Real-time fluorescent quantitative PCR (Polymerase Chain Reaction) detection kit for porcine reproductive and respiratory syndrome virus and application thereof

Abstract

The invention belongs to the technical field of biology, and particularly relates to a real-time fluorescent quantitative PCR (polymerase chain reaction) detection kit for porcine reproductive and respiratory syndrome virus and application of the real-time fluorescent quantitative PCR detection kit. The invention designs a primer probe combination for detecting porcine reproductive and respiratory syndrome virus, the primer probe combination consists of a primer P1, a primer P2 and a probe, and the sequences of the primer P1, the primer P2 and the probe are respectively shown as a sequence 1, a sequence 2 and a sequence 3. The invention further provides a kit containing the primer probe combination. The kit can be used for identifying and detecting the porcine reproductive and respiratory syndrome virus. The primer P1 and the primer P2 designed by the invention have strong specificity and high sensitivity, the detection sensitivity of the primer P1 and the primer P2 to the porcine reproductive and respiratory syndrome virus reaches 1.0 * 10 < 1 > copies / mu L, the detection repeatability is good, and the primer P1 and the primer P2 can be used for rapidly detecting the porcine reproductive and respiratory syndrome virus.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and specifically relates to a porcine reproductive and respiratory syndrome virus real-time fluorescence quantitative PCR detection kit and an application thereof. Background Art

[0002] Porcine reproductive and respiratory syndrome virus (PRRSV) is one of the most devastating viral diseases in the global swine industry. There are two genotypes of PRRSV: the European type (PRRSV-1), represented by the Lelystad strain; and the North American type (PRRSV-2), represented by the VR-2332 strain. Although the pathological changes, clinical symptoms and genome structures caused by the two genotypes are very similar, their nucleotide homology is only 60%. PRRSV is an enveloped RNA virus belonging to the order Nidovirales and the genus Arterivirus of the family Arteriviridae. The PRRSV genome is approximately 15 kb long and has at least 10 open reading frames (ORFs). The PRRSV genome contains ORF1a, ORF1b, ORF2a, ORF2b, ORF3, ORF4, ORF5, ORF5a, ORF6 and ORF7 from the 5′ end to the 3′ end. Among them, ORF2-ORF5 encode structural proteins: GP2a, E, GP3, GP4, GP5 and GP5a; ORF6 encodes matrix protein (M); ORF7 encodes viral nucleocapsid protein (N).

[0003] At present, PRRSV in domestic pig farms is mostly latent infection and subclinical infection, and the diversity of PRRSV strains leads to large differences in clinical symptoms, pathological changes, duration of disease, mortality and morbidity. In addition, the clinical symptoms of PRRSV are similar to those of brucellosis, pseudorabies and porcine parvovirus (PPV), so the early clinical diagnosis of PRRSV is very difficult. Therefore, the establishment of rapid, accurate and efficient detection technology is crucial for the timely detection and control of PRRS. Summary of the invention

[0004] In view of the problems and shortcomings in the prior art, the object of the present invention is to provide a porcine reproductive and respiratory syndrome virus real-time fluorescence quantitative PCR detection kit and its application.

[0005] To achieve the purpose of the invention, the technical solution adopted by the present invention is as follows:

[0006] The first aspect of the present invention provides a primer-probe combination for detecting porcine reproductive and respiratory syndrome virus, the primer-probe combination consisting of primer P1, primer P2 and a probe, wherein:

[0007] The nucleotide sequence of the primer P1 is: GCCAAATGCTGGGTAAGAT (such as sequence 1 in the sequence table);

[0008] The nucleotide sequence of the primer P2 is: CAGTCGCAAGAGGGAAATG (such as sequence 2 in the sequence table);

[0009] The nucleotide sequence of the probe is: TCGCCCAACAAAACCAGTCCAGAGG (such as sequence 3 in the sequence listing).

[0010] According to the above primer-probe combination, preferably, the 5' end of the probe is labeled with a fluorescent reporter group, and the 3' end of the probe is labeled with a fluorescent quencher group.

[0011] According to the above primer-probe combination, preferably, the fluorescent reporter group is selected from any one of FAM, VIC, HEX, TRT, CY3, CY5, ROX, JOE, FITC, TET, NED, TAMRA, LC RED640, LC RED705, Quasar705, and Texas Red, and the fluorescent quencher group is selected from any one of TAMRA, BHQ1, BHQ2, and BHQ3. More preferably, the fluorescent reporter group is FAM, and the fluorescent quencher group is TAMRA.

