A method for breeding a new red-fleshed and seedless grape variety based on molecular markers

By digging the molecular markers R1 and S1 related to red meat and kernelless traits in grapes, and developing breeding methods based on these marks, the problems of low breeding efficiency and high cost in the prior art are solved, and an efficient method for screening out new red meat kernelless varieties in the early stage of grape hybrid seedlings is realized.

CN119433074BActive Publication Date: 2025-07-01INST OF BOTANY CHINESE ACAD OF SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411527689.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-10-30
Publication Date
2025-07-01
Estimated Expiration
2044-10-30

AI Technical Summary

Technical Problem

It is difficult to efficiently breed new varieties of high-quality seedless grapes with independent intellectual property rights in the prior art, especially in the combination of red meat and seedless traits, which leads to low breeding efficiency and high cost.

Method used

Through genome-wide analysis, the molecular markers R1 and S1, which are significantly related to the red meat and anuclear traits of grapes were mined, and a set of breeding methods based on these marks were developed. PCR amplification and agar gel electrophoresis detection technology can accurately screen new red meat seedlings that meet the breeding targets in the early stage of hybrid seedlings.

Benefits of technology

It has achieved the accurate screening of new red-sized seedless grape varieties in the early stages of hybrid seedlings, which significantly improved breeding efficiency, reduced breeding cycle and cost, and supported efficient molecular assisted breeding of new red-sized seedless grape varieties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119433074B_ABST
    Figure CN119433074B_ABST
Patent Text Reader

Abstract

The present invention discloses a method for breeding new varieties of red-fleshed and seedless grapes based on molecular markers, belonging to the field of biological breeding. By means of a whole-genome analysis method, the present invention discovers molecular markers significantly associated with the traits of red-fleshed and seedless grapes. These molecular markers have broad-spectrum characteristics. By using the electrophoretic band types of amplified molecular marker gene fragments, the phenotypic traits of red-fleshed and seedless grapes can be accurately identified at the early stage of hybrid seedlings, saving at least 5 years of breeding cycle compared with traditional breeding and culture breeding, significantly shortening the breeding period, saving a large amount of land and management investment, improving breeding efficiency, and providing support for the efficient molecular-assisted breeding of new varieties of red-fleshed and seedless grapes.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biological breeding, and particularly to a method for breeding new red - flesh and seedless grape varieties based on molecular markers. Background Art

[0002] China is a major producer and consumer of table grapes. Since 2010, China's grape production has ranked first in the world. 80% of the grapes produced in China are table grapes, and the output of Chinese table grapes accounts for about half of the world's.

[0003] Variety is one of the key factors determining fruit quality, and using excellent varieties is the prerequisite for producing high - quality fruits. Currently, 70% of the varieties used in grape production in China are introduced from abroad. These varieties have poor adaptability to China's climate conditions, and there is an urgent need for the breeding and promotion of new grape varieties with independent intellectual property rights in production.

[0004] Convenient - to - eat seedless grapes have always been favored by people, and seedless grapes are also the breeding goals of breeders. Currently, 90% of table grapes in the United States are seedless grapes. The cultivation of seedless grapes in Chile has developed rapidly, and the planting variety structure has gradually changed from seeded varieties to seedless varieties. Currently, the area of seedless varieties has exceeded 50%. It can be said that seedless grapes are an inevitable trend in the development of the table grape industry. At present, the breeding of new seedless grape varieties in China still mainly relies on traditional hybridization. In the process of obtaining hybrid seedlings, although embryo rescue technology can increase the probability of seedless plant lines in the hybrid population, the selection in the later stage of the population still needs to wait until after planting and the hybrid lines have stable fruit set, which takes at least 5 years, with low efficiency and high cost. Although there are publications on seedless molecular markers, most of them are in the research on marker development and verification. There is no report on the actual use of a single seedless - related marker for screening offspring and breeding lines.

[0005] The fruit quality and nutritional value of varieties are also key factors determining their economic value. Fruit anthocyanins not only directly affect consumers' preference for grapes but also have good effects on human health. Cultivating new high - quality (high anthocyanin content) seedless grape varieties is an urgent need for the development of China's grape industry and also the breeding goal of functional varieties. Therefore, China urgently needs to accelerate the breeding progress of new high - quality (high anthocyanin content) seedless grape varieties with independent intellectual property rights. Currently, there is no report on red - flesh molecular markers, and no molecular markers combining seedless traits and high - quality traits have been applied to actual breeding. Using genomic technology to carry out multi - trait molecular marker - assisted breeding is an inevitable trend in the innovation and development of China's grape germplasm and also a necessary means to improve the germplasm innovation ability. Summary of the Invention

[0006] The object of the present invention is to provide a method for breeding new red-fleshed and seedless grape varieties based on molecular markers to solve the problems existing in the above-mentioned prior art. By mining genomic data, molecular markers significantly related to broad-spectrum red-fleshed and seedless traits are obtained, and a method for breeding new red-fleshed and seedless grape varieties is constructed, which can accurately and efficiently screen out new red-fleshed and seedless grape varieties that meet the breeding objectives at the initial stage of hybrid seedlings, improving the breeding efficiency and reducing the breeding cost.

