KASP primer group related to growth period of upland cotton and application of KASP primer group

Abstract

The invention relates to the field of molecular breeding, in particular to a KASP marker primer group related to the growth period of upland cotton and application of the KASP marker primer group. According to the method, an early-maturing strain XSK28 and a late-maturing strain TM-1 are hybridized, and the QTL in the growth period is finely positioned by using an F2 group. It is identified that the expression level of the two genes GhA05G014200 and GhA05G014500 in an early maturing line XSK28 is obviously higher than that of a late maturing line TM-1. 6 KASP marker primer groups are developed again for the SNP near the two genes, and haplotype analysis of the upland cotton germplasm population further verifies that the two genes are related to the growth period; the six KASP marker primer groups are used for carrying out single marker analysis on an upland cotton germplasm population, and the result shows that the six KASP marker primer groups can be used for auxiliary selection in the growth period, so that the prematurity of cotton is improved.

Description

Technical Field

[0001] The invention relates to the field of molecular breeding, and in particular to a KASP primer set related to the growth period of upland cotton and an application thereof. Background Art

[0002] Cotton is an important natural fiber crop. Upland cotton (Gossypium hirsutum L.) is one of the 50 species of cotton. Due to its high fiber yield and strong adaptability, its output accounts for more than 95% of the total cotton output. Early-maturing cotton is a special type of upland cotton, which is usually characterized by short plants, compact plant shape, and a shorter growing period than medium and late-maturing cotton. The breeding and promotion of early-maturing cotton are of great significance to alleviating the contradiction between grain and cotton for land and optimizing the crop industry structure. Among the many early-maturing traits of cotton, such as the growing period, seedling stage, bud stage, flowering and boll stage, pre-frost flowering rate, fruiting branch first node and its height, the growing period directly reflects the early maturity of cotton. Therefore, elucidating the genetic and molecular mechanisms of the growing period is a prerequisite for achieving molecular breeding for early maturing cotton.

[0003] The rapid development of molecular marker technology and high-throughput sequencing platforms has greatly promoted the genetic analysis of quantitative traits. So far, many QTLs related to growth period have been identified in upland cotton using two main QTL mapping methods: linkage analysis and association analysis. These QTLs provide genomic information for further screening of candidate genes affecting cotton precocity.

[0004] Linkage analysis based on segregating populations is considered a reliable method for identifying QTLs for target traits. However, the workload of constructing segregating populations and genetic linkage maps is very large, especially for large segregating populations. Bulked Segregant Analysis (BSA) is a method for rapidly identifying target QTLs associated with potential genes or genomic regions. With the advancement of sequencing technology, the combination of BSA and sequencing data has greatly improved the efficiency of QTL detection, and this method is called QTL-seq. In recent years, QTL-seq has been widely used in the identification of target trait QTLs and functional gene mining in a variety of crops. Competitive Allele-Specific PCR (KASP) is a high-throughput genotyping technology based on single nucleotide polymorphism (SNP). It has been widely used in germplasm resource identification, kinship research, molecular marker-assisted breeding, genetic map construction and gene positioning. Although many QTLs related to cotton precocity have been identified, there are no reports on the fine positioning of QTLs by combining QTL-seq and KASP. Summary of the invention

[0005] The purpose of the present invention is to provide a KASP marker primer set related to the growth period of upland cotton.

[0006] Another object of the present invention is to provide the application of the above-mentioned KASP marker primer set related to the growth period of upland cotton.

[0007] According to the technical solution of the present invention, six KASP marker primer sets related to the growth period of upland cotton are:

[0008] A KASP marker primer set related to the growth period of upland cotton, characterized in that the KASP marker primer set comprises:

[0009] (1) K1853547 primer pair, the K1853547 primer pair comprising the following primers:

[0010] K1853547 forward primer (SEQ ID NO: 1) 1:

[0011] 5'GAAGGTCGGAGTCAACGGATTTGAACTCTTTTAGATCACTTTCTTAATC3',

[0012] K185354 forward primer 2 (SEQ ID NO: 2):

[0013] 5'GAAGGTGACCAAGTTCATGCTTGAACTCTTTTAGATCACTTTCTTAATG3',

[0014] K185354 reverse primer (SEQ ID NO: 3):