[0012] The second aspect of the present invention provides the use of the primer-probe combination described in the first aspect in the preparation of a product for identifying or assisting in the identification of porcine reproductive and respiratory syndrome virus.

[0013] The third aspect of the present invention provides the use of the primer-probe combination described in the first aspect in the preparation of a product for identifying or assisting in identifying whether a sample to be tested contains porcine reproductive and respiratory syndrome virus.

[0014] A fourth aspect of the present invention provides a kit, comprising the primer-probe combination according to any one of claims 1 to 3.

[0015] According to the above-mentioned kit, preferably, the kit further contains a negative control and a positive control, the negative control is RNase Free dH2O, and the positive control is total RNA containing porcine reproductive and respiratory syndrome virus.

[0016] The fifth aspect of the present invention provides the use of the kit described in the fourth aspect in the preparation of a product for identifying or assisting in the identification of porcine reproductive and respiratory syndrome virus.

[0017] The sixth aspect of the present invention provides the use of the kit described in the fourth aspect in the preparation of a product for identifying or assisting in identifying whether a sample to be tested contains porcine reproductive and respiratory syndrome virus.

[0018] A seventh aspect of the present invention provides a method for identifying or assisting in identifying porcine reproductive and respiratory syndrome virus, comprising the following steps:

[0019] (1) Extracting RNA of the virus to be tested;

[0020] (2) performing reverse transcription using the RNA extracted in step (1) as a template to obtain cDNA;

[0021] (3) Using the cDNA obtained in step (2) as a template, qPCR amplification is performed using the primer-probe combination described in the first aspect or the kit described in claim 4. After the qPCR amplification reaction is completed, the amplification product is detected and analyzed; if the amplification product shows an S-curve amplification and the Ct value is less than 40, the sample to be tested contains or is suspected of containing porcine reproductive and respiratory syndrome virus; otherwise, the sample to be tested does not contain or is suspected of not containing porcine reproductive and respiratory syndrome virus.

[0022] According to the above method, preferably, the qPCR amplification reaction system is: Premix Ex Taq TM (ProbeqPCR) (2X) 10μl, 10μmol / L primer P1 0.4μl, 10μmol / L primer P2 0.4μl, 2.5μmol / L probe 0.8μl, cDNA template 2.0μl, and make up to 20μL with sterile ddH2O.

[0023] According to the above method, preferably, the qPCR amplification reaction conditions are: pre-denaturation at 95°C for 30 seconds; 95°C for 5 seconds, 62°C for 20 seconds, for a total of 40 cycles.

[0024] According to the above method, preferably, the reverse transcription is performed using a HiScriptⅢRT SuperMix for qPCR (+gDNA wiper) reverse transcription kit.

[0025] The eighth aspect of the present invention provides a method for identifying or assisting in identifying whether a sample to be tested contains porcine reproductive and respiratory syndrome virus, comprising the following steps:

[0026] (1) extracting RNA from the sample to be tested;

[0027] (2) performing reverse transcription using the RNA extracted in step (1) as a template to obtain cDNA;

[0028] (3) Using the cDNA obtained in step (2) as a template, PCR amplification is performed using the primer-probe combination described in the first aspect or the kit described in claim 4. After the PCR amplification reaction is completed, the amplified product is detected and analyzed; if the amplified product shows an S-curve amplification and the Ct value is less than 40, the sample to be tested contains or is suspected of containing porcine reproductive and respiratory syndrome virus; otherwise, the sample to be tested does not contain or is suspected of not containing porcine reproductive and respiratory syndrome virus.

[0029] According to the above method, preferably, the qPCR amplification reaction system is: Premix Ex Taq TM (ProbeqPCR) 10μl, 10μmol / L primer P1 0.4μl, 10μmol / L primer P2 0.4μl, 2.5μmol / L probe 0.8μl, cDNA template 2.0μl, and make up to 20μL with sterile ddH2O.

[0030] According to the above method, preferably, the qPCR amplification reaction conditions are: pre-denaturation at 95°C for 30 seconds; 95°C for 5 seconds, 62°C for 20 seconds, for a total of 40 cycles.

