A dark septate endophytic fungus strain and application thereof

By providing a microbial agent prepared from the dark-colored septate endophytic fungal strain YMF1.068, the problem of root-knot nematode disease control was solved, achieving efficient and safe biological control, enhancing plant resistance, and reducing the use of chemical pesticides.

CN119464075BActive Publication Date: 2026-04-28YUNNAN UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
YUNNAN UNIV
Filing Date
2024-11-06
Publication Date
2026-04-28

AI Technical Summary

Technical Problem

Current technologies lack effective applications of dark-colored septate endophytic fungal strains in the control of root-knot nematode disease. Chemical pesticides have negative impacts on the environment and livestock, and biological control resources are insufficient.

Method used

A dark-colored septate endophytic fungal strain YMF1.068 (Paraphoma vinacea) is provided to prepare an inoculum for the control of root-knot nematode disease. The inoculum is prepared by fermentation, drying, and pulverization and can be used on crops such as tomatoes, cucumbers, and tobacco.

Benefits of technology

This strain exhibits high lethality against root-knot nematodes, enhances plant resistance, is safe for humans and animals, achieves a control efficacy of over 68%, is environmentally friendly, and reduces the negative impacts of chemical pesticides.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005120963640000081
    Figure BDA0005120963640000081
  • Figure BDA0005120963640000091
    Figure BDA0005120963640000091
  • Figure BDA0005120963640000101
    Figure BDA0005120963640000101
Patent Text Reader

Abstract

The application discloses a dark septate endophytic fungus strain and application thereof, and the strain is a dark septate endophytic fungus strain YMF1.068, the preservation name is Paraphoma vinacea, and the strain is preserved in the China General Microbiological Culture Collection Center (CGMCC) and has a preservation unit address of No. 3, Xibin West Road, Chaoyang District, Beijing, a preservation date of May 20, 2024, and a preservation number of CGMCC No. 41305. The strain can effectively prevent and control root-knot nematode disease, has high lethal activity, enhances plant resistance, and is safe to humans and animals and free of residues. The application of a microbial agent prepared by using the strain on tomatoes, cucumbers and tobacco shows a control effect of more than 68%, which is equivalent to the effect of chemical pesticides, and the microbial agent shows potential and market prospects as a biological pesticide.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of microbial pesticide technology, specifically to a dark-colored septate endophytic fungal strain and its application. Background Technology

[0002] Plant parasitic nematodes cause $157 billion in crop losses globally each year (Abad et al., 2008), making them the second leading cause of plant disease damage after fungal diseases; approximately 50% of these losses are caused by root-knot nematodes (Kim et al., 2016). The genus *Meloidogyne* has reported 103 species (Sun et al., 2024), and these nematodes can parasitize almost all flowering plants, including all cultivated crops (Yimer et al., 2023), particularly those in the Solanaceae, Cucurbitaceae, Poaceae, Brassicaceae, Fabaceae, Apiaceae, Liliaceae, and valuable medicinal herbs, causing yield reductions of over 20%, and in severe cases, even total crop failure. Furthermore, wounds created by root-knot nematode infection can lead to infections with other soil-borne pathogens, forming root-knot nematode complex diseases, further exacerbating plant damage (Wagner et al., 2022).

[0003] The use of chemical pesticides is the main measure for controlling root-knot nematodes. Currently, the main chemical pesticides that can effectively control root-knot nematodes include abamectin, fluopyram, thiazophos, methyl bromide, carbofuran, aldicarb, dazomet, fenvalerate, fenitrothion, and chlorpyrifos (Taylor, 2003). Due to the high toxicity of some nematicidal chemical pesticides, which negatively impact humans, livestock, and the ecological environment, highly toxic and persistent nematicides are restricted or prohibited from application and promotion in actual production under the current policy guidance of reducing pesticide and fertilizer use and ecological protection. This has created a vast space for the development of biological pesticides (Hu & Liu, 2024). Nematode biocontrol bacteria kill nematodes through predation, parasitism, and toxin production. They are an important group of microorganisms controlling nematode populations in nature and an important resource for developing biological control agents (Li et al., 2015). Biological control of root-knot nematodes has the characteristics of long-lasting effect and eco-friendliness. Exploring new biocontrol resources and developing highly efficient biological nematicides has broad market prospects.

[0004] Dark septate endophytes (DSEs) are a major group of plant endophytes. Their characteristic feature is that after DSEs form symbiotic relationships with plant roots, they can form dark-colored hyphal structures with distinct septa. They can form "micro-sclerotia" structures within plant cells and intercellular spaces. DSEs colonize the epidermis and cortex of healthy plant roots, posing no harm to the host plant and enhancing its resistance to pathogens and tolerance to heavy metal stress (Luo Qixin & Hou Rui, 2024). Studies have shown that DSEs have good application value in nematode control; for example, Ashrafi et al. (2018) reported that *Polyphilus sieberi* can parasitize the eggs of *Heterodera avenae*. This fungus colonizes on nematode sporangia and eggs by forming highly melanized single-spore hyphae, producing melanized hyphae and the typical micro-sclerotia-like structures of dark septate endophytes. Nevertheless, there are few reports on the research and application of DSE in the control of nematode diseases, and a large number of biological control resources remain to be explored and utilized.

