A portable field tobacco black root rot pathogen rapid diagnosis and identification kit

By designing specific primers and probes using RPA technology, combined with a portable reagent kit, the limitations of site and equipment in detecting tobacco root black rot pathogens have been overcome, enabling rapid and accurate field detection with a detection limit of 100 fg and high accuracy.

CN119433081BActive Publication Date: 2026-04-14HANBIN BRANCH OF ANKANG TOBACCO CO
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
HANBIN BRANCH OF ANKANG TOBACCO CO
Filing Date
2024-12-06
Publication Date
2026-04-14

AI Technical Summary

Technical Problem

Existing technologies cannot quickly and easily detect tobacco root black rot pathogens in the field or in the wild, and the detection sensitivity is not high, with a large number of false positives.

Method used

Design specific upstream and downstream modified primers, and combine them with fluorescently labeled probes. Use recombinase polymerase amplification (RPA) technology to amplify DNA at 25-40℃. Use immunochromatographic gold lateral flow chromatography strips to read the results and use a portable kit for detection.

Benefits of technology

It enables rapid, simple, and sensitive detection of tobacco root black rot pathogens in the field or outdoors, with a detection limit of up to 100 fg and an accuracy rate of nearly 100%. No additional equipment is required, and the operation time is short.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119433081B_ABST
    Figure CN119433081B_ABST
Patent Text Reader

Abstract

The application discloses a portable field tobacco black root rot pathogen rapid diagnosis and identification kit and belongs to the technical field of tobacco black root rot detection. The upstream primer, the downstream modified primer and the multi-site modified probe are disclosed, and the nucleotide sequences are respectively SEQ ID NO.1-SEQ ID NO.7; meanwhile, a simple kit for detecting tobacco black root rot is prepared by using the probe and the primer, and the problem that the detection of the tobacco black root rot pathogen is difficult to be carried out in the field without complex equipment is solved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of tobacco root black rot detection technology, and in particular to a portable rapid diagnostic method for tobacco root black rot pathogens in the field, as well as primers, probes and reagent kits. Background Technology

[0002] Tobacco root black rot is a soil-borne root and stem disease caused by the fungus Thieviopsis basicola, which infects the roots of tobacco plants. It is highly concealed and difficult to distinguish from Fusarium root rot. Furthermore, there is a period of incubation during the infection process. Accurate identification and monitoring of this fungus are the primary conditions for achieving precise control of tobacco root black rot.

[0003] Early and rapid diagnosis of tobacco root black rot provides crucial information for precise pesticide application and is a fundamental basis for the promotion and application of green control technologies. Traditional detection methods for tobacco root black rot primarily rely on the morphological and physiological characteristics of the pathogen. With the development of molecular biology techniques, polymerase chain reaction (PCR) based on nucleic acid detection has been widely adopted. However, both traditional methods and conventional PCR require highly skilled operators and specialized equipment, making rapid detection of tobacco root black rot fungi in the field impossible. Recombinase Polymerase Amplification (RPA) technology, based on the T4 phage nucleic acid replication mechanism, utilizes the recombinase protein of T4 phage...

[0004] The recombinase polymerase (Bsu) plays a crucial role in the isothermal amplification of nucleic acids in vitro, utilizing the functions of uvsX, single-strand binding protein (SSB), and DNA polymerase (Bsu). Primer design is a key factor determining the amplification effect of recombinase polymerase. RPA primer design differs from general PCR primer design. Overly long primers are prone to primer dimers and hairpin structures, while overly short primers reduce the recombination rate, affecting amplification speed and detection sensitivity. Currently, there is no software to assist in primer screening, which presents a significant challenge. Therefore, the principles of primer design and screening require extensive experimentation to be established during the primer design stage.

[0005] Therefore, early and rapid diagnosis of tobacco black root rot can provide an important basis for precise application of pesticides to control tobacco black root rot and is an important foundation for the promotion and application of green control technologies. Therefore, there is an urgent need for a method that can quickly detect tobacco black root rot in the field or in the wild. Summary of the Invention

[0006] Therefore, the purpose of this invention is to provide a portable rapid diagnostic method for tobacco root black rot pathogen in the field, as well as primers, probes and reagent kits, to solve the problems of complex operation, cumbersome procedures, low sensitivity and many false positives in the current detection of tobacco root black rot.

