the two types I and II in natural populations and their association with plant height. DETAILED DESCRIPTION

[0020] The following examples illustrate the present invention in detail. The various raw materials and equipment used in the present invention are all conventional commercial products and can be directly obtained through market purchase. The wheat materials used in the following examples are all from the National Crop Germplasm Bank (http: / / icscaas.com.cn / jiguoku / zhongzhiku.htm), and the material information can be found in the China Crop Germplasm Information Network, website: http: / / icgr.caas.net.cn.

[0021] It should be understood that when used in the present specification and the appended claims, the term "comprising" indicates the presence of the described features, integrals, steps, operations, elements and / or components, but does not exclude the presence or addition of one or more other features, integrals, steps, operations, elements, components and / or their collections. It should also be understood that the term "and / or" used in the present specification and the appended claims refers to any combination of one or more of the associated listed items and all possible combinations, and includes these combinations.

[0022] As used in the specification and appended claims of this application, the term "if" can be interpreted as "when" or "uponce" or "in response to determining" or "in response to detecting", depending on the context. Similarly, the phrase "if it is determined" or "if [described condition or event] is detected" can be interpreted as meaning "uponce it is determined" or "in response to determining" or "uponce [described condition or event] is detected" or "in response to detecting [described condition or event]", depending on the context.

[0023] In addition, in the description of the present application specification and the attached claims, the terms "first", "second", "third", etc. are only used to distinguish the description and cannot be understood as indicating or implying relative importance. The reference to "one embodiment" or "some embodiments" described in the present application specification means that one or more embodiments of the present application include specific features, structures or characteristics described in conjunction with the embodiment. Therefore, the statements "in one embodiment", "in some embodiments", "in some other embodiments", "in some other embodiments", etc. that appear in the different parts of this specification do not necessarily refer to the same embodiment, but mean "one or more but not all embodiments", unless otherwise specifically emphasized in other ways. The terms "including", "comprising", "having" and their variations all mean "including but not limited to", unless otherwise specifically emphasized in other ways.

[0024] Example 1: Specific primers for amplifying the genome fragment containing the wheat SNP and sequence analysis

[0025] The developed SNP should be located at position 353 from the 5' end of sequence table 1; this site has two genotypes in the natural variation population of wheat:

[0026] Genotype A: C

[0027] Genotype B: A

[0028] According to the sequence differences of different wheat genomes, specific primers were designed to PCR amplify the DNA fragments containing the SNP sites:

[0029] F1: TCTTGGGGTCGGTGATTACCGCCGATTACT; (SEQ ID NO.2)

[0030] R1: CTTTTGTCTTCTTTGGAGTATTGCTCCGAT; (SEQ ID NO.3)

[0031] F2: CCGCCTCCATCAGACCCTCGGCACC; (SEQ ID NO.4)

[0032] R2: ACGCTGGCAAGACAGTTAAATGTTT; (SEQ ID NO.5)

[0033] The target sequence amplified by PCR using F1 and R1 as primers is the 173-698 sequence shown in Sequence 1 of the sequence list; the target sequence amplified by PCR using F2 and R2 as primers is the 328-574 sequence shown in Sequence 1 of the sequence list. Enzyme digestion analysis showed that the polymorphisms can be recognized by EcoRII respectively.

[0034] Example 2: Establishment of PCR-enzyme digestion polymorphism detection and genotyping method

[0035] 1) Extracting genomic DNA of wheat to be tested;

[0036] 2) Using the genomic DNA from step 1) as a template, PCR amplification was performed with primers F1 and R1. The PCR amplification system (10 μL) was: 3.5 μL ddH2O, 0.5 μL each of primer F1 (10 μmol / L) and primer R1 (10 μmol / L), 5 μL 2×Taqmix, and 0.5 μL of template (20 ng / μL).

[0037] The PCR amplification conditions were 95°C for 2 min; 95°C for 30 s, 60°C for 30 s, 72°C for 1 min, 30 cycles; 72°C for 10 min, and stored at 16°C.

[0038] 3) The PCR product of step 2) was diluted 10 times and used as a template for PCR amplification using primers F2 and R2. The PCR amplification system (20 μL) was: 7 μL of ddH2O, 1 μL each of primer F2 (10 μmol / L) and primer R2 (10 μmol / L), 10 μL of 2×Taq mix, and 1 μL of template (20 ng / μL).

