G-Quadruplex-ThT biosensor constructed based on CRISPR-Cas12a system and preparation method and application of G-Quadruplex-ThT biosensor

Abstract

The invention relates to the technical field of biosensors, in particular to a G-quadruplex-ThT biosensor constructed on the basis of a CRISPR-Cas12a system and a method for detecting ATP (adenosine triphosphate) of the G-quadruplex-ThT biosensor. The G-quadruplex-ThT biosensor takes a G-quadruplex sequence as a structural main body and ThT as a coloring agent, the ThT is connected to the G-quadruplex sequence, and the G-quadruplex sequence is SEQ ID NO.7. The G-quadruplex-ThT biosensor has high sensitivity and specificity, and can be used for detecting ATP (adenosine triphosphate). In addition, the ATP is selectively responded in a CRISPR-Cas12a system.

Description

Technical Field

[0001] The present invention relates to the field of biosensor detection technology, and in particular to a G-quadruplex-ThT biosensor constructed based on a CRISPR-Cas12a system, and a preparation method and application thereof. Background Art

[0002] ATP (adenosine triphosphate) testing is a method used to assess biological activity, health status, cell viability and metabolic activity. ATP is the universal currency of energy in organisms, and almost all life forms rely on ATP as an energy carrier. In different applications, ATP testing can be done in a variety of ways: such as bioluminescence assays, colorimetry and fluorescence methods, and high performance liquid chromatography (HPLC);

[0003] In the bioluminescence assay, due to the high sensitivity of the biosensor, it is easily interfered by other substances in the sample, and the detection equipment cost is high; in the colorimetric and fluorescence methods, due to the low sensitivity of the biosensor, the color or fluorescence of the sample is easily interfered by other compounds, which may lead to inaccurate measurements. In the high performance liquid chromatography (HPLC), it takes a long time from the sample being sent into the detection instrument to obtaining the test results, and it is not suitable for bedside testing. Summary of the invention

[0004] In order to solve the above problems, the present invention provides a G-quadruplex-ThT biosensor based on the CRISPR-Cas12a system, a preparation method thereof, and the use of the biosensor for detecting ATP. The biosensor has high sensitivity and specificity, can specifically recognize and bind to ATP sequences, reduces the possibility of common cross-reactions and false positives, and can fully amplify the fluorescence signal of the ATP-bound biosensor under the CRISPR-Cas12a system, thereby accelerating the detection efficiency. The biosensor can also be used to detect low concentrations of ATP and is suitable for bedside testing.

[0005] In the first aspect, the present invention provides a G-quadruplex-ThT biosensor constructed based on the CRISPR-Cas12a system, with a G-quadruplex sequence as the main structure, ThT as a dye, ThT connected to the G-quadruplex sequence, and the G-quadruplex sequence is SEQ ID NO.7.

[0006] In the present invention, G-quadruplex is a special secondary structure of DNA or RNA, in which a sequence containing guanine (G) can form a stable quadruple helix structure. This structure is that in a G-rich DNA or RNA sequence, multiple G bases interact through Hoogsteen hydrogen bonds to form a planar G-tetrad, and the π-π stacking force between the G-tetrads and cations (such as K + Or Na + ) has a stabilizing effect and stacks up to form a quadruplex structure. The benzothiazole ring structure of ThT can interact with the π electron cloud of the G-tetrad through π-π stacking and insert into the G-tetrad of the G-quadruplex. In the CRISPR-Cas12a system, gRNA guides the Cas12a enzyme to the target site of the target DNA for cutting. After the gRNA binds to the target DNA, Cas12a introduces G-quadruplex-ThT into the DNA, and fluorescence appears, indicating the presence of ATP. The Cas12a enzyme can also cut other ssDNA at the target site to avoid the binding of G-quadruplex with ssDNA fluorescence and extinguish the fluorescence.

[0007] In a second aspect, the present invention provides a method for preparing a G-quadruplex-ThT biosensor based on the CRISPR-Cas12a system as in the first aspect, comprising the following steps:

[0008] S21, dissolving the G-quadruplex sequence in a Tris-HCl buffer system, and then heating in a KCl gradient system to obtain a G-quadruplex;

[0009] S22. In the activated Cas12a system, the G-quadruplex was mixed with the ThT solution. After incubation, fluorescence measurement was performed under the conditions of excitation wavelength of 320 nm and emission wavelength of 490 nm. When the color of the solution gradually changed from bright green to nearly colorless, the G-quadruplex-ThT response was better.