[0007] A primer and probe for rapid detection of tobacco root black rot pathogen, wherein the primer comprises an upstream primer and a downstream modified primer, the nucleotide sequences of the upstream primer are shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3, respectively, and the nucleotide sequences of the downstream modified primer are shown in SEQ ID NO.4, SEQ ID NO.5, and SEQ ID NO.6, respectively; the nucleotide sequence of the probe is shown in SEQ ID NO.7.

[0008] Specifically, the nucleotide sequences of the upstream primers are as follows:

[0009] SEQ ID NO.1(TbF1): CACATACGACCATAGCCTGTAGAAAGCACG;

[0010] SEQ ID NO.2(TbF2): CATACGACCATAGCCTGTAGAAAGCACGGG;

[0011] SEQ ID NO.3(TbF3): TACGACCATAGCCTGTAGAAAGCACGGGAT;

[0012] The nucleotide sequence of the downstream modification primer is as follows:

[0013] SEQ ID NO.4(TbR1): ATATAGTCAAGTCAAGCCGGATTGGGGGAG;

[0014] SEQ ID NO.5(TbR2):TTAAATATAGTCAAGTCAAGCCGGATTGGG;

[0015] SEQ ID NO.6 (TbR3): CGTTAAATATAGTCAAGTCAAGCCGGATTG;

[0016] The nucleotide sequence of the probe is as follows:

[0017] SEQ ID NO.7 (Tb Probe):

[0018] TGTTGTATGTCATCTTTTTACATGGTCAGTCTGCTTACTGTGGGGG;

[0019] Furthermore, the downstream modified primer has a biotin label at its 5' end, the probe has a fluorescent label at its 5' end, and the probe also includes at least one of the following features:

[0020] (1) The intermediate sequence of the probe contains a nucleotide analog;

[0021] (2) The nucleotide analogues include tetrahydrofuran residues;

[0022] (3) The 3' end of the probe has a polymerase extension blocking group;

[0023] (4) The polymerase extension blocking group includes any one of the following: C3-spacer group, phosphate group, and dideoxynucleotide.

[0024] Preferably, the fluorescent label is FAM.

[0025] Furthermore, the application of one of the upstream primers and one of the downstream modified primers described in this invention, combined with a probe, in the detection of tobacco root black rot.

[0026] Any of the upstream primers disclosed in this invention can be combined with any of the downstream modified primers and used together with the probe to detect tobacco root black rot, and the detection limit of pathogen DNA can reach 100 fg, with high sensitivity and accuracy.

[0027] This invention also discloses a rapid detection method for tobacco root black rot pathogens, the method being as follows:

[0028] DNA was extracted from the plant tissue to be tested to obtain a DNA extract. The DNA extract was then subjected to RPA amplification, and the results were read using an immunochromatographic gold lateral flow test strip. The RPA amplification reaction system consisted of 50 μL of the following components: 2 μL of DNA extract, 2 μL of 10 μM upstream primer, 2 μL of 10 μM downstream modification primer, 0.6 μL of 10 μM probe, 40.9 μL of Buffer A, 2.5 μL of Buffer B, and one tube of RPA amplification enzyme and exonuclease powder (Junuode, catalog number A4631). The reaction conditions were incubation at 25-40℃ for at least 15 min.

[0029] The detection method of the present invention is convenient, rapid and easy to use in the field for detecting early-stage tobacco root black rot.

[0030] Based on the publicly available upstream primers, downstream modified primers, probes, and detection methods, this invention also discloses a rapid detection kit for tobacco root black rot pathogens. The kit further includes lysis buffer, reaction solution a, reaction solution b, RPA reaction amplification enzyme and exonuclease dry powder tubes, ultrapure water dilution buffer, and test strips. Reaction solution a includes upstream primers, downstream modified primers, probes, and Buffer A; reaction solution b includes Buffer B.

[0031] To make operation more convenient, it also includes grinding rods, micropipettes, and centrifuge tubes to facilitate grinding, aspirating, or loading of reactants.

[0032] Furthermore, the upstream primer is selected from one of the upstream primers with nucleotide sequences as shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3, respectively, and the downstream modification primer is selected from one of the downstream modification primers with nucleotide sequences as shown in SEQ ID NO.4, SEQ ID NO.5, and SEQ ID NO.6, respectively, and the nucleotide sequence of the probe is shown in SEQ ID NO.7.