[0007] To achieve the above object, the present invention provides the following solutions:

[0008] The present invention provides a molecular marker for identifying new red-fleshed and seedless grape varieties, including a molecular marker R1 for identifying red-fleshed grape pulp and a molecular marker S1 for identifying seedless grapes. The molecular marker R1 is located in the upstream promoter region of the key grape gene VvMYBA1, and the molecular marker R1 contains ≥2 copies of the MYBA1 promoter. The promoter sequence is as shown in SEQ ID NO: 2. The nucleotide sequence of the molecular marker S1 is as shown in SEQ ID NO: 3, and there is a 70bp deletion starting from the 121st position in this sequence. The deleted fragment is as shown in SEQ ID NO: 4.

[0009] The present invention also provides a method for breeding new red-fleshed and seedless grape varieties, including the step of breeding new red-fleshed and seedless grape varieties using the above-mentioned molecular markers.

[0010] Preferably, the method includes the following steps:

[0011] Extract DNA from the young tissues of grape hybrid seedlings, and then use the primer pairs shown in SEQ ID NO: 5-6 to amplify the molecular marker S1, and the primer pairs shown in SEQ ID NO: 7-8 to amplify the molecular marker R1. According to the band types of the amplification products, breed new red-fleshed and seedless grape varieties.

[0012] Preferably, at least one of the parents of the hybrid seedlings is a red-fleshed variety parent and at least one is a seedless variety parent.

[0013] Preferably, the reaction system for amplification includes: 25 μL of 2×Rapid Taq Master Mix, 2 μL of upstream primer, 2 μL of downstream primer, 0.1-1 μg of DNA template, and ddH2O is added to make the total volume 50 μL.

[0014] Preferably, the amplification reaction program is as follows: denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 59°C for 30 s, with the annealing temperature decreasing by 0.5°C for each cycle, extension at 72°C for 30 s, for a total of 5 cycles; denaturation at 94°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 30 s, for a total of 25 cycles; finally, extension at 72°C for 5 min; preservation at 4°C.

[0015] Preferably, when the molecular marker R1 has double bands of 638 bp and (638 + 408n) bp, it is a red - flesh grape, and when it has a single band of 638 bp, it is a white - flesh grape, where n is a natural number greater than or equal to 1; when the molecular marker S1 has a single band of 284 bp, it is a seeded grape, and when it has a band of 214 bp, it is a seedless grape.

[0016] Preferably, the hybrid seedling variety that retains the molecular marker R1 with double bands of 638 bp and (638 + 408n) bp and at the same time the molecular marker S1 with a band of 214 bp is the new hybrid variety of red - flesh and seedless grapes.

[0017] The present invention also provides a primer pair for identifying new varieties of red - flesh and seedless grapes. The nucleotide sequences of the primer pair are as shown in SEQ ID NO: 5 - 8. Among them, the primer pair shown in SEQ ID NO: 5 - 6 is used for amplifying the molecular marker S1, and the primer pair shown in SEQ ID NO: 7 - 8 is used for amplifying the molecular marker R1.

[0018] The present invention also provides the application of the above - mentioned molecular marker or the above - mentioned primer pair in the breeding of new grape varieties.

[0019] The present invention discloses the following technical effects:

[0020] Through the whole - genome analysis method, the present invention has mined molecular markers (i.e., molecular marker R1 and molecular marker S1) significantly related to the red - flesh and seedless traits of grapes. Based on this molecular marker, a set of methods suitable for breeding new varieties of red - flesh and seedless grapes has been developed. This method uses agar gel electrophoresis for detection, which is convenient, fast, has stable results, is not affected by the environment, and has the characteristics of quickly and accurately screening grape single plants with red pulp and seedless traits. Identification and screening of hybrid offspring can be carried out at the seedling stage of hybrid seedlings, reducing the breeding cycle, saving a large amount of land and management investment, and improving the breeding efficiency.

