A cassava plant height SNP molecular marker, KASP primer set and its application
By developing SNP molecular markers and KASP primer sets related to cassava plant height, and using PCR amplification and fluorescence signal detection, the time-consuming problem of traditional breeding methods was solved, and efficient screening of cassava plant height traits and improved breeding efficiency were achieved.
Patent Information
- Application Number
- CN202411901081.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-23
- Publication Date
- 2025-09-05
- Estimated Expiration
- 2044-12-23
AI Technical Summary
Existing technologies make it difficult to efficiently screen out dwarf cassava varieties. Traditional breeding methods are time-consuming and inefficient, and the application of KASP markers in cassava breeding has not been widely reported.
Develop SNP molecular markers and KASP primer sets related to cassava plant height, and achieve early auxiliary prediction and identification of cassava germplasm plant height traits through PCR amplification and fluorescence signal detection.
It achieves efficient screening of plant height phenotypes of cassava germplasm, shortens the breeding cycle, improves breeding efficiency, and is simple, convenient and low-cost to operate.
Smart Images

Figure SMS_1 
Figure SMS_2 
Figure SMS_3
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of molecular biology, and particularly relates to a cassava plant height SNP molecular marker, a KASP primer set and applications thereof. Background Art
[0002] Cassava (Manihot esculenta Crantz), a plant of the genus Manihot in the Euphorbiaceae family, is the staple food of over one billion people worldwide and is ranked as the world's sixth-largest food crop. It is also a key raw material for industries such as alcohol, pharmaceuticals, and feed. In recent years, the global food and energy supply chains have been impacted by climate change and the pandemic. As a crop that combines both food and energy resources, cassava has enormous economic value and market potential, attracting widespread attention worldwide. However, due to various reasons, problems such as low cassava yield, poor lodging resistance, single cultivar, aging, and low mechanization levels remain unresolved, severely hindering the development of my country's cassava industry. Plant height is one of the most important plant traits of cassava and has a significant impact on its yield and quality. Furthermore, dwarfing plant height facilitates mechanized harvesting, increases yield and photosynthetic efficiency, improves fertilizer tolerance, tolerates dense planting, resists lodging, enhances the transport of crop nutrients to reproductive organs, and can also reduce the use of chemical growth regulators, thereby protecting the ecological environment. Therefore, cultivating cassava varieties with dwarfed plant height is an important issue that urgently needs to be addressed in the development of my country's cassava industry.
[0003] Due to the complex genetic background and long growth cycle of cassava, traditional breeding methods for genetic improvement are inefficient, time-consuming, and labor-intensive. Furthermore, plant height development is easily affected by external factors, making it difficult to screen for cassava varieties with dwarfed plant height using traditional breeding methods. The development of modern molecular biology techniques has enabled the use of molecular markers closely linked to relevant traits for parent selection or pre-screening of hybrid offspring, thereby improving breeding efficiency. Therefore, establishing an efficient DNA molecular marker and its detection method has become one of the most pressing issues in identifying cassava plant height and is of great significance to cassava breeding.
[0004] Competitive allele-specific PCR (KASP) is a method for SNP typing based on specific primer terminal base matching and universal fluorescent probes. Typing can be achieved using a fluorescent quantitative PCR instrument or a conventional PCR instrument combined with a microplate reader. It offers advantages such as high throughput, low cost, stability, efficiency, accuracy, and flexibility. KASP molecular markers have become a new generation of SNP typing markers and have been widely used in fine gene mapping, marker-assisted selection breeding, and germplasm resource identification in various crops. However, the application of KASP markers in cassava breeding is rarely reported, and no research has yet been conducted on molecular markers related to cassava plant height. Therefore, the development and design of KASP molecular markers related to cassava plant height and their genotyping validation in natural and hybrid populations will support the use of KASP markers for cassava parent selection and early selection of hybrid progeny, helping to accelerate the selection process and improve breeding efficiency.
[0005] The information disclosed in this background technology section is only intended to enhance understanding of the overall background of the invention and should not be regarded as an admission or any form of suggestion that the information constitutes the prior art already known to a person skilled in the art. Summary of the Invention
[0006] The present invention aims to provide a SNP molecular marker associated with cassava plant height, a KASP primer set, and applications thereof. The SNP molecular marker and KASP primer set can perform early auxiliary prediction and identification of the plant height phenotype of cassava germplasm, are simple and convenient to operate, have low cost, and high selection efficiency, and can efficiently screen target individual plants or a large number of progeny with potential excellent quality, thereby shortening the cassava breeding cycle and improving breeding efficiency.