[0033] The upstream and downstream modification primers added to the kit disclosed in this invention can be any of the disclosed upstream primers and any combination of downstream modification primers.

[0034] Furthermore, the lysis buffer is prepared from 4% PEG 2000, 24mM NaOH, and 1mM EDTA, with a total volume of 300μL; the reaction solution a has a total volume of 45.5μL, including 2μL of 10μM upstream primer, 2μL of 10μM downstream modification primer, 0.6μL of 10μM probe, and the remainder is Buffer A buffer; the ultrapure water dilution solution is 400μL, and the reaction solution b has a total volume of 2.5μL.

[0035] Furthermore, the method of using the reagent kit is as follows:

[0036] S1: Take the diseased plant tissue to be tested, add lysis buffer and grind it. After grinding, wait 2 minutes for full lysis, and the lysis time shall not exceed 5 minutes to obtain DNA extract.

[0037] S2: Add reaction solution a to the dry powder tube containing RPA reaction amplification enzyme and exonuclease, draw DNA extraction solution into the reaction tube, draw reaction solution b to start the RPA reaction, and react at 25-40℃ for more than 15 minutes.

[0038] S3: Draw all the reaction solution into a tube containing diluent for dilution, insert the test strip into the tube, and read the result after 3-5 minutes.

[0039] This kit requires a reaction temperature between 25-40℃, which can be achieved simply by holding the kit by hand, eliminating the need for additional temperature control equipment and facilitating field testing. Furthermore, the kit has optimized the addition process for primers, probes, buffers, and various enzymes, making the detection operation even simpler. The entire detection process can be completed within 25 minutes, resulting in a short testing time.

[0040] The application of the reagent kit disclosed in this invention in the detection of tobacco root black rot.

[0041] Beneficial effects:

[0042] 1. The detection method disclosed in this invention has a detection limit of up to 100 fg for pathogen DNA. When the pathogen DNA content reaches 1 pg or more, the detection band (positive band) will be very obvious. Therefore, a smaller sample size is required, which can detect tobacco root black rot at an earlier stage.

[0043] 2. The portable tobacco root black rot pathogen diagnostic kit prepared according to the above method has the advantages of simple and quick operation, no limitation on testing site, and no need for additional equipment. It also has high sensitivity and specificity, and the specific sequence used is significantly different from the genome sequences of all other known species. It shows no cross-reactivity with other common pathogens in tobacco, and the accuracy of detection using this kit is close to 100%. Furthermore, the kit can be used at a reaction temperature between 25-40℃, requiring only hand contact to meet the temperature requirements, eliminating the need for additional temperature control equipment and facilitating convenient field testing.

[0044] 3. The kit disclosed in this invention optimizes the addition process of primers, probes, buffers and various enzymes, making the detection operation simpler and the entire detection can be completed within 25 minutes, which is relatively short. Attached Figure Description

[0045] Figure 1 : Reagent kit product image; including ① lysis buffer, ② disposable plastic grinding rod, ③ reaction solution a, ④ reaction solution b, ⑤ dry powder tube, ⑥ plastic micropipettes, ⑦ diluent, ⑧ test strip;

[0046] Figure 2 : Detection results after different combinations of upstream primers, downstream modified primers, and probes;

[0047] Figure 3 : Graphs showing test results under different temperature conditions;

[0048] Figure 4 : Specificity test of the reagent kit;

[0049] Figure 5 : Reagent kit detection sensitivity test;

[0050] Figure 6 Detection status in field settings. Detailed Implementation

[0051] The present invention will now be described in detail with reference to specific embodiments and accompanying drawings:

[0052] Example 1: Gene Sequence, Probes and Primers

[0053] Specificity and sensitivity are two key indicators in pathogen detection technology. Many factors influence the specificity and sensitivity of nucleic acid detection, such as the quality of the nucleic acid in the sample, primer design, optimized reaction system ratios, and the specificity and copy number of the target sequence. Species-specific, high-copy-number repetitive sequences in an organism's genome are ideal target sequences for nucleic acid molecular detection and are widely used in the detection of medical pathogens. The higher the copy number of the target sequence, the higher the sensitivity of the detection system based on it.

