Application of GLUT1 / ALDOB / G6PD metabolic axis in reduction of drug resistance of chemotherapeutic drugs

Abstract

The invention relates to an application of a GLUT1 / ALDOB / G6PD metabolic axis in reducing the drug resistance of a chemotherapeutic drug, and particularly provides an application of a reagent for inhibiting the GLUT1 / ALDOB / G6PD metabolic axis in preparing a drug for reducing the drug resistance of a patient to the chemotherapeutic drug or increasing the sensitivity of the patient to the chemotherapeutic drug. The invention relates to an application of a combination of a reagent for inhibiting a GLUT1 / ALDOB / G6PD metabolic axis and a chemotherapeutic drug in preparation of a drug for treating cancer patients, and an application of the reagent for inhibiting the GLUT1 / ALDOB / G6PD metabolic axis in preparation of a drug for inhibiting glucose metabolism and reducing metabolite flowing to a pentose phosphate pathway so as to reduce raw materials participating in DNA synthesis.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and specifically relates to the application of GLUT1 / ALDOB / G6PD metabolic axis in reducing the drug resistance of chemotherapeutic drugs. Background Art

[0002] Pancreatic ductal adenocarcinoma (PDAC) is the most common type of pancreatic cancer. Surgical resection is the main treatment for PDAC, but the postoperative recurrence rate is high, and most patients eventually die from tumor metastasis. Among patients who undergo surgical resection of the tumor, some develop to the advanced stage within just a few months, while some patients can maintain a stable quality of life for up to several years. In addition to surgical resection, drug treatment is still needed for pancreatic ductal adenocarcinoma (PDAC).

[0003] The treatment of PDAC is mainly based on chemotherapy drugs, including gemcitabine (GEM), 5-fluorouracil (5-FU), irinotecan (IRI), oxaliplatin (OXA) and albumin-paclitaxel conjugate (PTX). However, these chemotherapy drugs often have the problem of chemotherapy drug resistance during treatment. For example, the rich matrix hinders drug penetration; water-soluble chemotherapy drugs are difficult to diffuse into tumor cells, and the transporter proteins responsible for transporting drugs on PDAC cells are usually missing; endogenous nucleotides compete with nucleoside analog chemotherapy drugs molecules, thereby inhibiting the effect of chemotherapy drugs; PDAC cells transport the primary active metabolites of chemotherapy drugs out of the cell, etc.

[0004] Metabolic changes are an important hallmark of cancer cells, but how metabolic pathways affect PDAC chemotherapy resistance remains to be studied. Therefore, this field urgently needs to explore the signaling pathways that affect the sensitivity of chemotherapy drugs from a metabolic perspective, so as to solve the problem of PDAC chemotherapy resistance. Summary of the invention

[0005] In a first aspect of the present invention, there is provided a use of an agent that inhibits the GLUT1 / ALDOB / G6PD metabolic axis in the preparation of a drug for reducing the resistance of cancer patients to chemotherapeutic drugs or increasing the sensitivity of cancer patients to chemotherapeutic drugs. The present invention also provides a use of a combination of an agent that inhibits the GLUT1 / ALDOB / G6PD metabolic axis and a chemotherapeutic drug in the preparation of a drug for treating cancer patients.

[0006] In some embodiments, the chemotherapy drug includes any one or any combination of 5-fluorouracil, gemcitabine, irinotecan and oxaliplatin.

[0007] In some embodiments, the agent that inhibits the GLUT1 / ALDOB / G6PD metabolic axis is selected from: (1) an agent that targets GLUT1 and inhibits the expression of the GLUT1 gene or the activity of the protein encoded by it; (2) an agent that targets ALDOB and enhances the expression of the ALDOB gene or the activity of the protein encoded by it; and (3) an agent that targets G6PD and inhibits the expression of the G6PD gene or the activity of the protein encoded by it.

[0008] In some embodiments, the agent that targets GLUT1 and inhibits the expression of the GLUT1 gene or the activity of the protein it encodes is selected from: (1) an antibody to GLUT1; (2) an expression construct or vector encoding a nucleic acid sequence of a GLUT1 mutant whose activity is downregulated or lost compared to wild-type GLUT1; (3) a nucleic acid molecule selected from shRNA, siRNA, antisense RNA, ribozyme and gene editing vector; and (4) a small molecule inhibitor; preferably, the inhibitor is BAY-576.

[0009] In some embodiments, the agent that targets ALODB and enhances the expression of the ALDOB gene or the activity of its encoded protein is selected from: (1) an ALDOB encoding gene or an expression construct or vector containing the encoding gene, or encoding an ALDOB mutant with upregulated or increased activity compared to wild-type ALDOB; (2) an agent that performs a gain-of-function point mutation on ALDOB; and (3) a small molecule agonist.

[0010] In some embodiments, the agent that targets G6PD and inhibits the expression of the G6PD gene or the activity of the protein it encodes is selected from: (1) an antibody to G6PD; (2) a homologous recombination vector encoding a nucleic acid sequence of a G6PD mutant whose activity is downregulated or lost compared to wild-type G6PD; (3) a nucleic acid molecule selected from shRNA, siRNA, antisense RNA, ribozyme, and gene editing vector; and (4) a small molecule inhibitor.

[0011] In some embodiments, the small molecule inhibitor that targets G6PD and inhibits the expression of the G6PD gene or the activity of its encoded protein is selected from one or more of V6N, MLN8054 and Alisertib.

[0012] In some embodiments, the chemotherapeutic drug resistance is chemotherapeutic drug resistance mediated by glucose metabolism and / or pyrimidine nucleoside levels.

[0013] In some embodiments, the glucose metabolism includes: the tricarboxylic acid cycle, glycolysis, the pentose phosphate pathway, and gluconeogenesis.

[0014] In some embodiments, the metabolites of the tricarboxylic acid cycle include: fumarate, malate, aspartate, alpha-ketoglutarate, glutamate, glutamine, citrate, and proline.

[0015] In some embodiments, the metabolites of glycolysis include: pyruvate, lactate, alanine, glycine, F6P, F1, and 6P.

[0016] In some embodiments, the metabolites of the pentose phosphate pathway include: an oxidized 5'-triphosphate product and a non-oxidized 5'-triphosphate product.

[0017] In some embodiments, the oxidized 5'-triphosphate products include G6P, 6PG, and R5P; and the non-oxidized 5'-triphosphate products include S7P and E4P.

[0018] In some embodiments, the pyrimidine nucleoside levels include endogenous pyrimidine nucleoside levels and exogenous pyrimidine nucleoside levels.

[0019] In some embodiments, the cancer is pancreatic cancer.

[0020] In some embodiments, the pancreatic cancer includes pancreatic ductal adenocarcinoma, pancreatic cell carcinoma, adenoid squamous cell carcinoma, mucinous cystadenocarcinoma, pancreatoblastic carcinoma, and islet cell carcinoma.

[0021] In some embodiments, the pancreatic ductal adenocarcinoma comprises: a squamous subtype, a progenitor subtype, a quasi-mesenchymal subtype, a classical subtype, and a basal subtype.

[0022] In a second aspect, the present invention provides a pharmaceutical composition comprising a chemotherapeutic drug and a preparation containing an agent that inhibits the GLUT1 / ALDOB / G6PD metabolic axis.

[0023] In some embodiments, the chemotherapy drug includes any one or any combination of 5-fluorouracil, gemcitabine, irinotecan and oxaliplatin.

[0024] In some embodiments, the agent that inhibits the GLUT1 / ALDOB / G6PD metabolic axis is as described in any embodiment herein.

[0025] In a third aspect, the present invention provides a drug kit comprising: (1) a preparation containing an agent that inhibits the GLUT1 / ALDOB / G6PD metabolic axis, and (2) a chemotherapeutic drug; or a pharmaceutical composition according to any embodiment of the present invention.

[0026] In some embodiments, the chemotherapy drug includes any one or any combination of 5-fluorouracil, gemcitabine, irinotecan and oxaliplatin.

[0027] In some embodiments, the agent that inhibits the GLUT1 / ALDOB / G6PD metabolic axis is as described in any embodiment herein.

[0028] The fourth aspect of the present invention provides the use of the GLUT1 / ALDOB / G6PD metabolic axis in screening substances that can reduce the resistance of cancer patients to chemotherapeutic drugs or increase the sensitivity of cancer patients to chemotherapeutic drugs.

[0029] In some embodiments, the chemotherapy drug includes any one or any combination of 5-fluorouracil, gemcitabine, irinotecan and oxaliplatin.

[0030] In some embodiments, the cancer is pancreatic cancer.

[0031] In some embodiments, the pancreatic cancer includes pancreatic ductal adenocarcinoma, pancreatic cell carcinoma, adenoid squamous cell carcinoma, mucinous cystadenocarcinoma, pancreatoblastic carcinoma, and islet cell carcinoma.

[0032] In some embodiments, the pancreatic ductal adenocarcinoma comprises: a squamous subtype, a progenitor subtype, a quasi-mesenchymal subtype, a classical subtype, and a basal subtype.

[0033] Other aspects of the present invention will be apparent to those skilled in the art in view of the disclosure herein. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 :Pathological histological observation of cancer tissues, organoids and their transplanted tumors from different patients.