[0010] In the present invention, in step S21, the heating condition is 95° C., maintained for 5 minutes, and then cooled to room temperature.

[0011] In the present invention, the KCl gradient system contains K + Promote the formation and stabilization of G-quadruplexes. After keeping for 5 minutes, the G-quadruplexes are converted into oligonucleotides so that the Cas12a enzyme can cut or edit the specific DNA sequence. After cooling to room temperature, the formation and stabilization of the G-quadruplex structure are ensured.

[0012] Preferably, in step S21, the Tris-HCL buffer system is selected (100 mM, pH 7.4) and the concentration is selected to be 20 μM.

[0013] Preferably, in step S21, the concentration of the KCl gradient system is 50 mM, 100 mM, 150 mM, and 200 mM.

[0014] Preferably, in step S22, the concentration of Cas12a system is 100 μL, the concentration of G-quadruplex is 8 μM, and the concentration of ThT solution is 20 μM.

[0015] Preferably, in step S22, the incubation condition is 37° C. for 60 min.

[0016] In a third aspect, the present invention provides a G-quadruplex-ThT biosensor constructed based on the CRISPR-Cas12a system for the detection of ATP.

[0017] Preferably, the G-quadruplex-ThT biosensor is used for the detection of ATP, comprising the following steps:

[0018] Prepared Cas12a, crRNA and dsDNA solutions; add the G-quadruplex-ThT biosensor constructed based on the CRISPR-Cas12a system as described in any one of claims 2 to 6, measure the ATP-test sample fluorescence spectrum at 450 to 600 nm, and determine the ATP concentration using the fluorescence intensity at 500 nm.

[0019] In the present invention, when Cas12a, crRNA and dsDNA solutions are added to the G-quadruplex-ThT biosensor, the total reaction volume must be 100 μL.

[0020] In the present invention, in the absence of ATP, crRNA and dsDNA hybridize with the crRNA-Cas12a double strand, increasing the trans-cutting ability of Cas12a. In the CRISPR-Cas12a system, the Cas12a enzyme cuts the surrounding G-quadruplex sequence to avoid the formation of G-quadruplex-ThT, resulting in poor fluorescence effect; in the presence of ATP, crRNA and dsDNA bind to G-quadruplex-Th with high specificity and affinity, resulting in a decrease in the number of aptamers hybridized to the crRNA-Cas12a double strand, but ThT can induce the complete G-quadruplex to self-assemble into G-quadruplex-ThT, and the fluorescence is significantly enhanced, thereby avoiding the decrease in the level of activated Cas12 and the decrease in the cutting activity beside the G-quadruplex.

[0021] Preferably, the concentration of Cas12a solution is 0.25 μM, the concentration of crRNA solution is 0.2 μM, and the concentration of dsDNA solution is 0.05 μM.

[0022] Preferably, the crRNA sequence is SEQ ID NO.23.

[0023] Compared with the prior art, the present invention has the following beneficial effects:

[0024] 1. The G-quadruplex sequence of the present invention forms a stable G-quadruplex structure under a KCl gradient system, and ThT is assembled on the G-quadruplex structure by π-π stacking to form a G-quadruplex-ThT structure, which enhances the fluorescence signal and has specificity.

[0025] 2. In the CRISPR-Cas12a system, Cas12a can effectively cut the target site of the target DNA, introduce G-quadruplex-ThT into the target DNA, and emit fluorescence at 320nm excitation and 490nm emission wavelengths. In the fluorescence emission spectrum of 450-600nm, fluorescence appears, indicating the presence of ATP. In the absence of ATP, the Cas12a enzyme in the CRISPR-Cas12a system cuts the surrounding G-quadruplex sequence to avoid the formation of G-quadruplex-ThT, resulting in poor fluorescence effect. The Cas12a enzyme can also cut other ssDNA target sites to avoid the binding of G-quadruplex with ssDNA fluorescence and extinguish the fluorescence.