[0015] 5'TCCATTTGAAGGAGCTATTGATC3';

[0016] (2) K1855926 primer pair, the K1855926 primer pair comprising the following primers:

[0017] K1855926 forward primer 1 (SEQ ID NO: 4):

[0018] 5'GAAGGTCGGAGTCAACGGATTTTTCCTACTTAGGGCCTTTTCC3',

[0019] K1855926 forward primer 2 (SEQ ID NO: 5):

[0020] 5'GAAGGTGACCAAGTTCATGCTTTTCCTACTTAGGGCTCTTTCG3',

[0021] K1855926 reverse primer (SEQ ID NO: 6):

[0022] 5′TGGATTTTGGAGCTCAAACAA3′;

[0023] (3) K185988 primer pair, the K185988 primer pair comprising the following primers:

[0024] K185988 forward primer 1 (SEQ ID NO: 7):

[0025] 5'GAAGGTCGGAGTCAACGGATTTTCGAGTTGGTACAGGAATTATATC3',

[0026] K185988 forward primer 2 (SEQ ID NO: 8):

[0027] 5'GAAGGTGACCAAGTTCATGCTTTCGAGTTGGTACAGGAATTATATT3',

[0028] K185988 reverse primer (SEQ ID NO: 9):

[0029] 5'ATATTGCTTATTCGTTTGGATGAC3';

[0030] (4) K1892563 primer pair, the K1892563 primer pair comprising the following primers:

[0031] K1892563 forward primer 1 (SEQ ID NO: 10):

[0032] 5'GAAGGTCGGAGTCAACGGATTTAGCAGCCTCGTCCTGTCC3',

[0033] K1892563 forward primer 2 (SEQ ID NO: 11):

[0034] 5'GAAGGTGACCAAGTTCATGCTTCTAGCAGCCTCGTCCTGTCT3',

[0035] K1892563 reverse primer (SEQ ID NO: 12):

[0036] 5'ACGTCTATTCTTTTTCAGGACTTTG3';

[0037] (5) K1893767 primer pair, the K1893767 primer pair comprising the following primers:

[0038] K1893767 forward primer 1 (SEQ ID NO: 13):

[0039] 5'GAAGGTCGGAGTCAACGGATTATGAACAAAAAATGAGGACAAGTAA3',

[0040] K1893767 forward primer 2 (SEQ ID NO: 14):

[0041] 5'GAAGGTGACCAAGTTCATGCTATGAACAAAAAATGAGGACAAGTAG3',

[0042] K1893767 reverse primer (SEQ ID NO: 15):

[0043] 5'AGTATATGTTTTAGCAATCTTATTGTTTA3';

[0044] (6) K1896332 primer pair, the K1896332 primer pair comprising the following primers:

[0045] K1896332 forward primer 1 (SEQ ID NO: 16):

[0046] 5'GAAGGTCGGAGTCAACGGATTGGATTATCGGCTGAGCTTCA3',

[0047] K1896332 forward primer 2 (SEQ ID NO: 17):

[0048] 5'GAAGGTGACCAAGTTCATGCTGGATTATCGGCTGAGCTTCG3',

[0049] K1896332 reverse primer (SEQ ID NO: 18):

[0050] 5'CATACTCTGCTTCTAATTGTTGGTCTA3'.

[0051] The method for molecular-assisted identification of the growth period of upland cotton according to the present invention comprises the following steps:

[0052] Use the above-mentioned KASP marker primer set related to the growth period of upland cotton to perform single marker analysis on the test material;

[0053] For the K1853547 primer pair, if the result of the single marker analysis of the material to be tested is the GG genotype, the material to be tested is an early-maturing material; if it is the CC genotype, the material to be tested is a late-maturing material;

[0054] For the K1855926 primer pair, if the result of the single marker analysis of the material to be tested is CC genotype, the material to be tested is an early-maturing material, and if it is GG genotype, the material to be tested is a late-maturing material;

[0055] For the primer pair K1859880, if the result of the single marker analysis of the material to be tested is TT genotype, the material to be tested is an early-maturing material, and if it is CC genotype, the material to be tested is a late-maturing material;