[0035] Figure 2 : Immunohistochemical staining of PDAC proliferation markers (Ki67) and differentiation markers (CK19) in cancer tissues, organoids and their transplanted tumors from different patients.

[0036] Figure 3:PDAC was metabolically categorized using the broad-target metabolome and the differences in metabolism, gene expression, and chromosome access between class 1 and class 2 metabolic subtypes were compared. (A) PDAC was metabolically categorized using the broad-target metabolome into class 1 (Lipomet-PDAC) and class 2 (Glucomet-PDAC). (B) ssGSEA compared the differences in metabolic pathway enrichment between class 1 and class 2 metabolic subtypes. (CF) Metabolic flux was used to detect the differences between class 1 and class 2 in glycolysis (C), tricarboxylic acid cycle (TCA) (D), oxidative 5′-triphosphate production (PPP) (E), and non-oxidative 5′-triphosphate production (PPP) (F). (GI) Whole genome sequencing (WGS) was used to compare the differences between class 1 and class 2 metabolic subtypes in mutant genes (G), chromosomal instability (H), and mutation number (I). (J) Differences in gene expression between class 1 and class 2. (K) Differences in accessibility of differentially expressed genes near TSS.

[0037] Figure 4 :Comparison of the differences in prognosis and chemotherapy drug sensitivity between class 1 and class 2 metabolic subtypes using the Bailey PDAC dataset and the TCGA PDAC dataset. (A) The Bailey dataset was classified using 245 metabolic subtype RNA signature genes. (B) The difference in prognosis after the Bailey dataset was classified into class 1 (Lipomet) and class 2 (Glucomet). (C) The TCGA dataset was classified using 245 metabolic subtype RNA signature genes. (D) The difference in prognosis after the TCGA dataset was classified into class 1 (Lipomet) and class 2 (Glucomet). (EF) Heat map (E) and statistical graph (F) of the sensitivity of class 1 (Lipomet) and class 2 (Glucomet) metabolic subtypes to four chemotherapy drugs, gemcitabine (GEM), 5-fluorouracil (5-FU), irinotecan (IRI) and oxaliplatin (OXA), expressed as the area under the drug-time curve (AUC) of the two metabolic subtypes.

[0038] Figure 5 :The correlation between class 1 and class 2 metabolic subtypes and clinical prognosis survival was compared using the Bailey PDAC dataset and the TCGA PDAC dataset. (A) After the TCGA dataset was classified using 245 RNA signature genes, the differences in prognosis between subtypes were compared. (B) After the Bailey dataset was classified using 245 RNA signature genes, the differences in prognosis between subtypes were compared.

[0039] Figure 6:Effects of the GLUT1 / ALDOB / G6PD metabolic axis on class 1 and class 2 metabolic subtypes. (A) Differences in gene expression of GLUT1 and ALDOB in Glucomet-PDAC and Lipomet-PDAC. (B) Correlation between the expression of GLUT1 and ALDOB and L-lactate content. (C) Differences between Glucomet-PDAC and Lipomet-PDAC in glucose consumption (remaining glucose content in the culture medium) and lactate secretion (lactate content in the matrix). (DG) Effects of knockdown of GLUT1 on glycolysis (D), TCA cycle (E), extracellular acidification rate (ECAR) (F), matrix glycolysis, and compensatory glycolysis (G). (HK) Effects of overexpression of ALDOB on metabolic fluxes in glycolysis and TCA cycle.

[0040] Figure 7 :The regulatory effect of ALDOB on G6PD activity, the interaction between ALDOB and G6PD, and the effect of intervening in the GLUT1 / ALDOB / G6PD metabolic axis on metabolism. (A) Comparison of G6PD activity in Glucomet-PDAC and Lipomet-PDAC. (B) Effect of overexpression of ALDOB on G6PD activity. (CE) Effects of overexpression of ALDOB (C), knockdown of GLUT1 (D), and overexpression of ALDOB and knockdown of GLUT1 (E) on markers of the oxidative pentose phosphate pathway (G6P, 6PG, R5P). (F) IP experiments demonstrated the interaction between ALDOB and G6PD. (GI) GSEA demonstrated the relationship between the expression of GLUT1 and ALDOB and fatty acid metabolism (G), pentose phosphate pathway (H), and glycolysis and gluconeogenesis (I). (JK) Tissue microarrays were used to divide samples into GLUT1 and ALDOB groups according to the expression of ALDOB and GLUT1. 高 , GLUT1 低 、ALDOB 高 、ALDOB 低 Four groups (J), statistics of GLUT1 高 ALDOB 高 GLUT1 低 ALDOB 高 , GLUT1 高 ALDOB 低 GLUT1 低 ALDOB 低 Prognostic survival probability (K) of four groups.

[0041] Figure 8:Effect of GLUT1 / ALDOB / G6PD metabolic axis on drug sensitivity. (A) Comparison of the content of nucleosides and their derivatives in Glucomet-PDAC and Lipomet-PDAC. (B) Correlation between the expression of ALDOB and G6PD and the abundance of nucleosides and their derivatives in cells. (CF) Effect of pyrimidine nucleoside (240μM) replenishment on chemotherapeutic drug sensitivity. (G) Effect of GLUT1 knockdown on 5-FU sensitivity. (H) Effect of ALDOB overexpression on 5-FU sensitivity. (I) Effect of G6PD knockdown on 5-FU sensitivity. (J) Effect of ALDOB overexpression combined with 5-FU on PDAC tumor treatment. (KQ) Effect of pyrimidine nucleoside (240μM), pyrimidine nucleoside analog (R5P, 1mM) or purine nucleoside (200μM) replenishment on 5-FU and GEM sensitivity when regulating the GLUT1 / ALDOB / G6PD metabolic axis.

[0042] Fig. 9: The GLUT1 / ALDOB / G6PD metabolic axis contributes to drug resistance. (A) Effects of GLUT1 knockdown in xenografts on GEM, IRI, and OXA responsiveness of DAC-34 (Glucomet), as determined by CellTiter-Glo assay 120 hours after GEM, IRI, or OXA treatment. (B-D) Effects of ALDOB overexpression on chemotherapy response of DAC-42 (Glucomet), DAC-34 (Glucomet), and DAC-35 (Glucomet), as determined by CellTiter-Glo 120 hours after chemotherapy treatment in organoids. (E) Western blot analysis of G6PD knockdown efficiency in DAC-34 (Glucomet) and DAC-42 (Glucomet) organoids. (F) Images of xenografts in the ODX model isolated from empty vector + adjuvant, empty vector + 5-FU, ALDOB + adjuvant, and ALDOB + 5-FU groups at day 16 of drug treatment. (G) Effect of GLUT1 knockdown on DAC-34 (Glucomet) PTX in xenografts as determined by CellTiter-Glo assay. (HJ) Effect of DAC-23 (Glucomet), DAC-35 (Glucomet), and DAC-42 (Glucomet) PTX in ALDOB overexpressing organoids as determined by CellTiter-Glo assay 120 hours after chemotherapy treatment. (K and L) Effect of pyrimidine nucleotides (240 μM) on 5-FU or GEM sensitivity in control and GLUT1 knockdown organoids as determined by CellTiter-Glo assay 120 hours after treatment. (M) Effect of pyrimidine nucleotides (240 μM) on GEM sensitivity in control and ALDOB overexpressing organoids as determined by CellTiter-Glo assay 120 hours after treatment. (N) RT-PCR analysis of ALDOB knockdown efficiency and specificity in DAC-5 (Lipofectamine) organoids. (O and P) Effects of pyrimidine nucleotides (240 μM) on 5-FU and GEM sensitivity in control and ALDOB knockdown DAC-5 (Lipomet) or DAC-18 (Lipomet) organoids were examined by CellTiter-Glo assay 120 h after treatment.

[0043] Fig.10:Inhibition of the GLUT1 / ALDOB / G6PD metabolic axis increases the sensitivity of cells to chemotherapeutic drugs. (A) Effect of knocking down GLUT1 on the growth of transplanted tumors. (B) Effect of GLUT1 inhibitor BAY-876 (50nM) on glucose consumption. (C) Detection of the effect of GLUT1 inhibitor BAY-876 (50nM) on the sensitivity of chemotherapeutic drugs. (D) Inhibition of G6PD activity by 6AN (100μM). (H) 6AN (100μM) inhibits G6PD activity and increases the sensitivity of Glucomet-PDAC cells to 5-FU. (F) Combination of 6AN (5mg / kg, administered once every two days) with the chemotherapeutic drug 5-FU (25mg / kg, administered once every two days) significantly inhibits the growth of transplanted tumors. (G) Effect of replenishing pyrimidine nucleosides or purine nucleosides on 5-FU sensitivity. DETAILED DESCRIPTION

[0044] Herein, the term “GLUT1 / ALDOB / G6PD” or “GLUT1-ALDOB-G6PD” may be used interchangeably.

[0045] In this article, "metabolic axis", "signaling pathway", "(signal) module", "regulatory module" or "regulatory module" can be used interchangeably, all referring to a signaling system formed by a series of proteins or genes that restrict or interact with each other, which generally leads to the occurrence of some cellular events.