[0039] The PCR amplification conditions were as follows: 95°C for 2 min; 95°C for 30 s, 60°C for 30 s, 72°C for 20 s, 34 cycles; 72°C for 10 min, and storage at 16°C.

[0040] 4) The PCR product obtained in step 3) is digested with EcoRII to obtain the digestion product, and then the digestion product is detected by 4% agarose gel electrophoresis. It is recorded whether the PCR product is cut into two fragments, and the situation of the wheat to be tested at the site is determined and recorded according to the following method:

[0041] If the enzyme cleavage product is two fragments, the wheat to be tested is A homozygous (expressed as A / A) at the site ( Figure 1 Lane A in

[0042] If the enzyme cleavage product is a fragment, the wheat to be tested is C homozygous (expressed as C / C) at the site ( Figure 1 Lane C in the figure).

[0043] 5) According to the result of step 4), the wheat is divided into two types, I and II, at the site:

[0044] I: C / C (i.e., homozygous for genotype A);

[0045] II: A / A (i.e., homozygous for genotype B);

[0046] The " / " before the " / " refers to the situation on one homologous chromosome, and the " / " after the " / " refers to the situation on the other homologous chromosome.

[0047] Example 3: Using dCAPs markers to type natural populations and conduct association analysis with plant height traits.

[0048] Each wheat in the natural population consisting of 323 hexaploid wheats was used as the wheat to be tested, and typing was performed according to the method in step 2. The amplified products of some wheats were randomly sequenced and verified. The results are shown in Table 1.

[0049] Table 1 The situation of the polymorphic sites in natural wheat populations

[0050]

[0051]

[0052]

[0053]

[0054]

[0055] Example 4: Results of analysis of gene polymorphisms and their association with plant height in natural populations

[0056] See attached Figure 2 As shown in Table 2, the above natural population wheat was planted in dry land, water land, drought-heat, and hydrothermal fields of the Experimental Farm of Crop Science Institute of Chinese Academy of Agricultural Sciences (Shunyi, Beijing), as well as in dry land, water land, drought-heat, and hydrothermal fields of the Experimental Farm of Crop Science Institute of Chinese Academy of Agricultural Sciences (Shunyi, Beijing). The plant height of each wheat variety was investigated, and the association analysis between plant height and the polymorphic loci was performed using Tassel 5.0 software. The mixed linear model + population structure (MLM+(Q+K)) method was selected for analysis, with P<0.05 as the significance level. The results are shown in Table 2 and the attached Figure 2 shown.

[0057] Table 2 Results of association analysis between gene polymorphism sites and plant height in natural populations

[0058]

[0059] The results of association analysis in Table 2 show that the differences in plant height between the two types formed by the natural population composed of 323 hexaploid wheats shown in Table 1 reached a significant level (P<0.05). Among them, the plant height of type I wheat is higher than that of type II wheat. In several environments, the plant height of type I wheat materials is 12.102cm, 11.177cm, 11.560cm, 10.819cm, 9.141cm, 10.927cm, 11.088cm, and 14.079cm higher than that of type II wheat. Studies on natural populations have shown that type I is an excellent genotype for improving wheat plant height.

[0060] In the above embodiments, the description of each embodiment has its own emphasis. For parts that are not described or recorded in detail in a certain embodiment, reference can be made to the relevant descriptions of other embodiments.

[0061] From the above examples, it can be seen that in the research of this application, through the genetic variation analysis of the natural variation population of wheat, multiple SNPs were found. The core SNP significantly associated with wheat plant height is located at position 353 from the 5' end of SEQ ID NO.1 in the sequence list.

[0062] This SNP has two genotypes: genotype A / Type I (CC) and genotype B / Type II (AA). Association analysis has shown that in the homozygous types of these two genotypes, the order of plant height is: wheat homozygous for genotype A > wheat homozygous for genotype B.

[0063] The present invention also provides a dCAPS marker for detecting the SNP. Experiments have shown that by detecting the SNP, wheat with a higher plant height can be found. The present invention provides a new method for molecular marker-assisted selection breeding of wheat, which can effectively improve the efficiency of molecular breeding and accelerate the wheat breeding process, and is of great significance in the cultivation and research of high-yield wheat varieties.