[0007] To achieve the above object, the present invention provides the following technical solutions:
[0008] The first object of the present invention is to provide a cassava plant height SNP molecular marker, the nucleotide sequence of the cassava plant height SNP molecular marker is as follows:
[0009] AGGTTCCTCCACATGATATTTGTTATCAGAGGTTCCCTAAATAAATGATATG ACATGAGCAAATTTACATAACATCTAAAATGCAAAATGGAATTGCCTAAGCTGG TTTGTTAACAGAGCTGAATCTCTGAAAAGTGAACAAAAGATGC[C / T]AAGTAGA CATAAAACAATAGAATTAAAGTCAAAAATCCATTTTCTTGGACTACCAAAAAT TGAAAATTAGCAACTCCTTGCCTCGTAAGCAAGGACAAAGCAATTTATTAAAGA AAAATTCACAATCCCAACAAATATTACAGTTTGCA;
[0010] The allele variation base of the SNP molecular marker site is C / T, which is located at position 3091721 of chromosome 6 of the cassava genome.
[0011] The second object of the present invention is to provide a KASP primer set for detecting the cassava plant height SNP molecular marker, the KASP primer set consists of a forward primer Fc, a forward primer Ft and a universal reverse primer R, and the nucleotide sequences thereof are shown in SEQ ID No. 1-3.
[0012] Furthermore, one end of the forward primer Fc is connected to a FAM fluorescent label sequence, and one end of the forward primer Ft is connected to a HEX fluorescent label sequence.
[0013] The third object of the present invention is to provide an application of the KASP primer set in identifying high-quality cassava strains.
[0014] A fourth object of the present invention is to provide a method for identifying cassava plant height using the KASP primer set, comprising the following steps:
[0015] S1. extracting genomic DNA from the cassava germplasm to be identified, and performing PCR amplification using the KASP primer set to obtain a PCR amplification product;
[0016] S2. Determine the plant height of the cassava germplasm to be identified based on the fluorescence signal results of the PCR amplification product.
[0017] Furthermore, in step S1, the PCR amplification system is: PCR amplification system is: template DNA 2 μL, 2×PARMS mastermix 5 μL, 10 μM forward primer Fc 0.15 μL, 10 μM forward primer Ft 0.15 μL, 10 μM reverse primer R 0.4 μL, ddH2O 3.3 μL.
[0018] Furthermore, in step S1, the PCR amplification program is: pre-denaturation at 94°C for 20 min; denaturation at 94°C for 20 s, extension at 65-57°C for 1 min, 10 cycles, with the extension temperature decreasing by 0.8°C in each cycle; denaturation at 94°C for 20 s, extension at 57°C for 1 min, 32 cycles.
[0019] Furthermore, in step S2, if the fluorescence signal result of the PCR amplification product is FAM, it means that the CC homozygous genotype is detected, and the cassava germplasm to be identified is a dwarf variety;
[0020] If the fluorescence signal result of the PCR amplification product is HEX, it means that the TT homozygous genotype is detected, and the cassava germplasm to be identified is a tall-stem variety.
[0021] Compared with the prior art, the present invention has the following beneficial effects:
[0022] The SNP molecular marker of the present invention is significantly correlated with the cassava plant height trait. In practical applications, it is only necessary to use the KASP primer set of the present invention to perform PCR amplification on the DNA of cassava germplasm leaf samples and detect the fluorescence signal thereof to perform early auxiliary prediction and identification of the cassava germplasm plant height phenotype. The operation is simple and convenient, the cost is low, and the selection efficiency is high. Target individual plants or a large number of progeny with potential excellent quality can be efficiently screened, thereby shortening the cassava breeding cycle and improving breeding efficiency. BRIEF DESCRIPTION OF THE DRAWINGS
[0023] Figure 1 Typing of different genotypes of cassava.