[0046] Herein, the “class 1”, “class 1” and “Lipomet-PDAC” are used interchangeably, and the “class 2”, “class 2” and “Glucomet-PDAC” are used interchangeably.

[0047] Herein, the "glucose metabolism" and "sugar metabolism" are used interchangeably, and the "fatty acid metabolism" and "lipid metabolism" are used interchangeably.

[0048] The present invention uses a broad-target metabolome to classify PDAC organoids into two metabolic subtypes, Class 1 (Lipomet-PDAC, enriched in lipid metabolism) and Class 2 (Glucomet-PDAC, enriched in sugar metabolism). The present invention found that increased expression of GLUT1 can transport more glucose into cells to meet the cell's demand for glucose. ALDOB can bind to G6PD to inhibit the activity of G6PD. After ALDOB expression is reduced, the activity of G6PD increases, thereby promoting the flow of metabolites to the pentose phosphate pathway, synthesizing more raw materials involved in DNA synthesis, and inducing cellular chemotherapy resistance.

[0049] Further studies have shown that increased flux in the pyrimidine nucleoside biosynthesis pathway leads to chemotherapeutic resistance in Glucomet-PDAC. Inhibiting GLUT1 expression, increasing ALDOB expression, or inhibiting G6PD expression significantly increased the sensitivity of Glucomet-PDAC organoids to chemotherapeutic drugs, while the addition of exogenous pyrimidine nucleosides inhibited this effect. This indicates that the GLUT1 / ALDOB / G6PD axis mediates chemotherapeutic resistance in pancreatic cancer cells by regulating glucose metabolism and pyrimidine nucleoside levels, and inhibiting GLUT1 / ALDOB / G6PD can increase the sensitivity of cells to chemotherapeutic drugs.

[0050] Based on the above findings, the present invention provides the use of an agent that inhibits the GLUT1 / ALDOB / G6PD metabolic axis in the preparation of a drug for reducing a patient's resistance to chemotherapeutic drugs or increasing a patient's sensitivity to chemotherapeutic drugs. The present invention also provides the use of an agent that inhibits the GLUT1 / ALDOB / G6PD metabolic axis in the preparation of a drug that inhibits glucose metabolism (such as inhibiting glucose from entering cells), reduces the flow of metabolites to the pentose phosphate pathway, and thereby reduces the raw materials involved in DNA synthesis (such as regulating the level of pyrimidine nucleosides).

[0051] Herein, chemotherapeutic drugs refer to drugs that act on the growth and reproduction of tumor cells to inhibit or kill tumor cells. Chemotherapeutic drugs can, for example, inhibit tumor DNA synthesis, thereby inhibiting or killing tumor cells. Herein, suitable chemotherapeutic drugs can be various chemotherapeutic drugs known in the art, especially including various commercially available chemotherapeutic drugs, especially chemotherapeutic drugs for the treatment of pancreatic cancer. Suitable chemotherapeutic drugs include, but are not limited to, gemcitabine (GEM), 5-fluorouracil (5-FU), irinotecan (IRI), oxaliplatin (OXA) and one or more combinations thereof. For example, the chemotherapeutic drug can be FOLFIRINOX, i.e., a combination of 5-fluorouracil (5-FU), irinotecan (IRI) and oxaliplatin (OXA). In some embodiments, the chemotherapeutic drug does not include paclitaxel albumin (PTX).

[0052] Herein, the term "chemo-resistance" refers to insensitivity to chemotherapeutic drugs, for example, the sensitivity of chemotherapeutic drugs is reduced by 5%, 10%, 15%, 20%, 30% or more. It is known to those skilled in the art that pharmacodynamic indicators, including, for example, drug-time curves, area under drug-time curves (AUC), can be used to indicate the sensitivity of chemotherapeutic drugs, and / or the degree of chemo-resistance.

[0053] Herein, the drug resistance (sensitivity) to chemotherapy drugs refers in particular to the tumor drug resistance (sensitivity) to chemotherapy drugs mediated by glucose metabolism and pyrimidine nucleoside levels.

[0054] Herein, the glucose metabolism includes, but is not limited to, tricarboxylic acid (TCA) cycle, glycolysis, pentose phosphate pathway, and gluconeogenesis. It is known to those skilled in the art that metabolites in the tricarboxylic acid (TCA) cycle include (but are not limited to): fumarate, malate, aspartate, α-ketoglutarate, glutamate, glutamine, citric acid, and proline. Metabolites in the glycolysis process include, but are not limited to, pyruvate, lactate, alanine, glycine, F6P, F1, and 6P. Metabolites of the pentose phosphate pathway include, but are not limited to, 5′-triphosphate products (PPP), further including: oxidized PPP and non-oxidized PPP. Oxidized PPP includes, but is not limited to, G6P, 6PG, and R5P. Non-oxidized PPP includes, but is not limited to, S7P and E4P.

[0055] Herein, the glycolysis includes basal glycolysis and compensatory glycolysis. The basal glycolysis refers to the ECAR reached by the cell after adding saturated concentration of glucose in the experiment, reflecting the glycolysis capacity of the cell under basal conditions. The compensatory glycolysis refers to the maximum ECAR value reached by the cell after adding oligomycin, that is, after oligomycin effectively shuts down the oxidative phosphorylation function, forcing the cell to use glycolysis to achieve the maximum energy production capacity value.

[0056] Herein, the pyrimidine nucleoside level includes: endogenous pyrimidine nucleoside level and exogenous pyrimidine nucleoside level. According to the records of the embodiments of the present invention, the pyrimidine nucleoside level is positively correlated with the resistance of chemotherapeutic drugs, and the increase in the pyrimidine nucleoside level will promote the resistance of tumor chemotherapeutic drugs. Inhibiting the GLUT1 / ALDOB / G6PD metabolic axis (for example, inhibiting GLUT1 expression, increasing ALDOB expression and / or inhibiting G6PD expression) can downregulate the endogenous pyrimidine nucleoside level, thereby inhibiting the resistance of tumor chemotherapeutic drugs.

[0057] Studies have shown that the phenomenon of chemotherapeutic drug resistance mediated by glucose metabolism and pyrimidine nucleoside levels exists in the treatment of various cancers, including but not limited to pancreatic cancer. The present invention confirms that the GLUT1 / ALDOB / G6PD metabolic axis plays an important role in pancreatic cancer. Therefore, the cancer described herein particularly includes pancreatic cancer.

[0058] Herein, the "pancreatic cancer" includes but is not limited to pancreatic ductal adenocarcinoma, pancreatic cell carcinoma, adenoid squamous cell carcinoma, mucinous cystadenocarcinoma, pancreatoblastic carcinoma and islet cell carcinoma.

[0059] Herein, the "pancreatic ductal adenocarcinoma" or "PDAC" includes, but is not limited to, squamous subtype, progenitor subtype, quasi-mesenchymal subtype, classical subtype and basal subtype.

[0060] It should be understood that, with the guidance of the technical solution of the present invention, those skilled in the art can easily think of changing the types of pancreatic cancer or pancreatic ductal adenocarcinoma to achieve the same or similar technical effects, and these changes are also included in the present invention.

[0061] Herein, the GLUT1 / ALDOB / G6PD metabolic axis includes, but is not limited to: GLUT1 gene and / or a protein encoded therein, ALDOB gene and / or a protein encoded therein, G6PD gene and / or a protein encoded therein.

[0062] Herein, the "GLUT1" refers to glucose transporter type 1. The GLUT1 gene (and / or its encoded protein) involved in the present invention includes GLUT1 genes and proteins from different species, especially GLUT1 genes and proteins from mammals (such as humans and mice, etc.), especially human GLUT1 genes and proteins. The amino acid sequence of human GLUT1 can be shown as NCBI accession number NP_006507.2, and the gene sequence of human GLUT1 can be shown as NCBIgene ID:6513.

[0063] Herein, "ALDOB" refers to aldolase B. The ALDOB gene (and / or the protein encoded by it) involved in the present invention includes ALDOB genes and proteins from different species, especially ALDOB genes and proteins from mammals (such as humans and mice, etc.), especially human ALDOB genes and proteins. The amino acid sequence of human ALDOB can be shown as NCBI accession number AAH29399.1, and the gene sequence of human ALDOB can be shown as NCBI gene ID: 229.

[0064] Herein, the "G6PD" is glucose-6-phosphate dehydrogenase. The G6PD gene (and / or its encoded protein) involved in the present invention includes G6PD genes and proteins from different species, especially G6PD genes and proteins from mammals (such as humans and mice, etc.), especially human G6PD genes and proteins. The amino acid sequence of human G6PD can be shown as NCBI accession number QZA86926.1, and the gene sequence of human G6PD can be shown as NCBI gene ID: 2539.

[0065] Those skilled in the art know that the nucleic acid sequence of a desired gene and / or the amino acid sequence of a protein can be downloaded from the NCBI database (https: / / www.ncbi.nlm.nih.gov / ) using the NCBI accession number or gene ID.