[0026] 3. The G-quadruplex-ThT prepared in the present invention has high detection sensitivity and universal applicability. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0028] Figure 1 It is the fluorescence spectrum of G-quadruplex sequence SEQ ID NO.1 to SEQ ID NO.8 when combined with ThT;

[0029] Figure 2 It is a histogram of the fluorescence intensity when the G-quadruplex sequences SEQ ID NO.1 to SEQ ID NO.8 are combined with ThT;

[0030] Figure 3 It is the UV spectrum of G-quadruplex sequence SEQ ID NO.1 to SEQ ID NO.8 when combined with ThT;

[0031] Figure 4 Circular dichroism chromatograms of G-quadruplex sequences Pu27, Pu27-1 to Pu27-14;

[0032] Figure 5 It is a histogram of the fluorescence intensity of ThT after the G-quadruplex sequences Pu27, Pu27-1 to Pu27-14 bind to ThT;

[0033] Figure 6 The UV images of ThT after the G-quadruplex sequences Pu27, Pu27-1 to Pu27-14 bind to ThT;

[0034] Figure 7 The fluorescence intensity spectrum of ATP in Sequence List 2 detected by G-quadruplex-ThT biosensor;

[0035] Figure 8 The fluorescence intensity bar graph of ATP in Sequence List 2 detected by G-quadruplex-ThT biosensor;

[0036] Fig. 9 The fluorescence spectra of ATP, CTP, GTP, UTP and ADP detected by G-quadruplex-ThT biosensor;

[0037] Fig.10 The fluorescence intensity bar graph of ATP, CTP, GTP, UTP and ADP detected by G-quadruplex-ThT biosensor;

[0038] Fig.11 (A) Emission spectra (excitation / emission: 320 / 490 nm) of ATP at different concentrations (0 to 10 μM from bottom to top) in cell extracts;

[0039] Fig.12 (A) Linear equation diagram of fluorescence intensity of different concentrations (0 to 10 μM from bottom to top) of ATP detected in cell extracts;

[0040] Fig.13 (B) Emission spectra (excitation / emission: 320 / 490 nm) of ATP at different concentrations (0 to 10 μM from bottom to top) in biological extracts;

[0041] Fig.14(B) is a linear equation diagram of the fluorescence intensity of different concentrations (0 to 10 μM from bottom to top) of ATP detected in biological extracts; DETAILED DESCRIPTION

[0042] The technical solution of the present invention will be clearly and completely described below in conjunction with specific embodiments. Obviously, the described embodiments are only part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work belong to the protection scope of the present invention.

[0043] Table 1 shows the nucleic acid sequences involved in the present invention

[0044]

[0045]

[0046] Example 1

[0047] This embodiment provides a G-quadruplex-ThT biosensor constructed based on the CRISPR-Cas12a system, wherein the biosensor uses a G-quadruplex sequence as a structural main body, ThT as a dye, ThT is connected to the G-quadruplex sequence, and the G-quadruplex sequence is SEQ ID NO.7. The preparation method of the biosensor comprises the following steps:

[0048] S21, dissolving the G-quadruplex sequence in a Tris-HCl buffer system, wherein the Tris-HCl buffer system is (100 mM, pH 7.4) and the concentration is 20 μM, and then heating in a KCl gradient system, wherein the KCl gradient system concentrations are 50 mM, 100 mM, 150 mM, and 200 mM, and the heating condition is 95° C., maintained for 5 min, and then cooled to room temperature to obtain a G-quadruplex;

[0049] S22. In the activated Cas12a system, the G-quadruplex was mixed with the ThT solution, the Cas12a system concentration was 100 μL, the G-quadruplex concentration was 8 μM, and the ThT solution concentration was 20 μM. After incubation, the excitation wavelength was 320 nm and the emission wavelength was 490 nm. The incubation conditions were incubated at 37 ° C for 60 min, and fluorescence measurement was performed. When the solution color gradually changed from bright green to nearly colorless, the G-quadruplex-ThT response was better.

[0050] This embodiment also provides a G-quadruplex-ThT biosensor based on the CRISPR-Cas12a system for ATP detection, comprising the following steps:

[0051] Prepared Cas12a, crRNA and dsDNA solutions; adding a G-quadruplex-ThT biosensor constructed based on the CRISPR-Cas12a system as described in any one of claims 2 to 6, when Cas12a, crRNA and dsDNA solutions are added to the G-quadruplex-ThT biosensor, it is necessary to ensure that the total reaction volume is 100 μL, and the ATP-test sample fluorescence spectrum is measured at 450 to 600 nm, and the ATP concentration is measured using the fluorescence intensity at 500 nm.