[0064] The embodiments described above are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that the technical solutions described in the aforementioned embodiments may still be modified, or some of the technical features may be replaced by equivalents. Such modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention, and should all be included in the protection scope of the present invention.

Claims

1. A SNP locus associated with wheat plant height, characterized by: The SNP site corresponds to the 353rd base from the 5' end of the nucleotide sequence shown in SEQ ID NO.1 in the sequence table, and the nucleotide polymorphism at this site is expressed as R=C or A.

2. The SNP site according to claim 1, characterized in that: When the nucleotide at the SNP site is homozygous for C / C, the corresponding genotype is type A or type I; when the nucleotide at the SNP site is homozygous for A / A, the corresponding genotype is type B or type II; and the plant height of type A or type I wheat is significantly greater than / candidate greater than the plant height of type B or type II wheat.

3. The use of the SNP site according to claim 2, characterized in that: The use is to conduct theoretical research on the principles of wheat plant height development based on the SNP site, and / or to study the molecular regulatory pathway of wheat plant height development based on the SNP site; including: based on the SNP site, confirming, identifying and / or distinguishing the downstream associated effector molecules through site genotype differences, and constructing a wheat plant height molecular regulatory pathway; the effector molecules include but are not limited to messenger RNA, proteins, associated biological enzymes, various molecular regulatory components, and various molecular signal components; further, on the basis of constructing the wheat plant height molecular regulatory pathway, identifying and confirming the main effect or key regulatory nodes and their corresponding biological macromolecules or small molecule components.

4. The use of the SNP site according to claim 1, characterized in that: The use is to develop molecular markers based on the SNP sites and existing molecular biological techniques, and further screen or assist in screening wheat plant height phenotypes in the early stages of molecular marker-assisted selection breeding.

5. The use of the SNP site according to claim 1, characterized in that: The use is to regulate the wheat plant height in the agricultural industry according to production needs based on the SNP site, including: increasing the wheat plant height or reducing the wheat plant height.

6. A gene detection kit, characterized in that: Used to detect the SNP site described in claim 1, the gene detection kit contains a PCR amplification specific primer combination and a specific restriction endonuclease, as well as template DNA, 2×Taq mix, dNTPs and other necessary components for gene detection.

7. The gene detection kit according to claim 6, characterized in that: The PCR amplification specific primer combination includes: primer pair 1F and 1R composed of SEQ ID NO.2 and SEQ ID NO.3 in the sequence list, and / or primer pair 2F and 2R composed of SEQ ID NO.4 and SEQ ID NO.5 in the sequence list; the specific restriction endonuclease is specifically: restriction endonuclease Eco RII.

8. A combination of molecular markers associated with wheat plant height traits, characterized in that: include: Molecular marker A is obtained by amplifying the 5' end 173-698 sequence in SEQ ID NO.1 using 1F and 1R as primer pair; and / or molecular marker B is obtained by amplifying the 5' end 328-574 sequence in SEQ ID NO.1 using 2F and 2R as primer pair.

9. A primer combination, characterized in that: The primer combination is used to detect the genotype of the SNP site described in claim 1, specifically comprising: primer pair 1F and 1R composed of SEQ ID NO. 2 and SEQ ID NO. 3 in the sequence list, and / or primer pair 2F and 2R composed of SEQ ID NO. 4 and SEQ ID NO. 5 in the sequence list.

10. A method for identifying or assisting in identifying wheat plant height in the early stage of breeding, characterized in that: Based on the SNP site described in claim 1, in the early stage of molecular marker-assisted selection breeding, primers are designed to perform PCR amplification on any DNA fragment containing the SNP site in the wheat genomic DNA to be tested, the wheat genotype is identified by enzyme digestion of the PCR amplification product, and the wheat plant height phenotype is identified or assisted in identification based on the following correlation between genotype and phenotype: when the nucleotide at the SNP site is homozygous for C / C, the corresponding genotype is type A or type I, and when the nucleotide at the SNP site is homozygous for A / A, the corresponding genotype is type B or type II, and the plant height of type A or type I wheat is significantly greater than / candidate greater than the plant height of type B or type II wheat.

Images