[0066] Herein, the "GLUT1", "ALDOB" or "G6PD" also include fragments, derivatives and analogs thereof. These fragments, derivatives and analogs are within the scope known to those skilled in the art. That is, such genes or proteins that may be referred to as "GLUT1", "ALDOB" or "G6PD" in the art are all within the scope of the present invention.

[0067] Herein, the agents that inhibit the GLUT1 / ALDOB / G6PD metabolic axis include: (1) agents that target GLUT1 to inhibit the expression of the GLUT1 gene or the activity of the protein encoded by it; (2) agents that target ALDOB to enhance the expression of the ALDOB gene or the activity of the protein encoded by it; (3) agents that target G6PD to inhibit the expression of the G6PD gene or the activity of the protein encoded by it.

[0068] Herein, the upregulation, promotion, increase or enhancement refers to significant upregulation, promotion, increase or enhancement, such as upregulation, promotion, increase or enhancement by 5%, 10%, 15%, 20%, 40%, 60%, 80%, 90% or more.

[0069] Herein, the downregulation, reduction, inhibition, weakening or attenuation refers to significant downregulation, reduction, inhibition or weakening, such as downregulation, reduction, inhibition or weakening by 5%, 10%, 15%, 20%, 40%, 60%, 80%, 90% or lower.

[0070] In some embodiments, the agent that targets GLUT1 and inhibits the expression of the GLUT1 gene or the activity of the protein it encodes is selected from: (1) an antibody to GLUT1; (2) an expression construct or vector encoding a nucleic acid sequence of a GLUT1 mutant whose activity is downregulated or lost compared to wild-type GLUT1; (3) a nucleic acid molecule selected from shRNA, siRNA, antisense RNA, ribozyme, and gene editing vector; and (4) a small molecule inhibitor.

[0071] Herein, the antibody against GLUT1 is preferably a monoclonal antibody or an antigen-binding fragment thereof. Commercially available antibodies or antigen-binding fragments thereof can be used to practice the present invention.

[0072] Herein, the GLUT1 mutant whose activity is downregulated or lost compared to the wild-type GLUT1 can be a mutant of GLUT1 known in the art. For example, a mutation can be implemented in the enzymatic activity center of the GLUT1 enzyme to weaken or downregulate or even lose its enzymatic activity. Then, by constructing a nucleic acid construct or vector of the mutant, it is used for homologous recombination into the cell genome, so that the cell expresses the GLUT1 mutant, thereby achieving the weakening or downregulation of GLUT1 activity.

[0073] Herein, the shRNA, siRNA or antisense RNA against GLUT1 binds to the mRNA region of GLUT1, for example, shGLUT1-1 shown in SEQ ID NO: 1 binds to position 2742 of GLUT1 mRNA; shGLUT1-5 shown in SEQ ID NO: 2 binds to position 899 of GLUT1 mRNA, thereby inhibiting the gene expression of GLUT1. Therefore, in some embodiments, the sequence of the shRNA for GLUT1 is as shown in SEQ ID NO: 1 or 2.

[0074] Herein, ribozymes can specifically cleave substrate RNA molecules by catalyzing the breakage of phosphodiester bonds in the target site RNA chain, thereby blocking the expression of the target gene. Therefore, ribozymes can be used to block the expression of the GLUT1 gene.

[0075] Herein, gene editing techniques such as ZFN, TALEN or CRISPR / Cas9 can be used to knock out the GLUT1 gene in the cell, thereby blocking its expression. ZFN, TALEN and CRISPR / Cas9 technologies applicable to the present invention are well known in the art. Each technology achieves the knockout of the target gene through the joint action of the DNA recognition domain and the nuclease. The reagents required for gene editing technology include guide RNA (sgRNA) and related nucleases (such as Cas9 protein complexes).

[0076] In some embodiments, the small molecule inhibitor of GLUT1 includes but is not limited to small molecule compound inhibitors of GLUT1 known in the art, and exemplary inhibitors include but are not limited to BAY-876, CAS 2421141-40-2, GLUT1-IN-1 and STF-31, etc., and their chemical structural formulas are shown below:

[0077]

[0078] Herein, the agent that targets ALODB and enhances the expression of the ALDOB gene or the activity of its encoded protein is selected from: (1) an ALDOB encoding gene or an expression construct or vector containing the encoding gene, or encoding an ALDOB mutant with upregulated or increased activity compared to wild-type ALDOB; (2) an agent that performs a gain-of-function point mutation on ALDOB; and (3) a small molecule agonist.

[0079] In some embodiments, the ALDOB encoding gene or an ALDOB mutant encoding an upregulated or increased activity compared to wild-type ALDOB is introduced into the expression construct or vector, thereby enhancing the gene expression of ALDOB; or a gain-of-function point mutation is made to ALDOB; or ALDOB expression is promoted by an enhancing promoter or a tissue-specific promoter; or ALDOB expression is promoted by an enhancer; or ALDOB enzyme activity is increased (for example, by a small molecule agonist).

[0080] In some embodiments, the agent that targets G6PD and inhibits the expression of the G6PD gene or the activity of the protein it encodes is selected from: (1) an antibody to G6PD; (2) a homologous recombination vector encoding a nucleic acid sequence of a G6PD mutant whose activity is downregulated or lost compared to wild-type G6PD; (3) a nucleic acid molecule selected from shRNA, siRNA, antisense RNA, ribozyme, and gene editing vector; and (4) a small molecule inhibitor.

[0081] Herein, the antibody against G6PD is preferably a monoclonal antibody or an antigen-binding fragment thereof. Commercially available antibodies or antigen-binding fragments thereof can be used to implement the present invention.

[0082] Herein, the G6PD mutant whose activity is downregulated or lost compared to the wild-type G6PD can be a mutant of G6PD known in the art. For example, a mutation can be implemented in the enzymatic activity center of the G6PD enzyme to weaken or downregulate or even lose its enzymatic activity. Then, by constructing a nucleic acid construct or vector of the mutant, it is used for homologous recombination into the cell genome, so that the cell expresses the G6PD mutant, thereby achieving the weakening or downregulation of G6PD activity.

[0083] Herein, the shRNA, siRNA or antisense RNA against G6PD binds to the mRNA region of G6PD. For example, the shRNA binds to the 1033 position of the G6PD mRNA, thereby inhibiting the expression of G6PD. The shRNA, siRNA or antisense RNA against G6PD can be designed and prepared using techniques well known in the art. The sequence of an exemplary shRNA against G6PD can be shown as SEQ ID NO: 3.

[0084] Herein, ribozymes can specifically cleave substrate RNA molecules by catalyzing the breakage of phosphodiester bonds in the target site RNA chain, thereby blocking the expression of the target gene. Therefore, ribozymes can be used to block the expression of the G6PD gene.

[0085] Herein, gene editing techniques such as ZFN, TALEN or CRISPR / Cas9 can be used to knock out the G6PD gene in the cell, thereby blocking its expression. ZFN, TALEN and CRISPR / Cas9 technologies applicable to the present invention are well known in the art. Each technology achieves the knockout of the target gene through the joint action of the DNA recognition domain and the nuclease. The reagents required for gene editing technology include guide RNA (sgRNA) and related nucleases (such as Cas9 protein complexes).

[0086] Herein, the small molecule inhibitors against G6PD may be small molecule compounds well known in the art, including but not limited to V6N, MLN8054 and Alisertib, etc. These small molecule inhibitors may be obtained from commercial sources, for example, A6N may be obtained from Selleck, MLN8054 may be obtained from TargetMol, and Alisertib may be obtained from Selleck.

[0087] In some embodiments, the agent that targets G6PD to inhibit the activity of the G6PD protein is the agent that targets ALODB to enhance the expression of the ALDOB gene or the activity of its encoded protein as described above. For example, ALODB can be overexpressed in cells or tissues, thereby inhibiting the activity of the G6PD protein.

[0088] In some embodiments, the patient's sensitivity to the chemotherapeutic drug GEM is increased by administering to the patient an agent that targets GLUT1 to inhibit the expression of the GLUT1 gene or the activity of its encoded protein, or by inhibiting the expression of the patient's GLUT1 gene or the activity of its encoded protein.

[0089] In some embodiments, the patient's sensitivity to the chemotherapeutic drugs 5-FU and / or GEM is increased by administering to the patient an agent that targets ALODB to enhance the expression of the ALDOB gene or the activity of its encoded protein, or by enhancing the expression of the patient's ALDOB gene or the activity of its encoded protein.

[0090] In some embodiments, the patient's sensitivity to the chemotherapeutic drugs 5-FU and / or GEM is increased by administering to the patient an agent that targets G6PD to inhibit the expression of the G6PD gene or the activity of its encoded protein, or by inhibiting the expression of the patient's G6PD gene or the activity of its encoded protein.