[0054] To identify novel multicopy sequences suitable for the pathogen of tobacco root black rot, genome sequence alignment was performed using the *Leuconostoc rhizogenes* reference genome (GenBank accession number ASM367143v1). BLASTN (v2.10.1) was used with default parameters for self-alignment to identify potential multicopy sequences. Two rounds of BLAST searches were conducted to screen for multicopy sequences. Genome comparisons retained sequences longer than 150 bp with two or more high confidence values ​​(E-value < 0.01). Overlapping multicopy sequences were then combined using bedtools (v2.30.0), and potential multicopy sequences were collected using samtools (1.9) based on these folded regions. Finally, the multicopy sequences were used as query sequences in the NCBI database for BLAST alignment with the genomes of all known species to obtain highly specific multicopy sequences.

[0055] Following the multicopy-specific sequence screening procedure described above, a multicopy-specific sequence was obtained. This sequence is 204 bp in length, has a copy number of 135 in the *Thielaviopsis basicola* genome, and sequence alignment shows that it is specifically present only in the *Thielaviopsis basicola* genome. The obtained multicopy-specific sequence is as follows:

[0056] CACATACGACCATAGCCTGTAGAAAGCACGGGATCCCGTCCCGCTCTCCCTTAGTTAACCTACAGA

[0057] GCGCCGGACTAGTACTACGGTGGGTGACCACGTGGGAATCCCCGGTGTTGTATGTCATCTTTTTACATG

[0058] GTCAGTCTGCTTACTGTGGGGGTTGTTTTTTGCTCTCCCCCAATCCGGCTTGACTTGACTATATTTAAC

[0059] G.

[0060] To apply this multi-copy sequence to the detection of tobacco root black rot, specific primers and probes were designed based on the characteristics of RPA amplification enzyme and Primer5. The resulting sequences are shown in SEQ ID NO.1-SEQ ID NO.7 of the sequence listing. Simultaneously, a detection kit for tobacco root black rot pathogens based on the LF-RPA strategy was established. The downstream modified primers were then biotin-labeled at the 5' end, and the probe was FAM fluorescently labeled at the 5' end. The probe's middle sequence contains tetrahydrofuran residues, and the 3' end has a spacerC3 blocking group, as detailed in Table 1.

[0061] Table 1

[0062]

[0063]

[0064] Example 2: Diagnostic methods and kits

[0065] Based on the upstream primers, downstream modified primers, and probes disclosed in Example 1, a rapid diagnostic method and kit for tobacco root black rot was developed for field use.

[0066] The detection method is as follows:

[0067] DNA extract from the diseased plant tissue to be tested was added to the reaction system for RPA amplification, and the results were read using an immunochromatographic gold lateral flow test strip.

[0068] Specifically, such as Figure 1 The kit shown consists of the following components:

[0069] ① Lysis buffer: 4% PEG 2000 + 24mM NaOH + 1mM EDTA, total volume 300μL;

[0070] ② Disposable plastic grinding rods;

[0071] ③ Reaction solution: upstream primer (10μM, 2μL), downstream modification primer (10μM, 2μL), probe (10μM, 0.6μL), commercial RPA reaction buffer A (Junuode, catalog number A4631, 40.9μL), total volume 45.5μL;

[0072] ④Reaction solution b: Commercial RPA reaction buffer B (Junuode, catalog number A4631);

[0073] ⑤ Dry powder tubes: The enzymes and exonuclease nfo related to RPA reaction amplification are more stable and easier to transport and store after being prepared as dry powder;

[0074] ⑥ Plastic micro-pipette;

[0075] ⑦ Diluent: 400 μL of sterile ultrapure water;

[0076] ⑧ Small strip: Commercial "double antibody sandwich" immunochromatographic test strips for 6-FAM and Biotin.

[0077] The specific instructions for using the kit are as follows:

[0078] (1) Take about 0.05g of the diseased plant tissue to be tested, about half the size of a fingernail, add lysis buffer and grind it. After grinding and lysis, wait 2 minutes for complete lysis (the lysis time should not exceed 5 minutes) to obtain DNA extract.

[0079] (2) Add reaction solution a to the RPA reaction amplification enzyme and exonuclease dry powder tube, use a pipette to extract DNA extraction solution (the liquid is drawn to the thin black line of the pipette) into the reaction tube, and after drawing reaction solution b into the reaction tube, carry out the RPA reaction, hold it with your hand or put it in your pocket to keep the temperature above 30°C for 15 minutes.

[0080] ( ) Use a pipette to draw all the reaction solution into a 1.5 mL tube containing diluent for dilution. Insert the test strip (with the arrow end immersed in the liquid) into this tube and read the result after 3-5 minutes.