[0056] For the K1892563 primer pair, if the result of the single marker analysis of the material to be tested is TT genotype, the material to be tested is an early-maturing material, and if it is CC genotype, the material to be tested is a late-maturing material;

[0057] For the K1893767 primer pair, if the result of the single marker analysis of the material to be tested is the AA genotype, the material to be tested is an early-maturing material, and if it is the GG genotype, the material to be tested is a late-maturing material;

[0058] For the K1896332 primer pair, if the result of the single marker analysis of the material to be tested is the AA genotype, the material to be tested is an early-maturing material, and if it is the GG genotype, the material to be tested is a late-maturing material.

[0059] Beneficial technical effects:

[0060] 1. Using traditional linkage analysis, many QTLs for cotton early maturity traits have been identified. However, most of these studies are only preliminary positioning of the QTL for the target traits, and the QTL confidence interval is too large to provide more valuable information. Although there have been reports on the rapid positioning of QTLs using the QTL-seq method, the fine positioning of QTLs cannot be achieved due to the insufficient population size. The present invention constructs a large-scale F2 population containing 2759 plants, uses QTL-seq to quickly identify genomic regions related to the growth period, and then performs two rounds of KASP genotyping on all F2 plants, and finally locates the QTL in a region of approximately 62kb on A05, thereby achieving fine positioning of the QTL. The present application combines BSA-seq and KASP based on a large-scale F2 population, which is an effective method for achieving fine positioning of QTLs. This method is used for the first time to finely locate QTLs for important traits of cotton.

[0061] 2. qRT-PCR analysis showed that the expression levels of the two candidate genes Gh_A05G014200 and Gh_A05G014500 were significantly higher than that of TM-1 at the four-leaf and five-leaf stages in the early stage of flower bud formation, indicating that these two genes are involved in the regulation of cotton flower bud formation and precocity.

[0062] 3. The population used for QTL mapping in the present invention is an F2 population, which is a highly heterozygous population with no haploid material. Therefore, 6 KASP marker primer sets were developed again for the SNPs near the candidate gene, and the possible functions of the candidate gene were verified by haplotype analysis of the upland cotton germplasm population. The results showed that the different haplotypes of the two genes showed significant differences in two of the three environments (Shihezi in 2014 and Shihezi in 2015). The haplotype GCT / CGC of Gh_A05G014200 and the haplotype AAT of Gh_A05G014500 showed a low growth period, providing excellent haploid material for cotton early breeding. This method is different from the existing research methods. The existing research methods use the same population to identify and functionally analyze QTLs. In this application, another upland cotton germplasm population is used for verification, which not only obtains excellent haploid materials, but also verifies the QTL identified in the F2 population. In addition, the T / C of Gh_A05G014500 (1892563bp in the upland cotton genome) is a non-synonymous mutation. In the superior haplotype, the 167th amino acid of the gene changes from threonine (encoded by ACA) to isoleucine (encoded by ATA). These results provide important information for further functional studies of genes related to early maturity.

[0063] 4. The single marker analysis of upland cotton germplasm population was carried out using the redeveloped KASP marker primer set. The results showed that the phenotypic differences of different genotypes of the six KASP markers in two environments (Shihezi 2014 and Shihezi 2015) were significant or extremely significant, indicating that these marker primer sets can be used for auxiliary selection during the growth period of cotton, thereby improving early maturity. BRIEF DESCRIPTION OF THE DRAWINGS

[0064] Figure 1 Figure a in the middle shows the phenotypic differences between the early-maturing parent XSK28, the late-maturing parent TM-1, and the low and high growth period pools, and Figure b shows the frequency distribution of the growth period of the F2 population;

[0065] Figure 2 The genomic regions of QTLs associated with growth period identified using BSA-seq are shown;

[0066] Figure 3 The genotyping of 9 KASP markers on A05 and 11 KASP markers on D10 in the first round in the F2 population is shown;

[0067] Figure 4 Figure a in the middle shows that through two rounds of KASP genotyping and QTL mapping, the growth period QTL was finely mapped to a region of approximately 62 kb containing 7 genes on A05, and Figure b shows that after the second round of KASP genotyping and QTL mapping, no QTL was detected on chromosome D10.