[0021] Compared with the traditional breeding methods in the prior art, the present invention provides a broad - spectrum single seedless marker combined with a red - flesh marker, which can simultaneously carry out early identification and screening of seedlessness and red - flesh for hybrid offspring, saving at least 5 years of breeding cycle compared with traditional breeding and culture breeding. The molecular markers and breeding methods provided by the present invention can be used for early screening of hybrids of red - flesh and seedless grapes, providing support for the efficient molecular - assisted breeding of new varieties of red - flesh and seedless grapes. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0023] Figure 1 Identification bands for red-fleshed plant lines of the population progeny (red-fleshed plant lines have two bands); from left to right, the bands are Marker, 'No. 19' (red-fleshed), 'No. 35' (red-fleshed), 'No. 38' (red-fleshed), 'No. 69' (red-fleshed), 'No. 82' (red-fleshed), 'No. 85' (red-fleshed), and 'No. 136' (white-fleshed);

[0024] Figure 2 Identification bands for seedless plant lines of the population progeny (the positions of seedless plant lines are relatively far); from left to right, the bands are 'No. 19' (seeded), 'No. 35' (seedless), 'No. 38' (seedless), 'No. 69' (seedless), 'No. 82' (seeded), 'No. 85' (seedless), 'No. 136' (seeded), and Marker;

[0025] Figure 3 External view of the cut grape of the seedless red-fleshed plant line 'No. 69'. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0026] Now, various exemplary embodiments of the present invention will be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, characteristics, and implementation schemes of the present invention.

[0027] It should be understood that the terms described in the present invention are only for describing specific embodiments and are not used to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded from the range.

[0028] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0029] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0030] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0031] Example 1 A molecular marker for identifying new varieties of red-fleshed and seedless grapes

[0032] The present invention uses the whole genome sequencing data of the red-fleshed grape 'Yan 73' and the seedless grape 'No Seed White', and compares the whole genome with the Eurasian grape 'Cabernet Sauvignon', 'Pinot Noir', 'Chardonnay' and Eurasian wild species, and combines gene expression and linkage to obtain a broad spectrum of red meat and seedless trait molecular markers:

[0033] Characteristics of the red flesh molecular marker (REDFLESH, denoted as R1): This molecular marker is located in the upstream promoter region of the key gene VvMYBA1 regulated by grape anthocyanins, and the nucleotide sequence is shown in SEQ ID NO: 1. This molecular marker is a copy number variation (CNV) molecular marker that is closely linked to the flesh color trait. The promoter variation copy number of this molecular marker affects the expression of VvMYBA1. When the promoter copy number is ≥2, VvMYBA1 is expressed in the flesh, making the flesh red. At the same time, there is a natural segment with a copy number of 1 on the grape genome, which can be used as a control, so it is used as a marker for identifying flesh color.

[0034] Characteristics of the seedless molecular marker (SEEDLESS, denoted as S1): Using GWAS for genome-wide analysis of the seedless trait, multiple SNP loci of MADS8 were mined. Through linkage analysis and in-depth mining of re-sequencing data, an InDel with a 70bp deletion highly linked to these SNPs was discovered. The sequence of the InDel molecular marker is as shown in SEQ ID NO: 3. Starting from position 121 of this sequence, a 70bp sequence is deleted, and the deleted sequence is as follows (SEQ ID NO: 4). After verification, this InDel is closely related to the seedless trait of grapes and can therefore be used as a marker for identifying seeded and seedless grapes.

[0035] The sequence shown in SEQ ID NO: 1:

[0036]

[0037]

[0038] The underlined part in the sequence is the 408bp sequence (SEQ ID NO: 2) of the MYBA1 promoter variation, 408×3bp.

[0039] SEQ ID NO: 3 is as follows:

[0040] TTCAGGATAGGGAGGTCTGAACTCAGTTGAAGGAATAGTAAAAGAAGACAAAGCAACTATTAGAGCTTAAGAAGAGTCCCATTTTAGTATTAGTGACTTCATACTACAAAGAAAACTTAG GGAAAAAAAAAACTCAATTAGAAA AAAGTCTTTTTGACAAGATTAGGATTACTGATATGGGTCTTAGCAT GTAAGCAATCATGTTCATGCATTCCAATTCTTTCTATTCTTGTTTTCCTTTTTTCCTTTTTTTCACCTAATATTTGTTGAGATGAAAAGTGGCT.

[0041] The underlined part of the sequence is the deleted 70bp sequence (SEQ ID NO: 4).