[0091] In some embodiments, the present invention also provides a pharmaceutical composition containing a chemotherapeutic drug and a preparation containing an agent that inhibits the GLUT1 / ALDOB / G6PD metabolic axis as described herein. The chemotherapeutic drug and the agent that inhibits the GLUT1 / ALDOB / G6PD metabolic axis are as described in any embodiment of the present invention. In the pharmaceutical composition, the chemotherapeutic drug and the preparation that inhibits the GLUT1 / ALDOB / G6PD metabolic axis can be packaged separately. The chemotherapeutic drug can be a preparation or dosage form known in the art, containing a known active ingredient and a known carrier or excipient. For example, the chemotherapeutic drug can be a gemcitabine (GEM), 5-fluorouracil (5-FU), irinotecan (IRI), oxaliplatin (OXA) preparation known in the art, or FOLFIRINOX, i.e., a combination of 5-fluorouracil (5-FU), irinotecan (IRI) and oxaliplatin (OXA). The preparation for inhibiting the GLUT1 / ALDOB / G6PD metabolic axis may contain, in addition to the agent for inhibiting the GLUT1 / ALDOB / G6PD metabolic axis described herein, various pharmaceutically acceptable carriers or excipients well known in the art.

[0092] The amount of the chemotherapeutic drug in the pharmaceutical composition can be an amount conventional in the art. These chemotherapeutic drugs can be administered at conventional doses in the art. The amount of the agent that inhibits the GLUT1 / ALDOB / G6PD metabolic axis in the pharmaceutical composition can be a dose that can effectively increase the sensitivity of the chemotherapeutic drug, which can be determined by a person of ordinary skill in the art based on a comprehensive consideration of multiple factors such as the severity of the disease, drug resistance, and patient conditions.

[0093] In some embodiments, the present invention also provides a kit comprising the pharmaceutical composition described herein.

[0094] In some embodiments, the present invention also provides the use of a combination of a preparation for inhibiting the GLUT1 / ALDOB / G6PD metabolic axis as described herein and a chemotherapeutic drug in the preparation of a drug for treating cancer patients. Preferably, the cancer is as described in any embodiment herein. In some embodiments, the agent is an agent that inhibits the expression of the GLUT1 gene or the activity of its encoded protein by targeting GLUT1, and the chemotherapeutic drug is GEM. In some embodiments, the agent is an agent that enhances the expression of the ALDOB gene or the activity of its encoded protein by targeting ALODB, and the chemotherapeutic drug is 5-FU and / or GEM. In some embodiments, the agent is an agent that inhibits the expression of the G6PD gene or the activity of its encoded protein by targeting G6PD, and the chemotherapeutic drug is 5-FU and / or GEM.

[0095] In some embodiments, the present invention also provides a method for reducing a patient's resistance to a chemotherapeutic drug or increasing a patient's sensitivity to a chemotherapeutic drug, the method comprising the step of administering to a patient an agent that inhibits the GLUT1 / ALDOB / G6PD metabolic axis. Preferably, the cancer suffered by the patient is as described in any embodiment herein, and the agent that inhibits the GLUT1 / ALDOB / G6PD metabolic axis is as described in any embodiment herein.

[0096] In some embodiments, the present invention also provides a method for treating cancer, comprising administering to a patient a therapeutically effective amount of a pharmaceutical composition as described in any embodiment herein. It should be understood that when a nucleic acid molecule, such as a nucleic acid construct, a vector, shRNA, siRNA, antisense RNA or ribozyme is administered, it can be administered using techniques well known in the art, such as liposome delivery, etc.

[0097] In some embodiments, the present invention also provides a screening method, which comprises contacting a substance to be screened, such as an antibody, protein, nucleic acid molecule or small molecule compound, with a cell or tissue containing the GLUT1 / ALDOB / G6PD metabolic axis, and detecting whether the expression of the GLUT1 gene and / or the activity of the GLUT1 protein in the cell or tissue is inhibited, whether the expression of the ALDOB gene and / or the activity of the ALDOB protein is enhanced, and / or whether the expression of the G6PD gene and / or the activity of the G6PD protein is inhibited, wherein the expression of the GLUT1 gene and / or the activity of the GLUT1 protein in the cell or tissue is inhibited, the expression of the ALDOB gene and / or the activity of the ALDOB protein is enhanced, and / or the expression of the G6PD gene and / or the activity of the G6PD protein is inhibited, indicating that the candidate compound is a potential substance that can reduce the resistance of cancer patients to chemotherapeutic drugs or increase the sensitivity of cancer patients to chemotherapeutic drugs. In some embodiments, the method further comprises the steps of setting negative controls and positive controls. In some embodiments, the present invention also provides the use of the GLUT1 / ALDOB / G6PD metabolic axis described herein in screening for substances that can reduce the resistance of cancer patients to chemotherapeutic drugs or increase the sensitivity of cancer patients to chemotherapeutic drugs. Preferably, the cancer is pancreatic cancer as described in any embodiment of the present invention. It should be understood that the screening is in vitro screening, or screening using a non-human animal model.

[0098] The present invention is further described below in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples where specific conditions are not specified are usually carried out according to conventional conditions such as those described in J. Sambrook et al., Molecular Cloning Experiment Guide, 3rd Edition, Science Press, or according to the conditions recommended by the manufacturer.

[0099] Experimental Materials

[0100] PDAC patients: from Changhai Hospital.

[0101] The components of PDAC organoid 3D culture medium are shown in Table 1.

[0102] Table 1: PDAC Organoid 3D Culture Medium Components

[0103] Medium components factory Part Number Advanced DMEM / F12 Gibco Cat#12634010 HEPES Gibco Cat#15630080 GlutMAX Gibco Cat#35050061 Penicillin-Streptomycin Gibco Cat#15140122 Primocin InvivoGen Cat#ant-pm-2 B27supplement Gibco Cat#17504044 Wnt3A conditioned medium Gao lab N / A R-spondin conditioned medium Gao lab N / A Noggin conditioned medium Gao lab N / A Nicotinamide SIGMA Cat#N0636-100G EGF Invitrogen Cat#PHG0313 FGF10 PEPRO TECH Cat#K2717 N-Acetyl-L-cysteine SIGMA Cat#A9165-100G A83-01 TOCRIS Cat#2939 Y-27632 Selleck chemicals Cat#S1049 Forskolin Selleck chemicals Cat#S2449 <![CDATA[TrypLE TM Express]]> Gibco Cat#12605028 Collagenase Type II Gibco Cat#17101015 Matrigel Matrix(For organoid culture) CORNING Cat#356231 Matrigel Matrix(For xenograft) CORNING Cat#354234

[0104] HE staining kit: Solarbio, G1120.

[0105] Ki-67 staining kit: Abcam, SP6.

[0106] CK19 staining kit: CST, D4G2.

[0107] Whole genome (WGS) sequencing, RNA-seq sequencing, ATAC-seq sequencing: Illumina, Nova sequencer

[0108] Glycolysis, TCA cycle, ECAR detection: Energy metabolism analyzer (seahorse, XF24). 13 The carbon labeling fraction in glucose indicates the relative carbon content of the analyte to the C 13 The ratio of glucose.

[0109] G6PD activity detection: G6PD activity detection kit BioTek Synergy Neo Multi-Mode Plate Reader (BioTek, USA).

[0110] 5-Fluorouracil (5-FU): (SIGMA, Cat#F6627); Gemcitabine (GEM): (TargetMol, Cat#T0251); Irinotecan (IRI): (Selleck, Cat#S1198); Oxaliplatin (OXA): (Selleck, Cat#S1124).

[0111] Exogenous purine nucleosides: Guanosine, Sigma, Cat#G6264; adenosine, Sigma, Cat#A4036.

[0112] Exogenous pyrimidine nucleosides: Uridine, Sigma, Cat#U3003; Cytidine, Sigma, Cat#C4654; Thymidine, Sigma, Cat#T1895.

[0113] GLUT1 inhibitor BAY-876: Selleck, Cat# S8452, solid powder.

[0114] 6-AN: Selleck, Cat# S9783, solid powder.

[0115] Experimental methods

[0116] G6PD activity detection

[0117] G6PD activity was measured at room temperature. G6PD was immunoprecipitated from organoid lysates and assayed for G6PD enzyme activity in a reaction buffer containing 42 mM Tris (PH 7.5), 2.66 mM 6-phosphoglucose (Sigma, G7879-500 mg), 40 mM MgCl2, and 0.66 mM β-NADP. The 340 nM absorbance change due to an increase in NADPH was measured using a BioTek Synergy Neo multi-function plate reader (BioTek, USA).

[0118] IP experiments

[0119] 1. Prepare RIPA and add protease inhibitors.

[0120] 2. Remove the cell culture medium and wash twice with 1×PBS (pH 7.2-7.4) (dosage: 1 ml for 10 cm dish, 600 ul for 6 cm dish, 200 ul for 6-well plate).

[0121] a) During the first wash, slowly add PBS along the wall, shake gently, and suck it off with a gun;

[0122] b) Add PBS directly for the second time, scrape the cells into a 1.5 ml EP tube and place on ice;

[0123] c) 4000 rpm for 5 min at 4°C and discard the supernatant.

[0124] 3. Add RIPA with protease inhibitors to the cells (dosage: 1 ml for 10 cm dish, 600 ul for 6 cm dish, 200 ul for 6-well plate), mix well without bubbles, and keep on ice for 30 min.

[0125] 4. Centrifuge at maximum speed for 10-15 min at 4°C.

[0126] 5. Aspirate the supernatant and keep it on ice for later use. 6. Add protein A / Gagarose beads to the supernatant, i.e., cell lysate (dosage: 30ul for 6cm-10cm dish, 20ul for 6-well plate)

[0127] 7. Cut the gun tip bald, and each time you add a gun, you must tilt it forward and turn it upside down to mix it thoroughly.