[0068] Figure 5 The genotyping of 8 KASP markers on A05 and 7 KASP markers on D10 in the F2 population in the second round is shown;

[0069] Figure 6 The relative expression levels of genes Gh_A05G014200 and Gh_A05G014500 at the three-, four-, and five-leaf stages of the early-maturing parent XSK28 and the late-maturing parent TM-1 are shown;

[0070] Figure 7 Haplotype analysis of candidate genes using upland cotton germplasm populations is shown: a: haplotype analysis of Gh_A05G014200 based on gene structure and linkage disequilibrium blocks; b: haplotype analysis of Gh_A05G014500 based on gene structure and linkage disequilibrium blocks. DETAILED DESCRIPTION

[0071] According to a specific embodiment of the present invention, QTL-seq and KASP techniques were used to finely locate the QTL of the growth period using the F2 population by hybridizing the early-maturing line XSK28 with the late-maturing line TM-1. A total of 2,380,361 high-quality SNPs were detected between the two parents and between the two extreme types of growth period DNA pools. QTL-seq analysis identified five genomic regions associated with the growth period, which were located on chromosomes A05, A08, D07, D08 and D10, respectively. Based on the reliability of these five regions, the regions on A05 and D10 were selected for QTL fine positioning. Through QTL mapping based on two rounds of KASP screening, the QTL region on A05 was narrowed down to a 62kb interval containing 7 genes, and after the second round of KASP screening, no QTL was detected on D10. qRT-PCR analysis showed that the expression levels of two genes Gh_A05G014200 and Gh_A05G014500 in the early-maturing line XSK28 were significantly higher than those in the late-maturing line TM-1. Six KASP marker primer sets were developed again for the SNPs near these two genes, and haplotype analysis of upland cotton germplasm populations further verified that these two genes were related to the growth period; single marker analysis of upland cotton germplasm populations using these six KASP marker primer sets showed that these six KASP marker primer sets can be used for auxiliary selection of cotton growth period, thereby improving early maturity.

[0072] Example 1

[0073] 1. Population construction, trait phenotyping and data analysis

[0074] XSK28 is an early-maturing upland cotton variety bred by the Shihezi Academy of Agricultural Sciences, and TM-1 is a genetic standard upland cotton variety bred in the United States that exhibits a late-maturing phenotype. In 2020, XSK28 and TM-1 were hybridized to obtain F1 seeds. In 2021, the F1 was self-pollinated and F2 seeds were harvested. In 2022, two parents and a large-scale F2 population of 2,759 plants were planted in an experimental field in Shihezi City, Xinjiang, a cotton-growing area in northwest China. 38 to 40 plants were planted in each row, with a row length of 5 meters and a row spacing of 0.45 meters.

[0075] The growth period phenotypes of the parents and all F2 plants were recorded. Specifically, the emergence date and the first boll opening date of each plant were recorded, and the difference between the two was the growth period phenotype value. SPSS17 was used for data analysis.

[0076] The average growth period of the early-maturing parent XSK28 and the late-maturing parent TM-1 were 117.6 days and 139.6 days, respectively, with significant phenotypic differences ( Figure 1 Figure a in Figure 2). By selecting extreme types of plants in the F2 population, a low growth period pool with an average growth period of 115.7 days and a high growth period pool with an average growth period of 146.0 days were constructed. The growth period of the two pools also showed significant phenotypic differences ( Figure 1 The frequency distribution of the growth period of all F2 plants showed several obvious peaks (see Figure a). Figure 1 This indicates that there may be a major gene or major effect QTL for this trait.