[0031] According to the above method, preferably, the reverse transcription is performed using a HiScriptⅢRT SuperMix for qPCR (+gDNA wiper) reverse transcription kit.

[0032] Compared with the prior art, the present invention has the following positive and beneficial effects:

[0033] (1) The present invention takes the conservative sequence on PRRSV ORF7 as the target gene (length of 111 bp) and designs specific amplification primers and probes. The specific amplification primers and probes have strong specificity and only produce specific amplification reaction to PRRSV, and do not cross-react with porcine circovirus type 2, pseudorabies virus, porcine epidemic diarrhea virus, and porcine transmissible gastroenteritis virus. In addition, the specific amplification primers and probes have good sensitivity, and the minimum detection concentration of the plasmid containing the PRRSV ORF7 gene sequence is 1.0×10 1 Therefore, the specific amplification primers and probes designed by the present invention can be used for the rapid detection of PRRSV, providing a new technical means for the detection of PRRSV.

[0034] (2) When the method for identifying or assisting in identifying porcine reproductive and respiratory syndrome virus of the present invention is used to detect samples, the intra-group variation rate of the samples is 0.8877%-0.9583%, and the inter-group variation rate of the samples is 0.6734%-1.7025%. Therefore, the method has good repeatability and the detection results are accurate and reliable.

[0035] (3) The method for identifying or assisting in the identification of porcine reproductive and respiratory syndrome virus of the present invention has a short detection time, is simple to operate, and has simple requirements for instruments and equipment. It only requires an ordinary PCR instrument and can be operated by ordinary experimenters, so it can be promoted and applied on a large scale. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 The electrophoresis band detection results of the PCR amplification product of PRRSV ORF7 gene; wherein, lane M represents DL5000 nucleic acid marker, and lane 1 represents the amplified PRRSV ORF7 gene;

[0037] Figure 2 The electrophoresis band detection results after plasmid digestion; wherein, lane M represents DL5000 nucleic acid marker, and lane 1 represents plasmid digestion product;

[0038] Figure 3 The sensitivity test results of the real-time fluorescence quantitative PCR for detecting PRRSV in the present invention are shown in Figure 1. The concentrations of the plasmid standards corresponding to amplification curves 1 to 6 are 1.0×10 6 copies / μL, 1.0×10 5 copies / μL, 1.0×10 4 copies / μL, 1.0×10 3 copies / μL, 1.0×10 2 copies / μL, 1.0×10 1 copies / μL;

[0039] Figure 4 It is the specific test result of the PRRSV real-time fluorescence quantitative PCR detection method of the present invention;

[0040] Figure 5 1.0×10 4 copies / μL~1.0×10 8 qPCR amplification results of plasmid standards; the concentrations of plasmid standards corresponding to amplification curves 1 to 5 were 1.0×10 8 copies / μL, 1.0×10 7 copies / μL, 1.0×10 6 copies / μL, 1.0×10 5 copies / μL, 1.0×10 4 copies / μL. DETAILED DESCRIPTION

[0041] In order to make the purpose, technical solution and advantages of the present invention clearer, the technical solution of the present invention will be described in detail below.

[0042] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0043] Experimental materials: The positive strain samples of PRRSV, pseudorabies virus (PRV), porcine epidemic diarrhea virus (PEDV), porcine circovirus type 2 (PCV2), and porcine transmissible gastroenteritis virus (TGEV) that were inactivated at 56°C for 30 minutes were identified and preserved by gene amplification sequencing in the laboratory of the Institute of Animal Husbandry and Veterinary Medicine of Henan Academy of Agricultural Sciences. 52 suspected clinical tissue samples of pigs (lymph nodes, lungs, feces, etc.) were collected from different regions, inactivated at 56°C for 30 minutes by this laboratory, and then frozen at -80°C.

[0044] Main reagents: Nucleic acid extraction kit and plasmid extraction kit were purchased from Axygen Biotechnology Co., Ltd., reverse transcription reagent HiScriptⅢRT SuperMix for qPCR (+gDNAwiper) reagent was purchased from Nanjing Novozyme Biotechnology Co., Ltd.; Premix Ex Taq TM (Probe qPCR) Probe method fluorescent quantitative PCR enzyme, T4 ligase, DNA gel recovery kit, DH5α competent cells, BamH I and Pst I restriction endonucleases, and DL5000 nucleic acid marker were all purchased from TAKARA Biotechnology Co., Ltd.

