An NNT activating composition and its application
By combining Dalbergia odorifera bark extract, Pinus tabuliformis bark extract, and ascorbate tetraisopalmitate in a specific ratio to form an NNT-activating composition, the problem of the inability to synergistically activate NNTs in existing technologies was solved, resulting in a significant increase in the expression levels of NNT genes and proteins.
Patent Information
- Application Number
- CN202411635565.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-15
- Publication Date
- 2025-10-31
- Estimated Expiration
- 2044-11-15
AI Technical Summary
Existing NNT activators are mainly divided into natural extracts, chemical synthesis and biological agents, but there is no new NNT activating composition that combines them, so it is impossible to achieve the effect of synergistic activation of NNT by the three.
An NNT activating composition was formed by combining extracts of Dalbergia odorifera bark, extracts of Pinus thunbergii bark, and ascorbate tetraisopalmitate in a specific ratio to activate the expression of NNT genes and proteins.
At specific concentrations, the three components synergistically activate NNTs, significantly increasing the gene and protein expression levels of NNTs with statistically significant differences.
Smart Images

Figure BDA0005137067170000061 
Figure BDA0005137067170000071 
Figure BDA0005137067170000081
Abstract
Description
Technical Field
[0001] This invention relates to a chemical composition, particularly an NNT activating composition. Background Technology
[0002] Nicotinamide nucleotide transhydrogenase (NNT) is a nuclear gene-encoded protein located in the inner mitochondrial membrane that plays a crucial role in cellular energy metabolism. It couples protons down the electrochemical proton gradient to complete the hydride transfer from nicotinamide adenine dinucleotide (NADH) to nicotinamide adenine dinucleotide phosphate (NADPH), thereby maintaining intracellular redox homeostasis. This balance is essential for normal cellular physiological functions, including energy production, antioxidant defense, and DNA repair. Given the positive effects of NNT in cellular energy metabolism regulation, redox homeostasis, disease treatment and prevention, and anti-aging, developing a novel composition capable of activating NNT has significant scientific and clinical application value.
[0003] Existing NNT activators can be categorized into naturally extracted, chemically synthesized, and biological agents. Naturally extracted NNT activators are active ingredients extracted from certain plants. These ingredients can activate NNTs through multiple pathways while exhibiting low toxicity and side effects; examples include plant polyphenols and flavonoids. Chemically synthesized NNT activators, designed and prepared, possess higher activity and specificity. Biological NNT activators are proteins, peptides, antibodies, or vaccines prepared using genetic engineering techniques. They activate NNTs by directly acting on them or their related signaling pathways. However, currently, there are no novel NNT activating compositions that combine naturally extracted and chemically synthesized substances. Summary of the Invention
[0004] The purpose of this invention is to provide an NNT activating composition. This invention is characterized by its ability to effectively activate NNTs.
[0005] The technical solution of the present invention is: an NNT activating composition comprising Dalbergia odorifera bark extract, Pinus koraiensis bark extract and ascorbate tetraisopalmitate, wherein the mass ratio of Dalbergia odorifera bark extract, Pinus koraiensis bark extract and ascorbate tetraisopalmitate is 1-15:1-2.5:2-50.
[0006] In the aforementioned NNT activating composition, the mass ratio of the Dalbergia odorifera bark extract, the North American pine bark extract, and ascorbate tetraisopalmitate is 1–1.1:1–2:2–5.
[0007] In the aforementioned NNT activating composition, the mass ratio of the Dalbergia odorifera bark extract, the North American pine bark extract, and ascorbate tetraisopalmitate is 1:1:2.
[0008] In the aforementioned NNT activating composition, the mass ratio of the Dalbergia odorifera bark extract, the North American pine bark extract, and ascorbate tetraisopalmitate is 1.1:1:2.
[0009] In the aforementioned NNT activating composition, the mass ratio of the Dalbergia odorifera bark extract, the North American pine bark extract, and ascorbate tetraisopalmitate is 5–15:1–2.5:5–50.
[0010] In the aforementioned NNT activating composition, the mass ratio of the Dalbergia odorifera bark extract, the North American pine bark extract, and ascorbate tetraisopalmitate is 15:2:50.
[0011] In the aforementioned NNT activating composition, the mass ratio of the Dalbergia odorifera bark extract, the North American pine bark extract, and ascorbate tetraisopalmitate is 15:2.5:50.
[0012] The present invention also discloses the application of the above-mentioned NNT activating composition in the preparation of skin care products with NNT activating function.
[0013] The present invention also discloses a skin care product comprising the above-mentioned NNT activating composition.
[0014] The aforementioned skincare products include any one of water, lotion, eye cream, face cream, and serum.