[0077] 2. Genome resequencing

[0078] Genomic DNA was extracted from young leaves of two parents and 2759 F2 individuals. The concentration of the separated DNA was determined by a spectrophotometer. The DNA of the two pools constructed above was mixed in equal amounts. The DNA of four samples, XSK28, TM-1, low and high fruit branch first node pools, was sequenced. The specific steps were as follows: the four samples were treated with an ultrasonicator to generate 350bp fragments. These fragments were then end-repaired and nucleotide (A) overhangs were generated. Sequencing adapters were then connected using T4 DNA ligase and PCR was performed. The PCR products were purified and then double-end sequenced using the Illumina platform. A total of 2.02Gb of clean reads and 302.43Gb of clean bases were generated from the four samples (Table 1). XSK28, TM-1, low and high fruit branch first node pools contained 77.74Gb, 70.85Gb, 78.19Gb and 75.65Gb of clean bases, respectively. The average sequencing depth of the four samples was greater than 30×, covering more than 98% of the genome.

[0079] Table 1 Sequencing results analysis

[0080]

[0081] 3.SNP detection

[0082] After removing low-quality reads, cleanreads were mapped to the upland cotton TM-1 reference genome sequence (https: / / www.cottongen.org / species / Gossypium_hirsutum / CRI-TM1). According to the position of cleanreads on the reference genome, local alignment and SNP detection were performed using the genome analysis toolkit. Finally, 2,380,361 high-quality SNPs were identified between the two parents and the two pools (Table 2). SNPs were unevenly distributed in the genome, with 1,455,209 and 925,152 SNPs distributed in the A and D subgenomes, respectively. The average marker density was approximately one SNP per 1.101 kb. In the A subgenome, chromosome A08 had the most markers (326075) with a marker density of one SNP per 0.385 kb, while A04 had the least markers (49942) with a marker density of one SNP per 1.694 kb. In the D subgenome, chromosome D08 had the most markers (111976) with a marker density of one SNP per 0.613 kb, while D03 had the least markers (35330) with a marker density of one SNP per 1.519 kb. The SNP sequencing depths of the four samples on 26 chromosomes ranged from 24.64× to 31.25×, from 22.09× to 26.01×, from 25.97× to 31.39×, and from 24.94× to 30.06×, respectively.

[0083] Table 2 Distribution characteristics of SNPs in the upland cotton genome

[0084]

[0085] 4.QTL-seq analysis

[0086] The Δ(SNP-index) method was used to analyze the target QTL candidate regions between the two pools. Combined with the parental information, the Δ(SNP-index) value was calculated by subtracting the SNP-index(high) from the SNP-index(low). The Δ(SNP-index) was fitted using the sliding window method with a window size of 4 Mb and a step size of 300 kb. The median value of the Δ(SNP-index) of all sites in the window was considered as the fitted association value. The confidence interval of the Δ(SNP-index) was obtained at confidence levels of 0.05 and 0.01. The genomic interval with a confidence level of 0.01 was considered as the QTL positioning region. Finally, 5 genomic regions related to the growth period were identified, namely 2.1 Mb on A05, 4.5 Mb on A08, 0.3 Mb on D07, 1.5 Mb on D08, and 3.9 Mb on D10 (Table 3, Figure 2 ).

[0087] Table 3 Five genomic regions related to growth period identified by QTL-seq (P<0.01)

[0088]

[0089] 5. KASP genotyping and QTL mapping

[0090] Considering the reliability of the five related regions identified in the above QTL-seq results, the regions from 900000 bp to 3000000 bp on A05 and from 11100000 bp to 15000000 bp on D10 were selected for further KASP genotyping and QTL mapping. The procedure included two rounds of KASP screening and QTL mapping. The specific methods and steps of KASP genotyping were: designing KASP primers using Primer5.0 and checking the specificity of primers using BLAST; using the GeneMatrix system for KASP genotyping, which includes the following three parts: matrix sampler reaction plate preparation device, matrix cycler high-throughput water bath thermal cycler and matrix scanner high-speed fluorescence scanner. The FAM signal marker is connected to forward primer 1, and the fluorescent group is blue fluorescence; the HEX signal is connected to forward primer 2, and the fluorescent group is red fluorescence. The KASP thermal cycle program was 94°C for 15 minutes, followed by 10 cycles of 94°C for 20 seconds, 61-55°C for 20 seconds (0.6°C decrease per cycle), 72°C for 45 seconds, 30 cycles of 94°C for 20 seconds and 55°C for 1 minute. After the reaction was completed, the fluorescence data was read and analyzed. Based on the KASP genotyping results and growth period phenotypic data of 2759 F2 plants, QTL IciMapping ver.4.1 software was used for QTL mapping, with the parameters set to 1 cM per step and PIN = 0.001. The significance of the QTL was determined when the logarithm value (LOD value) was greater than or equal to the threshold calculated by 1000 permutation tests. After QTL mapping, the genes in the reduced QTL region were considered candidate genes associated with the growth period.