[0128] 8. Add antibody, mix at low speed at 4°C, dosage: 10ul (2ug) for 6-10cm dish, 6ul for 6-well plate (provided that the dosage for Western can be 1:1000).

[0129] 9. Mix at low speed at 4°C overnight.

[0130] 10. Wash beads: Incubate the mixture at 4000rpm for 5min at 4℃, discard the supernatant, add 1ml RIPA without protease inhibitors, shake at 4℃ for 10min, and centrifuge again. Repeat 4-5 times, centrifuge briefly after the last centrifugation, and remove the liquid with a 10ul gun. 10. Add 30ul or 20ul 2×SDS PAGE loading buffer, vortex and mix, boil in boiling water for 5min, centrifuge at the highest speed for 1min to allow agarose to settle, and then take the upper liquid for electrophoresis.

[0131] Example 1: Construction of a PDAC organoid library

[0132] Primary cells were isolated from fresh cancer tissues of 28 PDAC patients (patients from Changhai Hospital), and 6,000 cells were inoculated in 50% matrix gel (CORNING, Cat#356231) for 3D culture. 24 culture media (as shown in Table 2) were designed and cultured for one week at 37 degrees and 5% CO2 to explore culture conditions suitable for the growth of PDAC tumor organoids. By calculating the number of cells and measuring the size of the organoids, it was found that the culture condition No. 16 was the best and was used as the subsequent culture condition.

[0133] Table 2: 24 designed culture media

[0134]

[0135]

[0136] The abbreviations in Table 2 are:

[0137] N(Noggin conditioned medium 4%);

[0138] E (EGF 50 ng / ml);

[0139] R(R-spondin conditioned medium 2%);

[0140] W(Wnt3A conditioned medium 30%);

[0141] X(XMU-MP-1 10nM);

[0142] A(A83-01 500nM);

[0143] F10 (FGF10 10 ng / ml);

[0144] FK (Forskolin 10uM);

[0145] BM (Advanced DMEM / F12, Primocin (100ug / ml), double antibody (1X), HEPES (10mM), GlutaMAX-I (1X)).

[0146] After finding the most suitable culture conditions, fresh PDAC cancer tissues from 28 patients in Changhai Hospital were collected and numbered according to the patient source, named DAC-patient number. The same method was used for 3D culture of PDAC organoids, and finally a PDAC organoid bank was established (the organoid bank contains 28 PDAC tumor organoids).

[0147] Organoids were inoculated subcutaneously into SCID mice at a concentration of 2 million cells per transplanted tumor. 3 The tumor was removed and the transplanted tumor was obtained.

[0148] HE staining was performed on cancer tissues and their corresponding organoids and transplanted tumors to compare the morphological differences between tissues, organoids, and transplanted tumors. Figure 1 As shown in Figure 2, the results showed morphological consistency between tissues, organoids, and transplanted tumors. Figure 2 As shown, by staining the proliferation marker Ki-67, we detected whether the organoids maintained the clinical staging characteristics of the tumor tissue. The results showed that the organoids maintained the proliferation characteristics of the tissue. By staining the differentiation marker CK19, we detected whether the organoids maintained the differentiation characteristics of the tumor tissue. The results showed that the organoids maintained the differentiation characteristics of the tissue.

[0149] Example 2: Broad-target metabolic typing and multi-omics analysis

[0150] Twenty-eight PDAC tumor organoids were collected and cultured in 3D. Blood (whole blood) from the same patient was used as a control for whole genome sequencing (WGS), RNA-seq, and ATAC-seq. The results of WGS, RNA-seq, and ATAC-seq sequencing were obtained after bioinformatics analysis. Figure 3 (GK) results. The broad-target metabolome (water-soluble metabolites, including carbohydrates, proteins, nucleic acids, lipid precursors, etc.) and the broad-target lipidome (fat-soluble metabolites) were detected simultaneously.

[0151] PDAC organoids were classified into two metabolic subtypes, Class 1 and Class 2 (as shown in Table 3) using the broad-target metabolome. By ssGSEA analysis (using the R package GSVA (parameter: method = "ssgsea"), the enrichment scores of six known metabolic gene sets in the broad-target metabolic spectrum were calculated, and the differences in the enrichment scores of different metabolic gene sets in Class 1 and Class 2 metabolic subtypes were compared), it was found that Class 1 was enriched in lipid metabolism genes, so Class 1 was named Lipomet-PDAC. Class 2 was enriched in sugar metabolism genes, so Class 2 was named Glucomet-PDAC.

[0152] Using C 13 Cells were labeled with labeled glucose for 24 h, and the cells were collected for LC-MS to detect the abundance of labeled metabolites. The differences between class 1 and class 2 in sugar metabolism (including glycolysis, TCA cycle, oxidative PPP, and non-oxidative PPP) were compared, which also showed that class 2 was relatively enriched in sugar metabolism.

[0153] Table 3: PDAC organoid classification

[0154]

[0155] The cells to be tested were cultured in glucose-free medium for 24 hours. 13 Cells were labeled with labeled glucose for 24 hours, and then collected. Glycolysis and TCA cycle were detected by GC-MS, and oxidative PPP and non-oxidative PPP were detected by LC-MS. Markers of glycolysis include: pyruvate, lactate, alanine, glycine, serine, F6P, F1, 6P. Markers of TCA cycle include: fumarate, malate, aspartate, α-ketoglutarate, glutamate, glutamine, citrate and proline. Oxidative PPP includes: G6P, 6PG, R5P. Non-oxidative PPP includes: S7P, E4P.

[0156] Genome Analysis Toolkit was used to analyze gene mutations, and CNVKit was used to analyze copy number variation and chromatin instability. The differences in gene expression and chromatin openness between the two metabolic subtypes of type 1 and type 2 were further compared. The results are shown in the figure. Figure 3(GI). No significant differences were observed between the two metabolic subtypes at the genomic level (including gene mutations, chromatin instability, and number of mutations), indicating that the metabolic differences between the two subtypes were not due to differences at the genomic level. TopHat was used to process the raw RNA-seq data, and Cufflinks was used to retrieve gene expression values ​​to analyze the differentially expressed genes between the two metabolic subtypes. 280 differentially expressed genes were found between the two metabolic subtypes, among which glucose transporter 1 (GLUT1) and glucose-6-phosphate dehydrogenase (G6PD) were relatively more expressed in Glucomet-PDAC, while aldolase B (ALDOB) was relatively more expressed in Lipomet-PDAC. The R package DiffBind was used to calculate the ATAC peaks with significant differences in the two metabolic subtypes, and then the plotHeatmap function of the deepTools software was used to plot the openness of the ATAC peaks corresponding to the characteristic gene set of the metabolic subtypes. The results are shown in the figure. Figure 3 As shown in (K), the ATAC peaks corresponding to the genes significantly enriched in Lipomet-PDAC are more open in Lipomet-PDAC, and the ATAC peaks corresponding to the genes significantly enriched in Glucomet-PDAC are more open in Glucomet-PDAC.

[0157] Example 3: Clinical significance of metabolic typing

[0158] In this example, the Bailey PDAC dataset (derived from the article Genomic analyses identify molecular subtypes of pancreatic cancer, n = 55 patients) and the TCGA PDAC dataset (derived from the article Integrated Genomic Characterization of Pancreatic Ductal Adenocarcinoma, n = 156 patients) were used to detect the correlation between metabolic subtypes and clinical outcomes.

[0159] In the absence of metabolomic data (i.e., lack of longitudinal data), the Bailey PDAC dataset and the TCGA PDAC dataset were divided into two subtypes based on the expression of metabolic signature genes.

[0160] In both datasets, the overall survival of Glucomet-PDAC patients was significantly lower than that of Lipomet-PDAC patients. At the same time, the classification of patients according to metabolic subtypes was significantly better than that according to RNA subtypes ( Figure 4 (B) Figure 5 (A) Comparison, Figure 4 (D) Figure 5 (B) is more able to separate the prognosis ( Figure 5 ).

[0161] Furthermore, the inventors used four chemotherapy drugs, gemcitabine (GEM), 5-fluorouracil (5-FU), irinotecan (IRI) and oxaliplatin (OXA), which all work by inhibiting DNA synthesis, to treat the 28 patients in Example 1, and statistically analyzed the area under the drug-time curve (AUC) of different chemotherapy drugs in each patient. The higher the AUC value, the more sensitive the chemotherapy drug is, so as to compare the difference in chemotherapy sensitivity between Glucomet-PDAC and Lipomet-PDAC. The results showed that Glucomet-PDAC was more resistant than Lipomet-PDAC ( Figure 4 , EF).

[0162] Example 4: Regulatory effect of ALDOB on G6PD activity

[0163] like Figure 6 As shown, a joint analysis of the transcriptome and metabolome revealed that the GLUT1 / ALDOB / G6PD metabolic axis plays a key role in influencing the direction of metabolites.