[0045] Example 1: Design and synthesis of primers and probes

[0046] According to the ORF7 gene of the PRRSV genome logged in Gene Bank, the relatively conservative region of the PRRSVORF7 gene was screened through DNAMAN comparative analysis, and the conservative region was used as the target gene for primer design and probe design. According to the above screening, the target gene was obtained, and the primers and probes were designed with reference to the PCR primer design rules and probe design rules. Moreover, the FAM fluorescent reporter group was added to the 5' end of the probe, and the fluorescent quenching group TAMRA was added to the 3' end of the probe. The designed primers and probes were synthesized by Zhejiang Shangya Biological Co., Ltd.

[0047] The nucleotide sequences of the designed specific primer P1, primer P2, and probe are shown in the following sequence 1 to sequence 3, respectively, and the nucleotide sequence of the target gene is shown in the following sequence 4:

[0048] The nucleotide sequence of the primer P1 is: GCCAAATGCTGGGTAAGAT (sequence 1);

[0049] The nucleotide sequence of the primer P2 is: CAGTCGCAAGAGGGAAATG (sequence 2);

[0050] The nucleotide sequence of the probe is: TCGCCCAACAAAACCAGTCCAGAGG (sequence 3);

[0051] The nucleotide sequence of the target gene is:

[0052] GCCAAATGCTGGGTAAGATCATCGCCCAACAAAACCAGTCCAGAGGCAAGGGACCG GGGAAGAAAAATAGGAAGAAAAACCCGGAGAAGCCCCATTTCCCTCTTGCGACTG (Sequence 4).

[0053] Example 2: Establishment of PRRSV real-time fluorescence quantitative PCR detection method

[0054] 1. Preparation of pBV-220-ORF7 recombinant plasmid standard

[0055] According to the ORF7 gene of the PRRSV genome (Gene bank accession number HQ315835.1), primers PF and PR were designed for amplifying the PRRSV ORF7 gene; the total RNA of PRRSV in the diseased material was extracted using the OMEGA micro RNA extraction kit with the catalog number: R6831-00, and the HiScriptⅢRT SuperMix for qPCR (+gDNAwiper) reverse transcription kit of Nanjing Vazyme Company was used for reverse transcription and cDNA synthesis; the reverse transcription system and reaction process are as follows: the first step is to add 4μL gDNAwiper Mix to 16μL RNA at 42℃ for 2min to remove the residual DNA genome in the template, and further take 16μL of the reaction solution and add 4μL 5×qRT SuperMixⅢ. Then react at 37℃ for 15min and 85℃ for 5min.

[0056] The cDNA synthesized by reverse transcription was used as a template, and primers PF and PR were used for PCR amplification. The amplified products were detected by agarose gel electrophoresis. The electrophoresis detection results were as follows: Figure 1 As shown. Figure 1 It can be seen that after PCR amplification, 372 bp of ORF7 gene was obtained.

[0057] The ORF7 gene in the PCR amplification product was recovered and purified using a gel recovery kit. The pBV220 vector and the purified ORF7 gene were digested with BamH I and Pst I. The digested pBV220 vector and ORF7 gene were connected. The connection product was transformed into E. coli DH5α competent cells and cultured at 37°C overnight. Then a single colony was picked and transferred to AMP + Liquid LB medium was used for culturing for 16-18 hours, and the plasmid was extracted. The extracted plasmid was digested and then electrophoresed. At the same time, the extracted plasmid was sent to Shangya Bio for sequencing and identification. The electrophoresis test results after plasmid digestion are as follows Figure 2 As shown. Figure 2 It can be seen that after the plasmid was digested, a fragment of 372 bp was obtained; moreover, the extracted plasmid was found to be the pBV-220-ORF7 recombinant plasmid through plasmid sequencing, which shows that the pBV-220-ORF7 recombinant plasmid was successfully constructed. The concentration of the extracted pBV-220-ORF7 recombinant plasmid was determined by Nanodrop2000, and according to the formula 6.02×10 23 The number of copies / mole × (concentration) / (MW g / mol) = copies / mL was used to calculate the number of copies of the pBV-220-ORF7 recombinant plasmid. The concentration of the pBV-220-ORF7 recombinant plasmid was 365 ng / μL, and the number of copies was 8.2×10 10 / μL copies.