[0091] In the first round of KASP, 11 KASP markers were developed on A05 and 13 on D10 (Table 4, Table 5). Finally, 9 effective KASP markers on A05 and 11 on D10 were used for genotyping of all F2 plants ( Figure 3 ). Further QTL mapping was performed using the genotyping results and phenotypic data, and the QTL region was narrowed down to between K1840167 and K1935207 on A05, within an area of ​​about 95 kb ( Figure 4 D10 is located between K12672241 and K13101813, within an area of ​​about 430 kb ( Figure 4 (b in Figure ).

[0092] Table 4 Genomic location of the first round of KASP markers and their polymorphism between parents

[0093] chromosome KASP Mark Genomic location XSK28 TM-1 A05 K1141326 1141326 G A A05 K1174820 1174820 G T A05 K1589587 1589587 A T A05 K1840167 1840167 A T A05 K1935207 1935207 A G A05 K2163390 2163390 A G A05 K2260924 2260924 G A A05 K2468816 2468816 A G A05 K2552815 2552815 G A A05 K2703174 2703174 T G A05 K2834442 2834442 C T D10 K11139135 11139135 G A D10 K11364019 11364019 A G D10 K11609696 11609696 T A D10 K11885068 11885068 G T D10 K12144399 12144399 T C D10 K12463094 12463094 C T D10 K12672241 12672241 C A D10 K12877244 12877244 A G D10 K13101813 13101813 C T D10 K13508541 13508541 C T D10 K13990601 13990601 C T D10 K14229625 14229625 C A D10 K14773846 14773846 C T

[0094] Table 5 First round KASP marker primer set

[0095]

[0096]

[0097]

[0098] In the target QTL interval obtained after the first round of KASP and QTL mapping, KASP markers were further developed for the second round of KASP. In this round, 10 KASP markers were developed on A05 and 12 KASP markers on D10 (Table 6, Table 7). Finally, 8 effective KASP markers on A05 and 7 effective KASP markers on D10 were used for genotyping of all F2 plants ( Figure 5 After QTL mapping was performed again, the QTL on A05 was located between K1901716 and K1887842. Considering the physical positions of the three markers K1901716, K1840233, and K1887842, the QTL region was further narrowed to a region of about 62 kb containing seven genes ( Figure 4 However, the QTL mapping of D10 showed that the LOD value did not exceed the threshold calculated by 1000 permutation tests ( Figure 4 b), therefore this chromosome was not considered for further analysis.

[0099] Table 6 Genomic location of the second round of KASP markers and their polymorphism between parents

[0100]

[0101]

[0102] Table 7 Second round KASP marker primer set

[0103]

[0104]

[0105] 6. qRT-PCR Analysis of Candidate Genes

[0106] To verify the candidate genes, qRT-PCR analysis was performed using the early-maturing parent XSK28 and the late-maturing parent TM-1. Total RNA was extracted from the terminal buds of the two materials at the three-leaf, four-leaf, and five-leaf stages, and cDNA was obtained by reverse transcription. The analysis was performed using the CFX96TM real-time system, with three biological replicates and three technical replicates. Primers were designed using Beacon Designer 7.9 software, with β-actin as the internal reference gene (Table 8). 2 -ΔΔCt Methods The relative expression levels of candidate genes were calculated.

[0107] Finally, 5 of the 7 genes (Gh_A05G014000, Gh_A05G014100, Gh_A05G014200, Gh_A05G014400 and Gh_A05G014500) were successfully amplified. Among the 5 genes, the expression levels of Gh_A05G014200 and Gh_A05G014500 in the three developmental stages of the two parents XSK28 (early maturing) and TM-1 (late maturing) showed consistent trends, especially at the four-leaf and five-leaf stages, the relative expression levels in XSK28 were significantly higher than those in TM-1 ( Figure 6 ). Therefore, these two genes may be involved in the regulation of growth period, thus affecting precocity.