[0081] If both the C line and T line on the lateral flow chromatography test strip show bands, the sample is positive; if the C line shows a band but the T line does not, the sample is negative.

[0082] The reagent kit disclosed in this invention has the advantages of being portable, easy to operate, not limited by the testing site, and requiring no additional equipment, making it very suitable for use in the field or in the wild.

[0083] Example 3: Detection of tobacco root black rot with different primer combinations

[0084] Referring to the detection method in Example 2, Thieviopsis basicola genomic DNA was used as the reaction template (1 ng), the reaction time was 20 min, and the reaction temperature was 37 °C. The detection of RPA combined with immunogold flow chromatography was compared under different primer combinations (upstream primer and downstream modified primer were combined respectively, while the probe remained unchanged).

[0085] The primer combinations used in the experiment are as follows:

[0086] The results obtained for primerless, TbF1+TbR1, TbF1+TbR2, TbF1+TbR3, TbF2+TbR1, TbF2+TbR2, TbF2+TbR3, TbF3+TbR1, TbF3+TbR2, and TbF3+TbR3 are as follows: Figure 2 As shown.

[0087] The analysis results show that any different upstream primers and downstream modified primers are suitable for the detection of Thieviopsis basicola, with obvious T-bands. Among them, the primer combinations of TbF1+TbR3 and TbF3+TbR1 have the best detection effect. This shows that the primers disclosed in this invention can flexibly pair upstream primers and downstream modified primers.

[0088] Example 5: Detection of Tobacco Root Black Rot at Different Reaction Temperatures

[0089] Following the method described in Example 2, Thieviopsis basicola genomic DNA was used as the reaction template (1 ng), the reaction time was 20 min, and the primer combination TbF1+TbR3 was selected. It was verified that the reaction could proceed at temperatures ranging from 25-40℃. The RPA reaction temperatures were set to 25℃, 30℃, 35℃, 40℃, and 45℃, and the results are as follows. Figure 3 As shown.

[0090] The analysis results show that the RPA reaction can proceed well within the reaction temperature range of 25-40℃, indicating that the detection method disclosed in this invention is applicable to different outdoor environments. Considering that the temperature range of 23-35℃ is during the tobacco root black rot disease season, the method of covering the reaction tube by hand can be used to provide a suitable RPA reaction temperature.

[0091] Example 6: Specificity Test

[0092] The method used in Example 2 was employed, with TbF1+TbR3 as the primer combination, a reaction temperature of 37°C, and a DNA template of 1 ng for specificity experiments. The first three pathogens were *Thielaviopsis basicola* isolated from different regions, followed by specificity experiments on *Corynespora cassioha* (the pathogen causing tobacco leaf spot), *Ralstonia solanacearum* (the pathogen causing tobacco bacterial wilt), *Phytophthora nicotianae* (the pathogen causing tobacco black shank), *Colletotrichum micotianae* (the pathogen causing tobacco anthracnose), and *Pseudomonas syringae pv. tabaci* (the pathogen causing tobacco wildfire). The results are as follows: Figure 4 As shown.

[0093] The analysis results show that the detection method of this invention specifically detects *Leuconostoc rhizogenes*, and will not produce false positives when detecting other common tobacco diseases. This indicates that the primers and probes have high specificity and are only targeted at detecting tobacco black root rot.

[0094] Example 7: Sensitivity Test

[0095] Following the method in Example 2, different concentrations of Thieviopsis basicola genomic DNA were used as reaction templates. The reaction time was set to 15 min and the reaction temperature to 37°C for RPA amplification. The template amounts were 10 ng, 1 ng, 100 pg, 10 pg, 1 pg, 100 fg, 10 fg, and NTC (without genomic template). The results are shown below. Figure 5 As shown.

[0096] The analysis results show that the detection limit for Phytophthora parasitica disclosed in this invention is 100 fg, and the detection band is very obvious when the genomic template is 1 pg or more.

[0097] Example 8: Equipment-free detection experiment of artificially inoculated disease samples

[0098] To verify the effectiveness of the kit in actual field use, the method in Example 2 was used to detect pathogens in tobacco root and stem tissues inoculated with Leuconostoc rhizomes on six artificial inoculation substrates without any additional equipment in the field. The results are as follows: Figure 6 As shown.