[0058] 2. Optimization of real-time fluorescence quantitative PCR detection system and establishment of detection method:

[0059] (1) Optimization of annealing temperature:

[0060] The constructed pBV-220-ORF7 recombinant plasmid was used as a template, and the PremixEx TaqTM probe method fluorescent quantitative PCR enzyme was used on the Roche LightCycler 96 fully automatic fluorescent quantitative PCR instrument using the primers P1, primer P2, and probe constructed in Example 1 to perform qPCR amplification reaction. During the qPCR amplification reaction, four different annealing temperatures (60°C, 61°C, 62°C, 63°C, and 64°C) were set, and three replicate controls were set for each annealing temperature sample to compare the effects of different annealing temperatures on the qPCR amplification effect. Among them, the qPCR amplification reaction system is: Premix Ex Taq TM(Probe qPCR) 10μl, 10μmol / L primer P1 0.4μl, 10μmol / L primer P2 0.4μl, 2.5μmol / L probe 0.8μl, cDNA template 2.0μl, sterile ddH2O to 20μL. qPCR amplification reaction conditions are: pre-denaturation 95℃ 30 seconds; 95℃ 5 seconds, 60-64℃ 20 seconds, a total of 40 cycles. The Ct value detection results of qPCR amplification at different annealing temperatures are shown in Table 1 below.

[0061] Table 1 shows the Ct value detection results of qPCR amplification at different annealing temperatures

[0062]

[0063] As shown in Table 1, when the annealing temperature is 62°C, the Ct value is the smallest and the amplification efficiency is the best; therefore, the annealing temperature is preferably 62°C.

[0064] (2) Optimization of probe concentration:

[0065] The constructed pBV-220-ORF7 recombinant plasmid was used as a template, and the PremixEx TaqTM probe method fluorescent quantitative PCR enzyme was used on the Roche LightCycler 96 fully automatic fluorescent quantitative PCR instrument to perform qPCR amplification reaction using primers P1, primer P2, and probe constructed in Example 1. During the qPCR amplification reaction, three different probe final concentrations were set (the three different probe final concentrations were: 100nmol / L, 200nmol / L, and 300nmol / L, and the corresponding probe addition volumes in the qPCR amplification reaction system were 0.8μl, 1.6μl, and 2.4μl, respectively), and three repeated controls were set for each primer concentration to compare the effects of different primer concentrations on the qPCR amplification effect. Among them, the qPCR amplification reaction system is: Premix Ex Taq TM (Probe qPCR) 10μl, 10μmol / L primer P1 0.4μl, 10μmol / L primer P2 0.4μl, 2.5μmol / L probe, cDNA template 2.0μl, sterile ddH2O to 20μL. qPCR amplification reaction conditions are: pre-denaturation 95℃ 30 seconds; 95℃ 5 seconds, 62℃ 20 seconds, a total of 40 cycles. The Ct value detection results of qPCR amplification at different probe final concentrations are shown in Table 2 below.

[0066] Table 2 shows the Ct value detection results of qPCR amplification at different probe concentrations

[0067]

[0068] As shown in Table 2, when the final concentration of the probe in the qPCR amplification reaction system is 100 nmol / L, the Ct value is the smallest and the amplification efficiency is the best; therefore, the final concentration of the probe is preferably 100 nmol / L.

[0069] (3) Optimization of primer concentration:

[0070] The constructed pBV-220-ORF7 recombinant plasmid was used as a template, and the PremixEx TaqTM probe method fluorescent quantitative PCR enzyme was used on the Roche LightCycler 96 fully automatic fluorescent quantitative PCR instrument to perform qPCR amplification reaction using the primers P1, primers P2, and probes constructed in Example 1. During the qPCR amplification reaction, four different final primer concentrations were set (the final concentrations of the four primers were 100nmol / L, 200nmol / L, 300nmol / L, and 400nmol / L, respectively, and the corresponding volumes of primers P1 and primers P2 added in the qPCR amplification reaction system were 0.2μl, 0.4μl, 0.6μl, and 0.8μl, respectively), and three repeated controls were set for each primer concentration to compare the effects of different primer concentrations on the qPCR amplification effect. Among them, the qPCR amplification reaction system is: Premix ExTaq TM (Probe qPCR) 10μl, 10μmol / L primer P1 0.2μl-0.8μl, 10μmol / L primer P2 0.2μl-0.8μl, 2.5μmol / L probe 0.8μl, cDNA template 2.0μl, sterile ddH2O to 20μL. qPCR amplification reaction conditions are: pre-denaturation 95℃ 30 seconds; 95℃ 5 seconds, 62℃ 20 seconds, a total of 40 cycles. The Ct value detection results of qPCR amplification at different primer final concentrations are shown in Table 3 below.