[0042] Example 2 A method for breeding new varieties of red-fleshed and seedless grapes

[0043] 1. Configuration of hybridization combinations

[0044] Select suitable parents and configure hybridization combinations. To breed new superior seedless and red-fleshed varieties, when configuring combinations, one of the two parents must include a red-fleshed variety parent and a seedless variety parent. The red-fleshed variety parent can be used as the female parent or the male parent. If the seedless variety parent is used as the female parent, embryo culture needs to be carried out after flowering, and embryo rescue is carried out to obtain hybrid seedlings; the flowering period of the male parent variety should be the same as or earlier than that of the female parent.

[0045] 2. Obtaining Hybrid Seedlings

[0046] When a seeded variety is used as the female parent, after obtaining mature hybrid seeds through hybridization, hybrid seedlings are obtained through temperature alternation treatment at 20 / 30 °C; when a seedless variety is used as the female parent, hybrid seedlings are obtained through embryo rescue.

[0047] 3. Sampling and DNA Extraction

[0048] Collect young tissues such as young leaves and tender stems of hybrid seedlings, and extract DNA using an improved CTAB plant genomic DNA rapid extraction kit. Dilute the extracted DNA concentration to about 200 ng / μL and store it at -20 °C.

[0049] 4. PCR Amplification

[0050] 4.1 PCR Detection Primers

[0051] Design primers according to the seedless molecular marker S1 and the red-fleshed molecular marker R1 provided by the present invention:

[0052] Seedless molecular marker S1:

[0053] F (SEQ ID NO: 5): 5’-TTCAGGATAGGGAGGTCTGAA-3’;

[0054] R (SEQ ID NO: 6): 5’-AGCCACTTTTCATCTCAACAAA-3’.

[0055] Red-fleshed molecular marker R1:

[0056] F (SEQ ID NO: 7): 5’-CAGTGAGGGTAACAAAGTCA-3’;

[0057] R (SEQ ID NO: 8): 5’-AAGGGTGTGTGTCATAAGAG-3’.

[0058] Use the above primers for detection.

[0059] 4.2 PCR Reaction System (50 μL)

[0060] All operations are carried out on ice. The total PCR amplification reaction system is 50 μL, as follows:

[0061] Table 1 Reaction system

[0062]

[0063] 4.3 PCR amplification program

[0064] To improve the specificity of the amplification product, Touchdown-PCR was used to amplify the target fragment. The specific procedure was as follows: denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 59°C for 30 s (decreasing by 0.5°C for each cycle), extension at 72°C for 30 s, for a total of 5 cycles; denaturation at 94°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 30 s, for a total of 25 cycles; finally, extension at 72°C for 5 min; stored at 4°C.

[0065] 4.5 Agarose gel electrophoresis

[0066] Add 1.5 g of agarose powder and 100 mL of 1×TAE buffer (1.5% agarose gel) to an Erlenmeyer flask, shake well and dissolve by heating in a microwave oven. After the solution becomes transparent, add 10 μL of nucleic acid dye. Pour the solution into the gel casting tank, insert the gel comb, and after solidification, remove the comb and place the gel in the electrophoresis tank. Add 5 - 10 μL of the PCR product to each well, set a constant voltage of 140 V, and perform electrophoresis for 15 - 30 minutes. After electrophoresis, observe and take pictures in a UV gel imager.

[0067] 4.6 Result verification

[0068] The sequence of the red meat marker amplification product is shown in SEQ ID NO: 1, and the sequence of the seedless marker amplification product is shown in SEQ ID NO: 3. The electrophoresis bands are clear and have good uniformity, indicating that there are no problems with the DNA purity and concentration. If the red meat marker has two bands (638 bp and (638 + 408n) bp, where n is a natural number ≥ 1), it proves that the variety is red meat. If there is only one band (638 bp), it is a white meat variety. The seedless marker is a 70-bp deletion. Therefore, compared with seeded varieties, the seedless band migrates farther, and the relative migration position of the seedless is lower in the agarose gel compared to seeded grapes. By comparing the bands, the specific situation of the seedlessness of the variety can be determined.

[0069] Example 3

[0070] For the method of breeding new grape varieties in Example 2, the offspring of the hybrid population of 'Yan 73' (red meat variety) × 'Zixiang Seedless' (seedless variety) was used as an example for application and verification.

[0071] Four red-fleshed and seedless grape lines that meet the breeding objectives were screened from the offspring of the hybrid population of 'Yan 73' (red-fleshed variety) × 'Zixiang Seedless' (seedless variety) according to the method of Example 2, namely 'No. 35', 'No. 38', 'No. 69' and 'No. 85'. The electrophoresis results are shown in Figure 1 and Figure 2 . The results showed that all red-fleshed grapes showed double bands (638 bp and 638 bp and (638 + 408n) bp), while the position of seedless grapes was relatively farther from that of seeded grapes. Seeded grapes showed a single band at 284 bp, and seedless grapes showed a single band at 214 bp. Among them, the comprehensive traits of 'No. 69' were excellent (see Figure 3 ), and it was selected as a strain. In 2022, an application for the right to a new plant variety was filed and accepted, and it is currently in the substantive examination stage.