[0099] The analysis results show that, from left to right, the samples are: negative control, and disease samples 1-6. The results indicate that all disease samples showed clear bands, with a detection accuracy of 100%.

[0100] The above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the present invention, and all such modifications and substitutions should be covered within the scope of the claims of the present invention. Technical aspects, shapes, and structures not described in detail in this invention are all well-known technologies.

Claims

1. A primer and probe for rapid detection of tobacco root black rot pathogen, characterized in that, The primers include an upstream primer and a downstream modification primer. The nucleotide sequences of the upstream primers are shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3, respectively, and the nucleotide sequences of the downstream modification primers are shown in SEQ ID NO.4, SEQ ID NO.5, and SEQ ID NO.6, respectively. The nucleotide sequence of the probe is shown in SEQ ID NO.

7. The downstream modified primer has a biotinylated 5' end, the probe has a fluorescent 5' end, and the probe further includes at least one of the following features: (1) The intermediate sequence of the probe contains a nucleotide analog; (2) The nucleotide analogues include tetrahydrofuran residues; (3) The 3' end of the probe has a polymerase extension blocking group; (4) The polymerase extension blocking group includes any one of the following: C3-spacer group, phosphate group, and dideoxynucleotide; The fluorescent label is FAM.

2. The application of the primers and probes according to claim 1 in the detection of tobacco root black rot by immunochromatographic colloidal gold lateral flow chromatography.

3. A method for rapidly detecting tobacco root black rot pathogen using the primers and probes described in claim 1, characterized in that, The method is as follows: DNA was extracted from the plant tissue to be tested to obtain a DNA extract. The DNA extract was subjected to RPA amplification reaction, and the results were read using an immunochromatographic gold lateral flow test strip. The RPA amplification reaction system consisted of 50 µL, including 2 µL of DNA extraction buffer, 2 µL of 10 µM upstream primer, 2 µL of 10 µM downstream modification primer, 0.6 µL of 10 µM probe, 40.9 µL of Buffer A, 2.5 µL of Buffer B, and RPA amplification enzyme and exonuclease dry powder tubes. The reaction conditions were incubation at 25-40℃ for at least 15 min.

4. A rapid detection kit for tobacco root black rot pathogen, characterized in that, The kit also includes lysis buffer, reaction solution a, reaction solution b, RPA reaction amplification enzyme and exonuclease dry powder, ultrapure water dilution solution, and test strips. Reaction solution a includes pre-mixed upstream primer, downstream modification primer, probe, and Buffer A. Reaction solution b includes Buffer B. The upstream primer is selected from one of the upstream primers with nucleotide sequences shown in SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3, respectively. The downstream modification primer is selected from one of the downstream modification primers with nucleotide sequences shown in SEQ ID NO.4, SEQ ID NO.5, and SEQ ID NO.6, respectively. The nucleotide sequence of the probe is shown in SEQ ID NO.

7.

5. The kit for rapid detection of tobacco root black rot pathogen according to claim 4, characterized in that, The lysis buffer was prepared with 4% PEG 2000, 24 mM NaOH, and 1 mM EDTA, with a total volume of 300 µL; the reaction solution a had a total volume of 45.5 µL, including 2 µL of 10 µM upstream primer, 2 µL of 10 µM downstream modification primer, 0.6 µL of 10 µM probe, and the remainder was Buffer A; the ultrapure water dilution solution was 400 µL; and the reaction solution b had a total volume of 2.5 µL.

6. The kit for rapid detection of tobacco root black rot pathogen according to claim 5, characterized in that, The method of using the kit is as follows: S1: Take the diseased plant tissue to be tested, add lysis buffer and grind it. After grinding, wait 2 minutes for full lysis, and the lysis time shall not exceed 5 minutes to obtain DNA extract. S2: Add reaction solution a to the tube containing RPA reaction amplification enzyme and exonuclease dry powder, draw DNA extraction solution into the reaction tube, then draw reaction solution b to start the RPA reaction, and react at 25-40℃ for more than 15 minutes. S3: Draw all the reaction solution into a tube containing diluent for dilution, insert the test strip into the tube, and read the result after 3-5 minutes.

7. The application of the kit according to any one of claims 4-6 in the detection of tobacco root black rot.

Citation Information

Patent Citations

  • Primer, detecting probe and actual time fluorescent PCR kit for detecting Thielaviopsls basicola

    CN101451162A