[0015] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0016] This invention provides a novel NNT activation composition, which consists of Dalbergia odorifera bark extract, Pinus koraiensis bark extract, and ascorbate tetraisopalmitate. As a single component, the three components can activate the expression levels of NNT genes and proteins. When mixed in a certain proportion at a specific concentration, the three active ingredients can synergistically activate NNTs. Detailed Implementation
[0017] The present invention will be further described below with reference to embodiments, but these embodiments are not intended to limit the scope of the invention.
[0018] Example 1:
[0019] An NNT activating composition comprising Dalbergia odorifera bark extract, Pinus koraiensis bark extract and ascorbate tetraisopalmitate in a mass ratio of 1:1:2.
[0020] Example 2:
[0021] An NNT activating composition comprising Dalbergia odorifera bark extract, Pinus koraiensis bark extract and ascorbate tetraisopalmitate in a mass ratio of 1.1:1:2.
[0022] Example 3:
[0023] An NNT activating composition comprising Dalbergia odorifera bark extract, Pinus koraiensis bark extract and ascorbate tetraisopalmitate in a mass ratio of 15:2:50.
[0024] Example 4:
[0025] An NNT activating composition comprising Dalbergia odorifera bark extract, Pinus koraiensis bark extract and ascorbate tetraisopalmitate in a mass ratio of 15:2.5:50.
[0026] Comparative Example 1:
[0027] The extract solutions of Dalbergia odorifera bark were prepared at concentrations of 0.5, 1, 10, and 25 μg / mL.
[0028] Comparative Example 2:
[0029] North American pine bark extract solutions at concentrations of 0.5, 1, 10, and 25 μg / mL.
[0030] Comparative Example 3:
[0031] Ascorbic acid tetraisopalmitate solutions were prepared at concentrations of 1, 25, 100, and 200 μg / mL.
[0032] Experimental reagents:
[0033] B16F10 melanoma cells (Shanghai Aike Biotechnology Co., Ltd.); RPMI-1640 complete culture medium (Gibco, catalog number: 72400047); 2NNaOH (Sinopharm Group, catalog number: 10019718); SPARKscript II RT Plus Kit (With gDNAEraser) reverse transcription kit (Aikerui Biotechnology, catalog number: AG11706); RIPA lysis buffer (Beyotime, catalog number: P0013C); NNT antibody (1:1000) (proteintech, 13442-2-AP); 2×SYBR Green qPCR Mix (With ROX) (Cisco, catalog number: AH0104-C); PBS (Solepro, catalog number: P1010); CCK8 (Beyotime, catalog number: C0038); DMSO (Sigma, catalog number: D119415); RNAiso Plus (Aikerui Biotechnology, catalog number: AG21102); Fluorescent dye (Aikerui Biotechnology, catalog number: AG11701).
[0034] Reagent preparation:
[0035] Preparation of mother liquor for Dalbergia odorifera bark extract: Weigh 0.03g of Dalbergia odorifera bark extract sample powder into 1mL of DMSO (DMSO as a co-solvent) to prepare a 30mg / mL mother liquor; the final concentration of the Dalbergia odorifera bark extract solution shall contain less than or equal to 0.05% DMSO.
[0036] Preparation of stock solution for North American pine bark extract: Weigh 1g of North American pine bark extract sample powder into DMEM complete medium to prepare a stock solution of 1g / mL;
[0037] Preparation of stock solution for ascorbic acid tetraisopalmitate: Measure 1 mL of ascorbic acid tetraisopalmitate sample into DMEM complete medium to prepare a 1% stock solution.
[0038] The mother liquor was then diluted according to the addition ratios of the examples and comparative examples to obtain Examples 1-4 and Comparative Examples 1-3.
[0039] Experimental methods:
[0040] 1. NNT activation experiment
[0041] (1) Cell culture: B16F10 cells in the logarithmic growth phase were taken, and a cell suspension was prepared. The cell concentration was adjusted to 2×10⁻⁶ cells. 5 / mL, seeded into 6-well plates, with a cell density of 200,000 / well; the seeded cell culture plates were placed in an incubator and cultured for 24 hours until the cells were completely adhered and grew stably. The cell culture medium was discarded, and the drugs were administered according to the final concentrations required for each substance in Examples 1-4 and Comparative Examples 1-3, based on the prepared stock solution. Three replicates were set up, and cell control wells (cells + culture medium) were also set up; the cells were incubated at 5% CO2 and 37°C for another 48 hours.