[0072] At present, when using seeded varieties as female parents and seedless varieties as male parents, the proportion of seedless trait lines in the hybrid offspring is only as low as 10%-15% at the lowest, and most are seeded lines (Reynolds, 2014). Even when crossing between seedless female parents and seedless male parents, although the probability of seedless lines in the hybrid offspring will increase greatly, at least 25% are still seeded lines. Even for seedless lines, the seed abortion situation does not all meet the breeding objectives of new seedless varieties (Ramming, 1990). And using the traditional method for screening, all hybrids need to be planted in the field, and after being domesticated during the juvenile period, it can be determined whether the lines are seedless after the plants bear fruit, which takes at least 5-6 years in the middle. Therefore, if seedless markers can be used to screen hybrid offspring at an early stage, firstly, the breeding process can be accelerated, reducing the breeding cycle by at least 5 years; secondly, a large amount of land, management and other resources occupied by miscellaneous seedlings after planting can be reduced, reducing the breeding cost. The combination of seedless trait markers and other quality markers can further highlight the advantages of modern biological breeding technology and improve the breeding efficiency. From the results of the above embodiments, it can be seen that the molecular markers provided by the present invention and the breeding method developed based on the molecular markers can determine the seedless and pulp color traits of the offspring lines in the second year after hybridization, screen the target trait lines targeted, and significantly shorten the breeding years, which is an important discovery and progress for grape breeding and has very important practical significance and value.

[0073] The above-described embodiments are only descriptions of the preferred embodiments of the present invention and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention should fall within the protection scope determined by the claims of the present invention.

Claims

1. A molecular marker for identifying a new variety of red-fleshed and seedless grapes, characterized in that: The molecular marker consists of a molecular marker R1 for identifying grape flesh as red flesh and a molecular marker S1 for identifying grapes as seedless. The molecular marker R1 is located in the upstream promoter region of the grape key gene VvMYBA1. The molecular marker R1 contains ≥2 copies of the MYBA1 promoter. The promoter sequence is shown in SEQ ID NO:

2. The nucleotide sequence of the molecular marker S1 is shown in SEQ ID NO:

3. There is a 70 bp deletion in the sequence starting from the 121st position. The deleted fragment is shown in SEQ ID NO:

4.

2. A method for breeding a new variety of red-fleshed and seedless grapes, characterized in that: The method comprises the step of using the molecular markers described in claim 1 to breed new varieties of red-fleshed and seedless grapes.

3. The method according to claim 2, characterized in that The method comprises the following steps: DNA is extracted from young tissues of hybrid grape seedlings, and the molecular marker S1 is amplified using the primer pair shown in SEQ ID NO: 5-6, and the molecular marker R1 is amplified using the primer pair shown in SEQ ID NO: 7-8. According to the band type of the amplified product, a new grape variety with red flesh and no seeds is selected.

4. The method according to claim 3, characterized in that The parents of the hybrid seedlings include at least one red meat variety parent and one seedless variety parent.

5. The method according to claim 3, characterized in that The amplification reaction system includes: 2×Rapid TaqMaster Mix 25 μL, upstream primer 2 μL, downstream primer 2 μL, DNA template 0.1-1 μg, and ddH2O supplemented to a total volume of 50 μL.

6. The method according to claim 3, characterized in that The amplification reaction procedure is: denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 59°C for 30 s, annealing temperature decreased by 0.5°C in each cycle, extension at 72°C for 30 s, for a total of 5 cycles; denaturation at 94°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 30 s, for a total of 25 cycles; finally extension at 72°C for 5 min; storage at 4°C.

7. The method according to claim 3, characterized in that When the molecular marker R1 has double bands of 638 bp and (638+408n) bp, it is a red-fleshed grape, and when it has a single band of 638 bp, it is a white-fleshed grape, wherein n is a natural number ≥ 1; when the molecular marker S1 has a single band of 284 bp, it is a seeded grape, and when it has a band of 214 bp, it is a seedless grape.

8. The method according to claim 7, characterized in that The hybrid seedling variety that retains the molecular marker R1 with double bands of 638 bp and (638+408n) bp and the molecular marker S1 with a band of 214 bp is a new red-fleshed and seedless hybrid grape variety.

9. Use of the molecular marker as claimed in claim 1 in breeding new varieties of red-fleshed and seedless grapes.