[0164] Comparison of the gene expression of GLUT1 and ALDOB in Glucomet-PDAC and Lipomet-PDAC revealed that the GLUT1 content was higher and the ALDOB content was lower in Glucomet-PDAC ( Figure 6 , A). GLUT1 gene expression is proportional to L-lactic acid content, and ALDOB gene expression is inversely proportional to L-lactic acid content ( Figure 6 , B). Meanwhile, relative glucose consumption and lactate content in the matrix were higher in Glucomet-PDAC ( Figure 6 , C). This indicates that the increased expression of GLUT1 in glycolysis leads to increased glycolytic flux in Glucomet-PDAC.

[0165] Two GLUT1 shRNAs were designed, named shGLUT1-1 and shGLUT1-5 (SEQ ID NO: 1, 2), and the empty vector was used as a control. They were cloned into the SGEP expression vector to obtain the GLUT1 knockdown plasmid. Vigofect was used to transfer it into 293T cells, and the virus-infected cells were collected to detect the knockdown effect of the gene by qPCR.

[0166] shGLUT1-1 (SEQ ID NO: 1):

[0167] TGCTGTTGACAGTGAGCGCTAGATGCAAGATATTTATATATAGTGAAGCCACAGATGTATATATAAATATCTTGCATCTATTGCCTACTGCCTCGGA

[0168] shGLUT1-5 (SEQ ID NO: 2):

[0169] TGCTGTTGACAGTGAGCGACCGCTTCATCATCGGTGTGTATAGTGAAGCCACAGATGTATACACACCGATGATGAAGCGGCTGCCTACTGCCTCGGA

[0170] After shRNA interference with GLUT1 expression, the carbon labeling fractions in glycolysis markers and TCA cycle markers were reduced ( Figure 6 , DE), and the ECAR curve was also significantly lower than that of the control group ( Figure 6 , F), and at the same time, the fluorescence absorption values ​​of both the matrix glycolysis level and the compensatory glycolysis level decreased ( Figure 6 , G), indicating that increased GLUT1 expression can transport more glucose into cells to meet the cells' demand for glucose.

[0171] The ALDOB gene sequence (Gene ID: 229) was cloned into a plasmid to construct an ALDOB overexpression plasmid, and an empty vector was used as a control. The plasmid was transferred into 293T cells using lentivirus, and virus-infected cells were collected to detect the overexpression effect of the gene by qPCR.

[0172] After overexpression of ALDOB, the carbon labeling fractions in glycolysis markers and TCA cycle markers were reduced ( Figure 6 , HI), while both the substrate glycolysis level and the compensatory glycolysis level were reduced ( Figure 6 , K), indicating that the decrease in ALDOB expression will lead to the accumulation of metabolites (G6P, F6P, F1, 6P), and the accumulated metabolites flow into the pentose phosphate pathway.

[0173] However, since there is no difference in the expression of G6PD protein level, the inventors speculate that ALDOB can bind to G6PD and inhibit its activity. After ALDOB expression is reduced, the activity of G6PD increases, which in turn promotes the flow of metabolites to the pentose phosphate pathway, synthesizing more raw materials involved in DNA synthesis, and inducing the insensitivity of cells to four chemotherapy drugs: gemcitabine (GEM), 5-fluorouracil (5-FU), irinotecan (IRI) and oxaliplatin (OXA).

[0174] Based on the above hypothesis, the inventors first detected the activity of G6PD in Glucomet-PDAC and Lipomet-PDAC, and then used the same method to overexpress ALDOB, with an empty vector as the control group. Under the condition of intervening the GLUT1 / ALDOB / G6PD metabolic axis, the activity of G6PD and the level of oxidized PPP (G6P, 6PG, R5P) were detected. The IP experiment was used to detect the interaction between ALDOB and G6PD. The relationship between the expression of GLUT1 and ALDOB and fatty acid metabolism, pentose phosphate pathway, and glycolysis and gluconeogenesis was analyzed through the GSEA website. The samples were divided into GLUT1 and ALDOB groups according to the expression of ALDOB and GLUT1 using tissue chips. 高 GLUT1 低 、ALDOB 高 、ALDOB 低 Four groups, statistics of GLUT1 高 ALDOB 高 GLUT1 低 ALDOB 高 , GLUT1 高 ALDOB 低 , GLUT1 低 ALDOB 低 Prognostic probability of survival in four groups.

[0175] Figure 7 The results showed that the activity of G6PD was higher in Glucomet-PDAC compared with Lipomet-PDAC, proving that ALDOB has a regulatory effect on G6PD activity. Overexpression of ALDOB in Glucomet-PDAC can inhibit the activity of G6PD and reduce the metabolic level of the oxidative PPP metabolic pathway (G6P, 6PG, R5P). At the same time, the inventors also found that there is an interaction between ALDOB and G6PD, indicating that the inhibitory effect of ALDOB on the enzymatic activity of G6PD is achieved through direct binding. In order to further verify the inventors' findings, the inventors used TCGA data for verification. According to the expression of GLUT1 and ALDOB, the samples were divided into four categories. Among them, GLUT1 高 ALDOB 低 The samples were enriched for the pentose phosphate pathway and glycolysis, while GLUT 低 ALDOB 高 The fatty acid metabolism was enriched in the samples. Tissue microarray further demonstrated that GLUT1 高 ALDOB 低 This group of patients has the worst prognosis.

[0176] Example 5: Effect of GLUT1 / ALDOB / G6PD metabolic axis on drug sensitivity

[0177] In this example, the content of nucleosides and their derivatives in Glucomet-PDAC and Lipomet-PDAC was compared by comparing the nucleosides and their derivatives detected in the broad-target metabolites ( Figure 8 , A), Correlation between the expression of ALDOB and G6PD and the abundance of nucleosides and their derivatives in cells ( Figure 8 , B), and the effect of adding pyrimidine nucleosides to the culture medium (i.e., replenishing pyrimidine nucleosides) on the sensitivity of chemotherapeutic drugs ( Figure 8 , CF). Further, the effects of knocking down GLUT1, overexpressing ALDOB, and knocking down G6PD on 5-FU sensitivity, as well as the effects of adding pyrimidine nucleosides or purine nucleosides to the culture medium on the sensitivity of chemotherapeutic drugs were analyzed.

[0178] A G6PD shRNA was designed and named shG6PD (SEQ ID NO: 3). The empty vector was used as a control and cloned into the SGEP expression vector by PCR using endonucleases to obtain a knockdown plasmid. It was transferred into lentivirus using vigofect and transfected into 293T cells. The knockdown efficiency of G6PD was detected by qPCR.

[0179] shG6PD (SEQ ID NO: 3):

[0180] TGCTGTTGACAGTGAGCGcgGccgtcaccaagaacattcaTAGTGAAGCCACAGATGTA

[0181] Increased metabolic flux in glycolysis and the pentose phosphate pathway led to increased nucleoside biosynthesis, including pyrimidine and purine nucleosides, and induced resistance to chemotherapeutic drugs in Lipomet-PDAC cells. Figure 8 As shown, analysis of the broad targeted metabolome revealed that pyrimidine and purine pathway-related metabolites were enriched in Glucomet-PDAC. In addition, nucleoside and nucleoside derivative levels were significantly correlated with high expression of GLUT1 and low expression of ALDOB. Further studies showed that exogenous addition of pyrimidine nucleosides but not purine nucleosides induced therapeutic resistance to GEM and 5-FU in Lipomet-PDAC organoids, but had no effect on Glucomet-PDAC organoids. However, increased pyrimidine nucleoside levels did not affect the sensitivity of Lipomet-PDAC and Glucomet-PDAC to nab-paclitaxel (PTX, which acts on microtubules) ( Fig. 9 , GJ). These results suggest that increased flux in the pyrimidine nucleoside biosynthetic pathway contributes to chemoresistance in Glucomet-PDAC.

[0182] GLUT1 knockdown, ALDOB overexpression, or G6PD knockdown significantly increased the sensitivity of Glucomet-PDAC organoids to GEM, 5-FU, IRI, and OXA ( Fig. 9 , AF). In addition, ALDOB overexpression significantly increased the sensitivity of Glucomet-PDAC to 5-FU in vivo. However, changes in the expression of GLUT1 or ALDOB did not affect the sensitivity of Glucomet-PDAC organoids to PTX ( Fig. 9 , GJ). Exogenous pyrimidine nucleosides effectively rescued the increased drug sensitivity caused by GLUT1 knockdown, ALDOB overexpression, or G6PD knockdown in Glucomet-PDAC cells ( Fig. 9 , LM). However, under GLUT1 knockdown conditions, the addition of exogenous purine nucleosides had no effect on the chemosensitivity of Glucomet-PDAC organoids to 5-FU and GEM ( Fig. 9 , K).

[0183] Two ALDOB shRNAs were designed, named shALDOB-1 (SEQ ID NO: 4) and shALDOB-2 (SEQ ID NO: 5), and the empty vector was used as a control. They were cloned into the SGEP expression vector by PCR using endonucleases to obtain knockdown plasmids. They were transferred into lentivirus by vigofect and transfected into 293T cells. The knockdown efficiency of ALDOB was detected by qPCR.