[0024] Description of main reference numerals:
[0025] Figure 1 In the middle, the FAM fluorescence signal result is blue on the typing diagram, indicating that the CC homozygous genotype is detected;
[0026] The HEX fluorescence signal result is green on the typing diagram, indicating that the TT homozygous genotype is detected;
[0027] The FAMHEX fluorescence signal result is red on the typing diagram, indicating that the CT heterozygous genotype has been detected. DETAILED DESCRIPTION
[0028] The following is a clear and complete description of the technical solution of the present invention. Obviously, the embodiments described are part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without making any creative efforts are within the scope of protection of the present invention.
[0029] Example 1 :SNP molecular marker
[0030] A cassava plant height SNP molecular marker, characterized in that the nucleotide sequence of the cassava plant height SNP molecular marker is as follows:
[0031] AGGTTCCTCCACATGATATTTGTTATCAGAGGTTCCCTAAATAAATGATATG ACATGAGCAAATTTACATAACATCTAAAATGCAAAATGGAATTGCCTAAGCTGG TTTGTTAACAGAGCTGAATCTCTGAAAAGTGAACAAAAGATGC[C / T]AAGTAGA CATAAAACAATAGAATTAAAGTCAAAAATCCATTTTCTTGGACTACCAAAAAT TGAAAATTAGCAACTCCTTGCCTCGTAAGCAAGGACAAAGCAATTTATTAAAGA AAAATTCACAATCCCAACAAATATTACAGTTTGCA;
[0032] The allele variation base of the SNP molecular marker site is C / T, which is located at position 3091721 of chromosome 6 of the cassava genome.
[0033] When the mutated base is C, the genotype is CC or CT; when the mutated base is T, the genotype is TT. Among them, when the genotype is CC, the cassava is a short-stem variety; when the genotype is TT, the cassava is a tall-stem variety.
[0034] Example 2 : KASP primer set
[0035] A KASP primer set for detecting the cassava plant height SNP molecular marker, the KASP primer set consists of a forward primer Fc, a forward primer Ft and a universal reverse primer R, and the sequences thereof are shown in Table 1 below.
[0036] Table 1 Molecular detection primer set sequences
[0037]
[0038] Example 3 :KASP primer set and cassava strains with high specificity
[0039] 1. At maturity, 214 cassava accessions were selected and their plant heights (the distance from the base of the cassava plant to the highest point) were measured with a ruler. Three plants were selected from each accession and the average of the measurements was taken as the plant height value for that accession.
[0040] 2. Take a cassava germplasm leaf sample of about 1 cm in length and width and place it in a deep-well plate (96 wells, 1.2 mL). Add 100 μL of 0.3 mol / L sodium hydroxide solution and grind at 50 Hz until the sample is completely ground.
[0041] 3. The ground product was centrifuged at 300 rpm for 1 min, and then placed in a boiling water bath for 2 min. 200 μL of 0.2 mol / L Tris-HCl (pH 6.8-7.0) was added and mixed, and then placed in a boiling water bath for another 2 min.
[0042] 4. After the water bath, centrifuge at 300 rpm for 1 minute, dilute the supernatant 20 times, and store at -20°C as the template DNA for subsequent PCR amplification;
[0043] 5. Construct the PCR amplification reaction system in Table 2 below and perform PCR amplification according to the PCR amplification program in Table 3;
[0044] Table 2 PCR amplification reaction system
[0045]
[0046] Table 3 PCR amplification program (dual-head 384 PCR instrument ABI GeneAmp 9700)
[0047]
[0048] 6. After PCR amplification, the fluorescence signal was read using a TECAN infinite M1000 microplate reader. The online software snpdecoder (http: / / www.snpway.com / snpdecoder / ) was then used to analyze and convert the fluorescence signal to obtain a clear and intuitive typing diagram, and the genotype results were output according to different colors. The results are shown in Tables 4-5 and Figure 1 .
[0049] Table 4 Plant height phenotypes and fluorescence signal results of different cassava germplasms
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058] Table 5 TT test statistical results
[0059]
[0060] Combined with Table 4, Table 5 and Figure 1 The KASP primer set of the present invention was used to genotype 214 cassava germplasm samples. Combined with the actual plant height types of the cassava germplasm samples, the genotyping results showed clear clustering and a high fit with the actual plant height phenotypes. Furthermore, the fluorescence signal results of the PCR amplification products of the KASP primer set differed significantly. This demonstrates that the KASP primer set of the present invention is specific for the cassava plant height phenotype.