[0071] Table 3 shows the Ct value detection results of qPCR amplification under different primer concentrations

[0072]

[0073] As shown in Table 3, when the final concentration of primers in the qPCR amplification reaction system is 200 nmol / L, the Ct value is the smallest and the amplification efficiency is the best; therefore, the final concentration of primers is preferably 200 nmol / L.

[0074] After the above optimization, the optimal reaction system and reaction conditions for real-time fluorescence quantitative PCR detection were obtained. Among them, the optimal reaction system for fluorescence quantitative PCR detection was: Premix Ex Taq TM(Probe qPCR) 10μl, 10μmol / L primer P1 0.4μl, 10μmol / L primer P2 0.4μl, 2.5μmol / L probe 0.8μl, cDNA template 2.0μl, and make up to 20μL with sterile ddH2O.

[0075] The optimal reaction conditions for qPCR amplification reaction were: pre-denaturation at 95°C for 30 seconds; 95°C for 5 seconds, 62°C for 20 seconds, for a total of 40 cycles.

[0076] 3. Real-time fluorescence quantitative PCR detection method for PRRSV

[0077] The total RNA of the sample to be tested is extracted, and a reverse transcription kit is used to reverse transcribe the extracted total RNA to synthesize cDNA; the cDNA synthesized by reverse transcription is used as a template, and the optimal reaction system and optimal reaction conditions of the above-mentioned fluorescence quantitative PCR detection are used to perform real-time fluorescence quantitative PCR. If the amplification reaction product has an S curve, the sample contains or is suspected of containing PRRSV; if the amplification reaction product does not have an S curve, the sample does not contain or is suspected of not containing PRRSV.

[0078] Example 3: Sensitivity test of PRRSV real-time fluorescence quantitative PCR detection

[0079] The pBV-220-ORF7 recombinant plasmid standard prepared in Example 2 was diluted 10-fold with RNase-free water to 1.0×10 0 copies / μL, 1.0×10 1 copies / μL, 1.0×10 2 copies / μL, 1.0×10 3 copies / μL, 1.0×10 4 copies / μL, 1.0×10 5 copies / μL, 1.0×10 6 The concentration after dilution is 1.0×10 0 copies / μL~1.0×10 6 The optimal reaction system and reaction conditions for fluorescence quantitative PCR detection in Example 2 were used for qPCR amplification. Three replicates were made for each dilution of the positive plasmid. The sensitivity and minimum detection concentration of the method for detecting PRRSV by real-time fluorescence quantitative PCR established by the present invention were determined.

[0080] The results of the qPCR amplification reaction are as follows Figure 3 As shown. Figure 3It can be seen that the minimum detection concentration of the real-time fluorescence quantitative PCR detection method established in the present invention is 1.0×10 1 The number of plasmid copies / μL was 1.54, which proved that the detection sensitivity of this method was good.

[0081] Example 4: Repeatability test of PRRSV real-time fluorescence quantitative PCR detection

[0082] The pBV-220-ORF7 recombinant plasmid standard prepared in Example 2 was diluted 10 times with RNase-free water to 1.0×10 4 copies / μL, 1.0×10 5 copies / μL, 1.0×10 6 The concentration after dilution was 1.0×10 4 copies / μL, 1.0×10 5 copies / μL, 1.0×10 6 The plasmid standard of 1000 copies / μL was used as a template, double distilled water was used as a negative control, and the optimal reaction system and reaction conditions for fluorescence quantitative PCR detection in Example 2 were used for qPCR amplification; 3 intra-group repetitions and 3 inter-group repetitions were performed, and the intra-group and component standard deviations and coefficients of variation were statistically analyzed to verify the repeatability of the real-time fluorescence quantitative PCR detection method established by the present invention. The statistical results of the repeatability test of the real-time fluorescence quantitative PCR detection method of the present invention are shown in Table 4 below.