[0052] The working principle of the CRISPR-Cas12a / G-quadruplex-ThT fluorescent sensing strategy for detecting ATP is as follows: Since the short single-stranded nucleic acid of the specific ATP aptamer has a high affinity for specific molecules, in this case, the aptamer and crRNA are designed to hybridize with the ssDNA activator. In the absence of ATP, the hybridization of the aptamer with the crRNA-Cas12a complex causes structural changes in the crRNA, enhancing the trans-cutting ability of Cas12a. The activated CRISPR / Cas12a system indiscriminately trans-cuts the surrounding G-quadruplex sequences, preventing the formation of the G-quadruplex-ThT complex. , resulting in low background fluorescence. In the presence of ATP, the aptamer binds to the complex with high specificity and affinity, reducing the number of aptamers hybridized to the crRNA-Cas12a complex. Fewer DNA fragments bind to the Cas12a-crRNA complex, resulting in a decrease in the level of activated Cas12a. Therefore, the activity of co-cutting G-quadruplexes of CRISPR / Cas12a is reduced. ThT can induce the complete G-quadruplex sequence to self-assemble into a G-quadruplex-ThT complex, and the fluorescence is significantly enhanced. This fluorescence enhancement depends on the number of cleaved DNA activators present, which in turn depends on the concentration of ATP.

[0053] In Test Example 1, Sequence Table 1 was used to prepare a G-quadruplex-ThT biosensor, and the ThT in the G-quadruplex-ThT biosensor was tested for fluorescence signal ratio and ultraviolet spectrum. The test results are as follows: Figures 1 to 6 shown.

[0054] The test results show that in the CRISPR-Cas12a system, the Cas12a enzyme can cut a series of stable G-quadruplex structures. The G-quadruplex sequence SEQ ID NO.7 was used to prepare G-quadruplex-ThT, which showed a higher signal-to-noise ratio, which highlights that the insertion of specific nucleotides can change the formation and robustness of the G-quadruplex. From the Pu27 series, Pu27-9 and SEQ ID NO.17 were selected to show the strongest signal-to-noise ratio, indicating that it is the most suitable G-quadruplex structure for fluorescent probes.

[0055] G-quadruplex-ThT biosensor was used to detect the fluorescence intensity of ATP aptamer mutant sequences with various mismatches at different binding site positions. The sequence table is shown in Table 2. The test results Figure 7 and Figure 8 shown.

[0056] Sequence Listing 2

[0057] crRNA name SEQ ID NO. sequence NTS 5′ 1 ACCTTCCTCCGCAATACTCCCCCAGGT 3' TS 3' 2 TGGAAGGAGGCGTTATGAGGGGGTCCA 5' Mut13′ 3 TGGAAGCTGGCGTTATGAGGGGGTCCA 5' Mut23′ 4 TGGAAGGACCCGTTATGAGGGGGTCCA 5' Mut33′ 5 TGGAAGGAGGGCTTATGAGGGGGTCCA 5' Mut43′ 6 TGGAAGGAGGCGAAATGAGGGGGTCCA 5' Mut53′ 7 TGGAAGGAGGCGTTTAGAGGGGGTCCA 5' Mut63′ 8 TGGAAGGAGGCGTTATCTGGGGGTCCA 5' Mut73′ 9 TGGAAGGAGGCGTTATGACCGGGTCCA 5' Mut83′ 10 TGGAAGGAGGCGTTATGAGGCCGTCCA 5' Mut93′ 11 TGGAAGGAGGCGTTATGAGGGGCACCA 5′

[0058] The test results showed that the mutation of bases 1 to 8 of crRNA did not lead to a significant decrease in the fluorescence signal, indicating a decrease in the cleavage activity. During this process, a mutant sequence of the ATP aptamer was synthesized with mismatches at different positions, indicating that the CRISPR-Cas12a system is highly specific.

[0059] The selectivity of the G-quadruplex-ThT biosensor was tested using nucleoside triphosphate analogs of ATP, CTP, GTP, UTP, and ADP, and the fluorescence intensity was tested. Fig. 9 and Fig.10 shown.

[0060] The test results showed that the fluorescence signal of 100 μM ATP increased significantly compared with that of TS samples (P<0.001), while at a concentration of 100 μM, there was no significant difference in the fluorescence signals of CTP, GTP, UTP and ADP (P>0.05), indicating that the G-quadruplex-ThT biosensor is highly selective for ATP.