[0042] (2) RNA extraction: Discard the cell suspension, add 1 mL of RNA extraction reagent, pipette and transfer to a 1.5 mL centrifuge tube, and let stand for 10 min. Add 200 μL of chloroform to each tube, invert and mix well, let stand for 5 min, and then centrifuge at 12000g for 10 min at 4℃. Transfer 300 μL of supernatant to a new centrifuge tube. Add 300 μL of isopropanol, mix well, let stand for 10 min, and then centrifuge to remove the supernatant. Add 75% ethanol to the precipitate and wash the precipitate, then centrifuge at 12000g for 5 min at 4℃. Discard the supernatant and dry for 10 min. Dissolve the precipitate in enzyme-free water. Measure and record the concentration and purity of RNA using NanoDrop, and then use enzyme-free water to unify the RNA concentration of each group.
[0043] (3) Real-time quantitative PCR: The reverse transcription system was prepared according to the SPARKscript II RT Plus Kit (With gDNA Eraser). qPCR was then performed according to the instructions for 2×SYBR Green qPCR Mix (With ROX), using the instrument's default melting curve acquisition program; pre-denaturation was performed at 94℃ for 2.5 min. This was followed by 40 cycles, including denaturation at 94℃ for 10 s and annealing at 60℃ for 30 s, with fluorescence signal acquisition during annealing. Primers were synthesized by Beijing Qingke Biotechnology Co., Ltd., and the primer sequences are shown in Table 1 below:
[0044] Table 1. Primer Information Table
[0045] Gene Upstream primer sequence Downstream primer sequence β-actin GGCTGTATTCCCCTCCATCG CCAGTTGGTAACAATGCCATGT NNT CAGCTCTGATTCCAGGTGGTT ATACTCTGGAGGGTCCGTGG
[0046] (4) Immunoblot analysis: The number of cells plated was the same as described above. Extracts of *Palmaria rubra* bark, *Pinus koraiensis* bark, and ascorbate tetraisopalmitate were added to the final concentrations listed in Table 3, and the cells were incubated for 48 hours. Samples were then collected. 100 μL of lysis buffer (containing 1% PMSF) was added to each well of a 6-well plate, cells were collected, and the supernatant was collected by centrifugation. Protein concentrations in each group were quantified using the BCA method and adjusted. Electrophoresis was performed using SDS-PAGE, followed by transfer to a PVDF membrane. After blocking with 5% skim milk powder at room temperature for 2 hours, the cells were incubated overnight at 4°C with primary antibody NNT (1:1000) and β-actin (1:1000), respectively. After 12–16 hours, the cells were washed three times with TBST, incubated with secondary antibody for 2 hours, and washed three times with TBST. A chromogenic agent was added, and the protein bands were visualized using a chemiluminescence imaging system.
[0047] Results analysis:
[0048] Table 2 shows the activation results of NNT gene expression levels under different concentration gradients for Comparative Examples 1-3.
[0049] Table 2. Results of comparative NNT gene expression level activation experiments at different concentration gradients
[0050]
[0051] Note: Statistical analysis was performed between groups. "SD" represents the standard deviation, "*" represents a significant difference between the groups and BC, ****P<0.0001, ***P<0.001, **P<0.01, *P<0.05.
[0052] Groups BC in the table are blank controls; no samples were added.
[0053] As shown in Table 2, the concentration of the extract from the bark of *Dalbergia odorifera* (1-10 μg / mL) showed a significant difference compared to the blank control (BC) group, effectively activating the expression of the NNT gene. The concentration of the extract from the bark of *Pinus koraiensis* (1-25 μg / mL) also showed a significant difference compared to the BC group, effectively activating the expression of the NNT gene. The concentration of ascorbic acid tetraisopalmitate (100-200 μg / mL) also showed a significant difference compared to the BC group, effectively activating the expression of the NNT gene.
[0054] Table 3 shows the activation results of NNT protein expression levels under different concentration gradients for Comparative Examples 1-3.
[0055] Table 3. Results of comparative NNT protein expression level activation experiments at different concentration gradients
[0056]
[0057] Note: Statistical analysis was performed between groups. "SD" represents the standard deviation, "*" represents a significant difference from group BC, ****P<0.0001, ***P<0.001, **P<0.01, *P<0.05.
[0058] Groups BC in the table are blank controls; no samples were added.
[0059] As shown in the table above, the concentration of the extract from the bark of *Dalbergia odorifera* (10-25 μg / mL) showed a significant difference compared to group BC, effectively activating the expression of NNT protein. Similarly, the concentration of the extract from the bark of *Pinus koraiensis* (10-25 μg / mL) also showed a significant difference compared to group BC, effectively activating the expression of NNT protein. Furthermore, when the concentration of ascorbic acid tetraisopalmitate reached 100 μg / mL, it showed a significant difference compared to group BC, effectively activating the expression of NNT protein.
[0060] Table 4 shows the activation results of NNT gene expression levels at different concentrations in Examples 1-4.
[0061] Table 4. Results of NNT gene expression level activation experiments in examples with different concentration gradients
[0062]
[0063] Note: Statistical analysis was performed between groups. "SD" represents the standard deviation, "*" represents a significant difference from group BC, ****P<0.0001, ***P<0.001, **P<0.01, *P<0.05.