[0083] Table 4 is the statistical results of the repeatability test of the real-time fluorescence quantitative PCR detection method of the present invention

[0084]

[0085] As shown in Table 4, the intra-group variation rate of the samples is 0.8877-0.9583%, and the inter-group variation rate of the samples is 0.6734-1.7025%, which indicates that the fluorescence quantitative PCR method established in the present invention has good repeatability and good reliability of the detection results.

[0086] Example 5: Specificity test of PRRSV real-time fluorescence quantitative PCR detection

[0087] The RNA of Porcine circovirus type 2 (PCV2), Porcine Reproductive and Respiratory Syndrome Virus (PRRSV), Pseudorabies virus (PRV), Porcine epidemic diarrhea virus (PEDV), and Transmissible Gastroenteritis virus of swine (TGEV) were extracted respectively, and the extracted RNA of PRV, PEDV, PCV2, and PRRSV viruses were reverse transcribed using a reverse transcription kit to obtain the cDNA of each virus. The cDNA of PRV, PEDV, PCV2, TGEV, and PRRSV viruses were used as templates, and the optimal reaction system and reaction conditions for quantitative fluorescence PCR detection in Example 2 were used for qPCR amplification, and double distilled water was set as a negative control. The specificity of the method for detecting PRRSV by real-time fluorescence quantitative PCR established by the present invention was determined. The detection results of the specificity test are shown in the figure. Figure 4 shown.

[0088] Depend on Figure 4 It can be seen that after qPCR amplification, only the amplification product of PRRSV showed a specific amplification curve, while PRV, PEDV, PCV2, and TGEV all showed amplification curves. This shows that the PRRSV real-time fluorescence quantitative PCR detection method established by the present invention can specifically detect PRRSV and is specific to PRRSV.

[0089] Example 6: Quantitative Detection of PRRSV

[0090] The pBV-220-ORF7 recombinant plasmid standard prepared in Example 2 was diluted 10 times with RNase-free water to 1.0×10 4 copies / μL, 1.0×10 5 copies / μL, 1.0×10 6 copies / μL, 1.0×10 7 copies / μL, 1.0×10 8 copies / μL, 1.0×10 9 The concentration after dilution is 1.0×10 4 copies / μL~1.0×10 8The optimal reaction system and reaction conditions for fluorescence quantitative PCR detection in Example 2 were used as templates for qPCR amplification, and double distilled water was used as a negative control. Three replicates were made for each dilution of the positive plasmid. The qPCR amplification results are shown in Figure 2. Figure 5 shown.

[0091] Depend on Figure 5 It can be seen that plasmid standards of various dilutions can generate amplification curves. The Ct values ​​corresponding to the plasmid standards of various dilutions are 25.02, 21.49, 17.43, 13.69, 10.03, and 7.91, respectively. After qPCR amplification, the Ct value is the ordinate and the concentration of the plasmid standard is the abscissa. The standard curve is drawn using QuantStudioTM Real-Time PCR Software software. The linear equation corresponding to the standard curve is y=3.7891x-9.2783 (R 2 =0.9994).

[0092] The PRRSV real-time fluorescence quantitative PCR detection method established in Example 2 of the present invention is used to detect the sample to be tested, and the Ct value of the qPCR amplification of the sample to be tested is obtained. The Ct value of the sample to be tested is substituted into the linear equation y=3.7891x-9.2783 of the above-mentioned standard curve, and the concentration of PRRSV in the sample to be tested is calculated to achieve quantitative detection of PRRSV in the sample to be tested.

[0093] Example 7: Detection of clinical samples

[0094] The PRRSV real-time fluorescence quantitative PCR detection method established in Example 2 of the present invention was used together with the common PCR to detect 52 clinical serum samples collected for detection. The results are shown in Table 5.

[0095] Table 5 shows the test results of clinical samples

[0096] Detection Methods Total number of samples Number of positive samples Positive sample detection rate Fluorescence quantitative PCR 52 7 13.5 Conventional PCR 52 3 5.8

[0097] As can be seen from Table 5, among the 52 clinical serum samples, 3 positive samples were detected by conventional PCR, with a detection rate of 5.8%; the fluorescence quantitative PCR method established in the present invention detected a total of 7 positive samples, with a detection rate of 13.5%, including the 3 positive samples detected by conventional PCR; at the same time, a commercial ELISA kit was used to detect 4 differential clinical samples, and it was found that all 4 differential samples were positive, which shows that the PRRSV real-time fluorescence quantitative PCR detection method established in the present invention has higher sensitivity than the conventional PCR detection method.