[0108] Table 8 qRT-PCR primers

[0109]

[0110] 7. Haplotype analysis of candidate genes

[0111] The genomic DNA information of Gh_A05G014200 and Gh_A05G014500 was extracted from CottonFGD (https: / / cottonfgd.net / ). Gh_A05G014200 contains 3 exons and 2 introns, and Gh_A05G014500 contains 9 exons and 8 introns. Four and five KASP markers were developed for SNP variations within 3 kb upstream and downstream of Gh_A05G014200 and Gh_A05G014500, respectively (Table 7). These markers were used for genotyping of a germplasm population containing 373 upland cotton varieties (lines) (with growth period phenotypes from three environments, Shihezi 2013, Shihezi 2014, and Shihezi 2015). LDBlockShow software was used to estimate linkage disequilibrium and haplotype blocks, and Student's t-test was used to analyze the phenotypic differences between haplotypes of each candidate gene.

[0112] Table 79 KASP markers and primer sets

[0113]

[0114]

[0115] For Gh_A05G014200, three of the four KASP markers, G / C (K1853547), C / G (K1855926), and T / C (K1859880), were evaluated as a linkage disequilibrium block with three haplotypes; the phenotypic values ​​of haplotypes GCT and CGC were significantly lower than those of haplotype GCC in the two environments, Shihezi 2014 and Shihezi 2015 ( Figure 7 (a in Figure 1). For Gh_A05G014500, four of the five KASP markers, A / G (K1896332), A / G (K1893767), T / C (K1892563), and G / T (K1891499), were evaluated as one LD haplotype block. However, for locus G / T (K1891499), there were only two genotypes, G / G and G / T, and no T / T genotype among the 373 materials. Therefore, only the other three markers were haplotyped. These three loci formed two haplotypes, among which the phenotypic values ​​of haplotype AAT were significantly lower than those of haplotype GGC in the two environments, Shihezi 2014 and Shihezi 2015 ( Figure 7 In addition, the T / C of Gh_A05G014500 (1892563bp in the upland cotton genome) is a non-synonymous mutation. In the superior haplotype, the 167th amino acid of the gene changes from threonine (encoded by ACA) to isoleucine (encoded by ATA). In summary, haplotype analysis further verifies that these two genes may be related to cotton early maturity.

[0116] 8. Application of KASP marker primer sets related to growth period

[0117] The DNA of 373 upland cotton materials was amplified using the primer sets of 6 KASP markers (K1853547, K1855926, K1859880, K1896332, K1893767, K1892563) contained in the above two linkage disequilibrium blocks (Table 8), and then the growth period phenotypes (average of 3 replicates, Table 8) of the two environments (Shihezi 2014 and Shihezi 2015) were analyzed by single marker analysis. The results showed that the phenotypic differences of different genotypes of these 6 markers in the two environments (Shihezi 2014 and Shihezi 2015) were significant or extremely significant (Table 9), indicating that the marker genotypes with short growth period can be used for marker-assisted selection of cotton early maturity by amplifying upland cotton materials using these marker primer sets. In practical applications, the 6 marker primer sets can be used alone to achieve cotton early maturity assisted selection, and if used in combination, the effect is more ideal.

[0118] Table 86 KASP marker primer sets amplification results for 373 upland cotton materials and growth period phenotypes in two environments

[0119]

[0120]

[0121]

[0122]

[0123]

[0124]

[0125]

[0126]

[0127]

[0128]

[0129]

[0130]

[0131]

[0132]

[0133]

[0134] Table 96 KASP molecular primer sets used in upland cotton germplasm populations

[0135]

[0136] * is significant at the 0.05 level, ** is significant at the 0.01 level.

[0137] The above embodiments are only used to understand the technical solution of the present application and do not limit the protection scope of the present application.