[0064] Groups BC in the table are blank controls; no samples were added.
[0065] As shown in the table above, the composition concentration of Example 1 at 10-25 μg / mL showed a significant difference compared to group BC, effectively activating NNT gene expression. The composition concentration of Example 2 at 25 μg / mL also showed a significant difference compared to group BC, effectively activating NNT gene expression. The composition concentration of Example 3 at 10-25 μg / mL also showed a significant difference compared to group BC, effectively activating NNT gene expression. The composition concentration of Example 4 at 25 μg / mL also showed a significant difference compared to group BC, effectively activating NNT gene expression.
[0066] Table 5 shows the NNT gene levels and NNT gene activation comparison results for Examples 1-4 and Comparative Examples 1-3, with a uniformly limited concentration of 25 μg / mL.
[0067] Table 5. NNT gene activation levels in Examples 1-4 and Comparative Examples 1-3 at a concentration of 25 μg / mL.
[0068]
[0069] Note: Statistical analysis was performed between groups. "SD" represents the standard deviation, "*" represents a significant difference from group BC, ****P<0.0001, ***P<0.001, **P<0.01, *P<0.05.
[0070] Groups BC in the table are blank controls; no samples were added.
[0071] The synergistic effect of the composition was determined using the King's Law formula, expressed as Q = E(a+b+c) / (Ea+Eb+Ec-Ea*Eb*Ec), where E(a+b+c) is the efficacy data after combining the three substances, and Ea, Eb, and Ec are the efficacy data of each individual component. A Q < 0.55 indicates significant antagonism, Q = 0.55–0.85 indicates antagonism, Q = 0.85–1.15 indicates additive effects, and Q > 1.15 indicates synergistic effect. As shown in the table above, according to the King's Law formula, the Q value calculated in Example 1 is 1.61, which is greater than 1.15; the Q value calculated in Example 2 is 1.26, which is greater than 1.15; the Q value calculated in Example 3 is 1.34, which is greater than 1.15; and the Q value calculated in Example 4 is 1.41, which is greater than 1.15. Therefore, compared with Comparative Examples 1, 2 and 3, Examples 1-4 of the present invention have a synergistic effect in enhancing NNT activation. It can be considered that the extract of Dalbergia odorifera bark, the extract of Pinus koraiensis bark and ascorbate tetraisopalmitate play a synergistic role in a certain proportion, increasing the ability to activate NNT gene expression level.
[0072] It should be understood that the above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit them. Those skilled in the art can modify the technical solutions described in the above embodiments, or make equivalent substitutions for some of the technical features; and all such modifications and substitutions should fall within the protection scope of the appended claims of the present invention.
Claims
1. An NNT activating composition for preparing skincare products, characterized in that: It is composed of Dalbergia odorifera bark extract, Pinus koraiensis bark extract and ascorbate tetraisopalmitate, wherein the mass ratio of Dalbergia odorifera bark extract, Pinus koraiensis bark extract and ascorbate tetraisopalmitate is 1~15:1~2.5:2~50.
2. The NNT activating composition for preparing skincare products according to claim 1, characterized in that: The mass ratio of the extract of Dalbergia odorifera bark, the extract of Pinus koraiensis bark, and ascorbate tetraisopalmitate is 1~1.1:1~2:2~5.
3. The NNT activating composition for preparing skincare products according to claim 2, characterized in that: The mass ratio of the extracts of Dalbergia odorifera bark, the extract of Pinus koraiensis bark, and ascorbate tetraisopalmitate is 1:1:
2.
4. The NNT activating composition for preparing skincare products according to claim 2, characterized in that: The mass ratio of the extracts of Dalbergia odorifera bark, the extract of Pinus koraiensis bark, and ascorbate tetraisopalmitate is 1.1:1:
2.
5. The NNT activating composition for preparing skincare products according to claim 1, characterized in that: The mass ratio of the extract of Dalbergia odorifera bark, the extract of Pinus koraiensis bark, and ascorbate tetraisopalmitate is 5~15:1~2.5:5~50.
6. The NNT activating composition for preparing skincare products according to claim 5, characterized in that: The mass ratio of the extracts of the rosewood bark, the extract of the North American pine bark, and ascorbate tetraisopalmitate is 15:2:
50.
7. The NNT activating composition for preparing skincare products according to claim 5, characterized in that: The mass ratio of the extracts of Dalbergia odorifera bark, the extract of Pinus koraiensis bark, and ascorbate tetraisopalmitate is 15:2.5:50.
Citation Information
Patent Citations
Skin whitening microemulsion
CN105726387A
Whitening skin cream and preparation method thereof
CN118873475A