[0184] shALDOB-1 (SEQ ID NO: 4):

[0185] TGCTGTTGACAGTGAGCGAAAGGAGATAGCTGCAACCAAATAGTGAAGCCACAGATGTATTTGGTTGCAGCTATCTCCTTCTGCCTACTGCCTCGGA

[0186] shALDOB-2 (SEQ ID NO: 5):

[0187] TGCTGTTGACAGTGAGCGAACCAAGAAGTATACTCCAGAATAGTGAAGCCACAGATGTATTCTGGAGTATACTTCTTGGTGTGCCTACTGCCTCGGA

[0188] Downregulation of ALDOB by shRNA significantly induced chemoresistance of Lipomet-PDAC organoids to 5-FU and GEM. The addition of exogenous pyrimidine nucleosides effectively reduced the difference in chemosensitivity of Lipomet-PDAC organoids between the ALDOB knockout group and the control group ( Fig. 9 , NP). These results suggest that the GLUT1 / ALDOB / G6PD axis mediates chemoresistance in pancreatic cancer cells by regulating glucose metabolism and pyrimidine nucleoside levels.

[0189] Example 6: Inhibition of the GLUT1 / ALDOB / G6PD metabolic axis increases cell sensitivity to chemotherapeutic drugs

[0190] This example explores the effect of knocking down GLUT1 on the growth of transplanted tumors ( Fig.10 , A). The GLUT1 inhibitor BAY-876 (final concentration 50 nM) was added to the culture medium to explore its effect on glucose consumption ( Fig.10 , B), GEM chemotherapy drug sensitivity ( Fig.10 , C). Since 6-aminonicotinamide (6AN) is an inhibitor of NADP+-dependent enzyme-6-phosphogluconate dehydrogenase (6-PGDH), it can inhibit glycolysis. Therefore, 6AN (final concentration 100 μM) was given in the culture medium to explore its inhibitory effect on G6PD activity ( Fig.10 , D), Effects on 5-FU sensitivity of Glucomet-PDAC cells ( Fig.10 , E), Effect of 6AN (5 mg / kg, administered once every two days) combined with the chemotherapy drug 5-FU (25 mg / kg, administered once every two days) on the growth of transplanted tumors ( Fig.10 , FG).

[0191] The results showed that knockout of GLUT1 significantly inhibited the growth of Glucomet-PDAC-derived xenografts. The GLUT1 inhibitor BAY-876 reduced glucose uptake in Glucomet-PDAC organoids and Lipomet-PDAC organoids. At the same time, BAY-876 increased the sensitivity of Glucomet-PDAC to GEM, but had no significant effect on Lipomet-PDAC. Under the condition of BAY-876 inhibiting GLUT1, the addition of exogenous pyrimidine nucleosides effectively reduced the sensitivity of Glucomet-PDAC organoids to GEM and 5-FU. These results indicate that inhibitors of GLUT1 have the potential to enhance the chemotherapy response of PDAC.

[0192] G6PD plays an important role in regulating the oxidative PPP pathway and nucleotide biosynthesis. Taking 5-FU as an example, the inventors studied the therapeutic potential of the G6PD inhibitor 6AN in promoting chemotherapy sensitivity. The results showed that 6AN treatment attenuated G6PD activity but had no effect on the cell viability of Glucomet-PDAC and Lipomet-PDAC organoids. In addition, 6AN increased the sensitivity of Glucomet-PDAC organoids to 5-FU and GEM, but had no effect on Lipomet-PDAC organoids. In resistant Glucomet-PDAC xenografts, 6AN significantly increased the tumor response to 5-FU ( Fig.10 , FG).

[0193] The above-mentioned embodiments only express several implementation methods of the present invention, and the description thereof is relatively specific and detailed, but it cannot be understood as limiting the scope of the patent of the present invention. It should be pointed out that, for a person of ordinary skill in the art, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims. At the same time, all the documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference separately.

Claims

1. Use of an agent that inhibits the GLUT1 / ALDOB / G6PD metabolic axis in the preparation of a drug for reducing cancer patients' resistance to chemotherapeutic drugs or increasing cancer patients' sensitivity to chemotherapeutic drugs, or use of a combination of an agent that inhibits the GLUT1 / ALDOB / G6PD metabolic axis and a chemotherapeutic drug in the preparation of a drug for treating cancer patients, or use of an agent that inhibits the GLUT1 / ALDOB / G6PD metabolic axis in the preparation of a drug that inhibits patients' glucose metabolism, reduces the flow of its metabolites to the pentose phosphate pathway, and thereby reduces the raw materials involved in DNA synthesis.

2. The use according to claim 1, characterized in that The chemotherapy drugs include any one or any combination of 5-fluorouracil, gemcitabine, irinotecan and oxaliplatin.

3. The use according to claim 1 or 2, characterized in that The agent that inhibits the GLUT1 / ALDOB / G6PD metabolic axis is selected from: (1) An agent that targets GLUT1 and inhibits the expression of the GLUT1 gene or the activity of the protein it encodes; (2) agents that target ALDOB and enhance the expression of the ALDOB gene or the activity of its encoded protein; (3) An agent that targets G6PD and inhibits the expression of the G6PD gene or the activity of the protein it encodes.

4. The use according to claim 3, characterized in that The agent that targets GLUT1 and inhibits the expression of the GLUT1 gene or the activity of its encoded protein is selected from: (1) an antibody to GLUT1; (2) an expression construct or vector encoding a nucleic acid sequence of a GLUT1 mutant whose activity is downregulated or lost compared to wild-type GLUT1; (3) a nucleic acid molecule selected from shRNA, siRNA, antisense RNA, ribozyme, and gene editing vector; and (4) a small molecule inhibitor; preferably, the inhibitor is BAY-576; The agent targeting ALODB to enhance the expression of the ALDOB gene or the activity of its encoded protein is selected from: (1) an ALDOB encoding gene or an expression construct or vector containing the encoding gene, or encoding an ALDOB mutant with upregulated or increased activity compared to wild-type ALDOB; (2) an agent for gain-of-function point mutation of ALDOB; and (3) a small molecule agonist; The agent that targets G6PD and inhibits the expression of the G6PD gene or the activity of its encoded protein is selected from: (1) an antibody to G6PD; (2) a homologous recombination vector encoding a nucleic acid sequence of a G6PD mutant whose activity is downregulated or lost compared to wild-type G6PD; (3) a nucleic acid molecule selected from shRNA, siRNA, antisense RNA, ribozyme and gene editing vector; (4) a small molecule inhibitor; preferably, the inhibitor is selected from one or more of V6N, MLN8054 and Alisertib.

5. The use according to any one of claims 1 to 4, characterized in that The chemotherapy drug resistance is the chemotherapy drug resistance mediated by glucose metabolism and / or pyrimidine nucleoside level.

6. The use according to claim 5, characterized in that The glucose metabolism includes: tricarboxylic acid cycle, glycolysis, pentose phosphate pathway and gluconeogenesis; preferably, metabolites of the tricarboxylic acid cycle include: fumarate, malate, aspartate, α-ketoglutarate, glutamate, glutamine, citric acid, proline; metabolites of glycolysis include: pyruvate, lactate, alanine, glycine, F6P, F1, 6P; metabolites of the pentose phosphate pathway include: oxidative 5′-triphosphate products and non-oxidative 5′-triphosphate products; preferably, the oxidative 5′-triphosphate products include G6P, 6PG and R5P, and the non-oxidative 5′-triphosphate products include S7P and E4P; The pyrimidine nucleoside level includes endogenous pyrimidine nucleoside level and exogenous pyrimidine nucleoside level.

7. The use according to any one of claims 1 to 6, characterized in that The cancer is pancreatic cancer; Preferably, the pancreatic cancer includes: pancreatic ductal adenocarcinoma, pancreatic cell carcinoma, adenoid squamous cell carcinoma, mucinous cystadenocarcinoma, pancreatoblastic carcinoma and islet cell carcinoma; More preferably, the pancreatic ductal adenocarcinoma comprises: a squamous subtype, a progenitor cell subtype, a quasi-mesenchymal subtype, a classical subtype and a basal subtype.

8. A pharmaceutical composition, characterized in that The pharmaceutical composition contains a chemotherapeutic drug and a formulation containing an agent that inhibits the GLUT1 / ALDOB / G6PD metabolic axis; Preferably, the chemotherapy drug is as described in claim 2; Preferably, the agent that inhibits the GLUT1 / ALDOB / G6PD metabolic axis is as described in claim 3 or 4.

9. A medicine box, characterized in that: The kit contains: (1) a preparation containing an agent that inhibits the GLUT1 / ALDOB / G6PD metabolic axis, and (2) a chemotherapeutic drug; or contains the pharmaceutical composition of claim 8; Preferably, the chemotherapy drug is as described in claim 2; Preferably, the agent that inhibits the GLUT1 / ALDOB / G6PD metabolic axis is as described in claim 3 or 4.

10. Application of GLUT1 / ALDOB / G6PD metabolic axis in screening substances that can reduce the resistance of cancer patients to chemotherapeutic drugs or increase the sensitivity of cancer patients to chemotherapeutic drugs; Preferably, the chemotherapy drug is as described in claim 2; Preferably, the cancer is the cancer according to claim 7.

Images