Claims

1. A KASP marker primer set related to the growth period of upland cotton, characterized in that: The KASP labeling primer set includes: (1) K1853547 primer pair, the K1853547 primer pair comprising the following primers: K1853547 Forward Primer 1: 5'GAAGGTCGGAGTCAACGGATTTGAACTCTTTTAGATCACTTTCTTAATC3', K185354 forward primer 2: 5'GAAGGTGACCAAGTTCATGCTTGAACTCTTTTAGATCACTTTCTTAATG3', K185354 reverse primer: 5'TCCATTTGAAGGAGCTATTGATC3'; (2) K1855926 primer pair, the K1855926 primer pair comprising the following primers: K1855926 Forward Primer 1: 5'GAAGGTCGGAGTCAACGGATTTTTCCTACTTAGGGCCTTTTCC3', K1855926 Forward Primer 2: 5'GAAGGTGACCAAGTTCATGCTTTTCCTACTTAGGGCTCTTTCG3', K1855926 reverse primer: 5′TGGATTTTGGAGCTCAAACAA3′; (3) K185988 primer pair, the K185988 primer pair comprising the following primers: K185988 forward primer 1: 5'GAAGGTCGGAGTCAACGGATTTTCGAGTTGGTACAGGAATTATATC3', K185988 forward primer 2: 5'GAAGGTGACCAAGTTCATGCTTTCGAGTTGGTACAGGAATTATATT3', K185988 reverse primer: 5'ATATTGCTTATTCGTTTGGATGAC3'; (4) K1892563 primer pair, the K1892563 primer pair comprising the following primers: K1892563 Forward Primer 1: 5'GAAGGTCGGAGTCAACGGATTTAGCAGCCTCGTCCTGTCC3', K1892563 Forward Primer 2: 5'GAAGGTGACCAAGTTCATGCTTCTAGCAGCCTCGTCCTGTCT3', K1892563 reverse primer: 5'ACGTCTATTCTTTTTCAGGACTTTG3'; (5) K1893767 primer pair, the K1893767 primer pair comprising the following primers: K1893767 Forward Primer 1: 5'GAAGGTCGGAGTCAACGGATTATGAACAAAAAATGAGGACAAGTAA3', K1893767 Forward Primer 2: 5'GAAGGTGACCAAGTTCATGCTATGAACAAAAAATGAGGACAAGTAG3', K1893767 reverse primer: 5'AGTATATGTTTTAGCAATCTTATTGTTTA; (6) K1896332 primer pair, the K1896332 primer pair comprising the following primers: K1896332 forward primer 1: 5'GAAGGTCGGAGTCAACGGATTGGATTATCGGCTGAGCTTCA3', K1896332 forward primer 2: 5'GAAGGTGACCAAGTTCATGCTGGATTATCGGCTGAGCTTCG3', K1896332 reverse primer: 5'CATACTCTGCTTCTAATTGTTGGTCTA3'.

2. A method for molecular-assisted identification of the growth period of upland cotton, characterized in that: The method comprises the following steps: Use the KASP marker primer set related to the growth period of upland cotton as claimed in claim 1 to perform single marker analysis on the test material; For the K1853547 primer pair, if the result of the single marker analysis of the material to be tested is the GG genotype, the material to be tested is an early-maturing material, and if it is the CC genotype, the material to be tested is a late-maturing material; For the K1855926 primer pair, if the result of the single marker analysis of the material to be tested is CC genotype, the material to be tested is an early-maturing material, and if it is GG genotype, the material to be tested is a late-maturing material; For the primer pair K1859880, if the result of the single marker analysis of the material to be tested is TT genotype, the material to be tested is an early-maturing material, and if it is CC genotype, the material to be tested is a late-maturing material; For the K1892563 primer pair, if the result of the single marker analysis of the material to be tested is TT genotype, the material to be tested is an early-maturing material, and if it is CC genotype, the material to be tested is a late-maturing material; For the K1893767 primer pair, if the result of the single marker analysis of the material to be tested is the AA genotype, the material to be tested is an early-maturing material, and if it is the GG genotype, the material to be tested is a late-maturing material; For the K1896332 primer pair, if the result of the single marker analysis of the material to be tested is the AA genotype, the material to be tested is an early-maturing material, and if it is the GG genotype, the material to be tested is a late-maturing material.

Images