[0098] The above embodiments are intended to illustrate the essential content of the present invention, but are not intended to limit the protection scope of the present invention. Those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the essence and protection scope of the technical solution of the present invention.

Claims

1. A primer-probe combination for detecting porcine reproductive and respiratory syndrome virus, characterized in that: It consists of primer P1, primer P2 and probe, wherein: The nucleotide sequence of the primer P1 is: GCCAAATGCTGGGTAAGAT; The nucleotide sequence of the primer P2 is: CAGTCGCAAGAGGGAAATG; The nucleotide sequence of the probe is: TCGCCCAACAAAACCAGTCCAGAGG.

2. The primer-probe combination according to claim 1, characterized in that: The 5' end of the probe is labeled with a fluorescent reporter group, and the 3' end of the probe is labeled with a fluorescent quencher group.

3. The primer-probe combination according to claim 2, characterized in that: The fluorescent reporter group is selected from any one of FAM, VIC, HEX, TRT, CY3, CY5, ROX, JOE, FITC, TET, NED, TAMRA, LC RED640, LC RED705, Quasar705, and Texas Red, and the fluorescent quencher group is selected from any one of TAMRA, BHQ1, BHQ2, and BHQ3.

4. A kit, characterized in that: The kit contains the primer-probe combination according to any one of claims 1 to 3.

5. The kit according to claim 4, characterized in that The kit also contains a negative control and a positive control, wherein the negative control is RNase Free dH2O, and the positive control is total RNA containing porcine reproductive and respiratory syndrome virus.

6. Use of the primer-probe combination according to any one of claims 1 to 3 or the kit according to claim 4 or 5 in any of the following: (A1) Use in the preparation of products for identifying or assisting in the identification of porcine reproductive and respiratory syndrome virus; (A2) Use in the preparation of products for identifying or assisting in identifying whether a sample to be tested contains porcine reproductive and respiratory syndrome virus.

7. A method for identifying or assisting in the identification of porcine reproductive and respiratory syndrome virus, characterized in that: The following steps are involved: (1) Extracting RNA of the virus to be tested; (2) performing reverse transcription using the RNA extracted in step (1) as a template to obtain cDNA; (3) Using the cDNA obtained in step (2) as a template, qPCR amplification is performed using the primer-probe combination of any one of claims 1 to 3 or the kit of claim 4. After the qPCR amplification reaction is completed, the amplification product is detected and analyzed; if the amplification product shows an S-curve amplification and the Ct value is less than 40, the sample to be tested contains or is suspected of containing porcine reproductive and respiratory syndrome virus; otherwise, if the Ct value is greater than 40, the sample to be tested does not contain or is suspected of not containing porcine reproductive and respiratory syndrome virus.

8. A method for identifying or assisting in identifying whether a sample to be tested contains porcine reproductive and respiratory syndrome virus, characterized in that: The following steps are involved: (1) Extract RNA from the sample to be tested; (2) performing reverse transcription using the RNA extracted in step (1) as a template to obtain cDNA; (3) Using the cDNA obtained in step (2) as a template, qPCR amplification is performed using the primer-probe combination of any one of claims 1 to 3 or the kit of claim 4. After the qPCR amplification reaction is completed, the amplification product is detected and analyzed; if the amplification product shows an S-curve amplification and the Ct value is less than 40, the sample to be tested contains or is suspected of containing porcine reproductive and respiratory syndrome virus; otherwise, if Ct is greater than 40, the sample to be tested does not contain or is suspected of not containing porcine reproductive and respiratory syndrome virus.

9. The method according to claim 7 or 8, characterized in that: The qPCR amplification reaction system is: Premix Ex Taq TM (Probe qPCR) 10μl, 10 μmol / L primer P1 0.4 μl, 10 μmol / L primer P2 0.4 μl, 2.5 μmol / L probe 0.8μl, cDNA template 2.0μl, and make up to 20μL with sterile ddH2O.

10. The method according to claim 9, characterized in that The qPCR amplification reaction conditions were: pre-denaturation at 95°C for 30 seconds; 95°C for 5 seconds, 62°C for 20 seconds, for a total of 40 cycles.

Images