[0061] HL-1 atrial myocytes and H9C2 cardiomyocytes were cultured in DMEM / F12 and DMEM medium, respectively, and 10% inactivated fetal bovine serum and antibiotics were added to establish cardiomyocyte hypoxia model and inflammation model. 95% N2+5% CO2 mixed gas and 10 μg / mL Cells were treated with LPS, and myocardial tissue was stained with hematoxylin-eosin (H&E) to observe the morphological changes of myocardial cells. Tissue sections were dewaxed, washed, stained and transparentized. Adult male BALB / c mice (8 weeks old, 22-25 g) were raised under standard animal laboratory conditions. The mice were anesthetized by intraperitoneal injection of pentobarbital, and a myocardial ischemia model was surgically established. During the operation, the successful establishment of the model was confirmed by electrode map monitoring and the appearance of white areas in the myocardium. Different concentrations of ATP (0 to 10 μM from bottom to top) were used to quantitatively detect ATP in the G-quadruplex-ThT-CRISPR / Cas12a system. Based on 3σ / S calculation, the detection limit (LOD) was 23 nM for (A) cell extract and 15 nM for (B) biological extract, ranging from 0 to 10 μM. The test results are shown in Figure 2. Figures 11 to 14 shown.

[0062] The test results show that the emission intensity increases linearly with the increase of ATP concentration, and based on 3σ / S calculation, the detection limit (LOD) is (A) 23nM for cell extracts and (B) 15nM for biological extracts.

[0063] The recovery rate and detection limit of (A) cell extract and (B) organism extract were determined, and the test results are shown in Table 3.

[0064]

[0065] The test results show that the sensor can detect significant fluorescence signals at ATP concentrations as low as 15nM, demonstrating its low detection limit. The experimental results also show that in complex biological samples, the sensor can still effectively detect ATP, with a recovery rate between 95%-107% and a relative standard deviation of less than 6%. Therefore, the G-quadruplex-ThT-CRISPR / Cas12a method has good accuracy and repeatability in detecting ATP in real samples.

[0066] The present invention is further described above with the aid of specific embodiments. However, it should be understood that the specific description here should not be construed as limiting the essence and scope of the present invention. Various modifications made to the above embodiments by ordinary technicians in the field after reading this specification are all within the scope of protection of the present invention.

Claims

1. Construction of G-quadruplex-ThT biosensor based on CRISPR-Cas12a system, characterized in that: The G-quadruplex sequence is used as the main structure, ThT is used as the dye, and ThT is connected to the G-quadruplex sequence. The G-quadruplex sequence is SEQ ID NO.

7.

2. A method for preparing a G-quadruplex-ThT biosensor based on the CRISPR-Cas12a system, characterized in that: The following steps are involved: S21, dissolving the G-quadruplex sequence in a Tris-HCl buffer system, and then heating in a KCl gradient system to obtain a G-quadruplex; S22. In the activated Cas12a system, the G-quadruplex was mixed with the ThT solution. After incubation, fluorescence measurement was performed under the conditions of excitation wavelength of 320 nm and emission wavelength of 490 nm. When the color of the solution gradually changed from bright green to nearly colorless, the G-quadruplex-ThT response was better.

3. The preparation method according to claim 2, characterized in that: In step S21, the Tris-HCL buffer system is selected (100 mM, pH 7.4) and the concentration is selected to be 20 μM.

4. The preparation method according to claim 2, characterized in that: In step S21, the concentration of the KCl gradient system is 50 mM, 100 mM, 150 mM, and 200 mM.

5. The preparation method according to claim 2, characterized in that: In step S22, the concentration of Cas12a system is 100 μL, the concentration of G-quadruplex is 8 μM, and the concentration of ThT solution is 20 μM.

6. The preparation method according to claim 2, characterized in that: In step S22, the incubation condition is 37°C for 60 minutes.

7. Construction of G-quadruplex-ThT biosensor based on CRISPR-Cas12a system for ATP detection.

8. The method of claim 7 for constructing a G-quadruplex-ThT biosensor based on the CRISPR-Cas12a system for detecting ATP, characterized in that: The steps include: Prepared Cas12a, crRNA and dsDNA solutions; add the G-quadruplex-ThT biosensor constructed based on the CRISPR-Cas12a system as described in any one of claims 2 to 6, measure the ATP-test sample fluorescence spectrum at 450 to 600 nm, and determine the ATP concentration using the fluorescence intensity at 500 nm.

9. The method of claim 8 for constructing a G-quadruplex-ThT biosensor based on the CRISPR-Cas12a system for detecting ATP, characterized in that: The concentration of Cas12a solution was 0.25 μM, the concentration of crRNA solution was 0.2 μM, and the concentration of dsDNA solution was 0.05 μM.

10. The method of claim 8 or 9 for constructing a G-quadruplex-ThT biosensor based on the CRISPR-Cas12a system for detecting ATP, characterized in that: The crRNA sequence is SEQ ID NO.23.

Images