[0061] Example 4 : Validity Verification
[0062] At maturity, the main cassava varieties currently in production were selected and their plant heights were measured with a ruler. Three plants of each variety were measured and the average value was taken as the actual height of the variety. The procedure and method described in Example 3 were then followed. The results are shown in Table 6.
[0063] Table 6 Plant height phenotype and fluorescence signal type results of cassava germplasm
[0064]
[0065] As shown in Table 6, the plant heights of different cassava germplasm phenotypes correspond to the types of fluorescence signals detected by the KASP primer set of the present invention, and the verification accuracy rate is 100%.
[0066] In summary, the KASP primer set of the present invention can be used as a primer set for detecting SNP molecular markers of cassava plant height, and can assist in the prediction and identification of plant height phenotypes of cassava germplasm.
[0067] The foregoing descriptions of specific exemplary embodiments of the present invention are for purposes of illustration and description. These descriptions are not intended to limit the invention to the precise forms disclosed, and it is apparent that many variations and modifications are possible in light of the foregoing teachings. The exemplary embodiments have been selected and described for the purpose of explaining the specific principles of the invention and their practical application, thereby enabling those skilled in the art to realize and utilize a variety of exemplary embodiments of the invention and various options and modifications. The scope of the invention is intended to be defined by the claims and their equivalents.
Claims
1. A cassava plant height SNP molecular marker, characterized in that: The nucleotide sequence of the cassava plant height SNP molecular marker is as follows: AGGTTCCTCCACATGATATTTGTTATCAGAGGTTCCCTAAATAAATGATATGACATGAGCAAATTTACATAACATCTAAAATGCAAAATGGAATTGCCTAAGCTGGTTTGTTAACAGAGCTGAATCTCTGAAAAGTGAACAAAAGATGC[C / T]AAGTAGACATAAAACAATAGAATTAAAGTCAAAAATCCATTTTCTTGGACTACCAAAAATTGAAAATTAGCAACTCCTTGCCTCGTAAGCAAGGACAAAGCAATTTATTAAAGAAAAATTCACAATCCCAACAAATATTACAGTTTGCA; Among them, [C / T] is the allelic variant base.
2. A KASP primer set for detecting the cassava plant height SNP molecular marker according to claim 1, characterized in that: The KASP primer set consists of a forward primer Fc, a forward primer Ft and a reverse primer R, and the nucleotide sequences thereof are shown in SEQ ID No. 1-3.
3. The KASP primer set according to claim 2, characterized in that One end of the forward primer Fc is connected to a FAM fluorescent label sequence, and one end of the forward primer Ft is connected to a HEX fluorescent label sequence.
4. Use of the KASP primer set according to claim 2 in identifying high-quality cassava strains.
5. A method for identifying cassava plant height using the KASP primer set according to claim 2, characterized in that: The following steps are involved: S1. Extracting genomic DNA from the cassava germplasm to be identified, and performing PCR amplification using the KASP primer set according to claim 2 to obtain a PCR amplification product; S2. Determine the plant height of the cassava germplasm to be identified based on the fluorescence signal of the PCR amplification product.
6. The method according to claim 5, wherein In step S1, the PCR amplification system is: template DNA 2 μL, 2×PARMS master mix 5 μL, 10 μM forward primer Fc 0.15 μL, 10 μM forward primer Ft 0.15 μL, 10 μM reverse primer R 0.4 μL, ddH2O 3.3 μL.
7. The method according to claim 5, characterized in that In step S1, the PCR amplification program is as follows: pre-denaturation at 94°C for 20 min; denaturation at 94°C for 20 s, extension at 65-57°C for 1 min, 10 cycles, with the extension temperature decreasing by 0.8°C each cycle; denaturation at 94°C for 20 s, extension at 57°C for 1 min, 32 cycles.
8. The method according to claim 5, characterized in that In step S2, if the fluorescence signal result of the PCR amplification product is FAM, it means that the CC homozygous genotype is detected, and the cassava germplasm to be identified is a dwarf variety; If the fluorescence signal result of the PCR amplification product is HEX, it means that the TT homozygous genotype is detected, and the cassava germplasm to be identified is a tall-stem variety.
Citation Information
Patent Citations
Non-heading Chinese cabbage core SNP molecular marker set developed based on KASP technology and application of non-heading Chinese cabbage core SNP molecular marker set
CN113403423A
KASP molecular marker closely linked with major QTL of pod wall tenderness of peas and development method and application of KASP molecular marker
CN113481312A