[0005] Currently, there is a lack of applications of dark-colored septate endophytic fungal strains in the control of root-knot nematodes. Summary of the Invention

[0006] The purpose of this invention is to provide a dark-colored septate endophytic fungal strain and its applications.

[0007] In order to solve the problems of the prior art, the present invention provides the following technical solution: In a first aspect, this application provides a dark-colored septate endophytic fungal strain;

[0008] Secondly, this application provides a dark-colored septate endophytic fungal agent prepared from a strain of dark-colored septate endophytic fungus;

[0009] Thirdly, this application provides a method for preparing a dark-colored, septate endophytic fungal inoculant;

[0010] Fourthly, this application provides the use of a dark-colored septate endophytic fungal strain or a dark-colored septate endophytic fungal agent in the preparation of a formulation for the control of root-knot nematode disease.

[0011] The first aspect of this application provides a dark-colored septate endophytic fungus strain, YMF1.068, with the depositary name *Paraphoma vinacea*, deposited at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, on May 20, 2024; accession number: CGMCC No. 41305.

[0012] Furthermore, the ITS gene sequence of the dark-colored septate endophytic fungal strain is the nucleotide sequence shown in SEQ ID No. 1.

[0013] The second aspect of this application provides a dark-colored septate endophytic fungal agent prepared from a strain of dark-colored septate endophytic fungus.

[0014] Furthermore, its active ingredient is at least one of the following (a), (b), and (c):

[0015] (a) Fermentation culture of dark-colored septate endophytic fungi;

[0016] (b) The resulting suspension of dark-colored septate endophytic fungi spores;

[0017] (c) The obtained dark-colored septate endophytic fungal cells were lysed by ultrasound and precipitated.

[0018] The third aspect of this application provides a method for preparing a dark-colored, septate endophytic fungal inoculant, comprising the following steps:

[0019] (1) YMF1.068 strain in vitro slant seed culture: The strain was inoculated onto the slant of PDA medium and cultured at 28℃ for 5 days to obtain slant seeds;

[0020] (2) Liquid seed culture of YMF1.068 strain: The slant seed was inoculated into an Erlenmeyer flask containing PDB medium and cultured on a shaker at 28℃ and 150rpm for 4 days to obtain liquid seed.

[0021] (3) Large-scale culture of YMF1.068 strain in fermenter: Liquid seed was inoculated into a fermenter containing PDB medium at a volume ratio of 5%. The culture conditions in a 1000-liter fermenter were controlled as follows: temperature 28℃, stirring speed 120-180rpm, fermentation time 72-96 hours.

[0022] (4) Preparation of YMF1.068 inoculant: Microbial cells and their metabolites obtained by fermentation in a fermenter are mixed with an appropriate amount of diatomaceous earth and dried or air-dried at a temperature below 65°C until the moisture content is less than 5%. After pulverization, a dark-colored septate endophytic fungal inoculant is obtained.

[0023] The application of the dark-colored septate endophytic fungal strains or dark-colored septate endophytic fungal agents provided in the fourth aspect of this application in the preparation of agents for the prevention and control of root-knot nematode disease.

[0024] Beneficial Effects: This invention discloses a dark-colored, septate endophytic fungus strain, *Paraphoma vinacea* YMF1.068, which effectively controls root-knot nematode disease, exhibits high lethality, enhances plant resistance, and is safe for humans and animals with no residue, meaning it has minimal impact on the environment and human health. Microbial agents prepared using this strain showed control efficacy exceeding 68% on tomatoes, cucumbers, and tobacco, comparable to chemical pesticides, demonstrating its potential and market prospects as a biological pesticide.

[0025] Compared with the prior art, the present invention has the following advantages:

[0026] (1) The present invention screened a DSE strain Paraphoma vinacea YMF1.068, which has strong lethal activity against second-instar larvae of root-knot nematodes. The fungal agent prepared using strain YMF1.068 has a control efficacy of more than 68% against root-knot nematode disease in tomatoes, cucumbers and tobacco, and has important application value. However, the nematicidal activity of this DSE and its application in root-knot nematode disease have not been reported.

[0027] (2) Safety to humans and animals: As YMF1.068 microbial agent is a biological pesticide, it is safe for humans, animals, and the environment, and therefore has good application prospects, especially under the current policy guidance of reducing pesticides and fertilizers and protecting the environment. Eco-friendly: As a biological pesticide, YMF1.068 microbial agent has the characteristics of long-lasting effect and eco-friendliness, which helps to reduce the negative impact of chemical pesticides on the environment.

[0028] (3) New Biocontrol Resources: This invention provides a new biocontrol resource that helps reduce dependence on chemical pesticides and offers new possibilities for developing highly effective biological nematicides. Enhanced Plant Resistance: Dark-colored septate endophytic fungi (DSE) colonize the epidermis and cortex of healthy plant roots, posing no harm to the host plant and enhancing the host plant's resistance to pathogens and tolerance to heavy metal stress. Broad Market Prospects: Exploring new biocontrol resources and developing highly effective biological nematicides has broad market prospects, which helps promote sustainable agricultural development and ecological protection. Detailed Implementation

[0029] To make the technical problems, technical solutions, and beneficial effects of this application clearer, the following detailed description is provided in conjunction with embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the scope of this application.

[0030] In this application, the term "and / or" describes the relationship between related objects, indicating that three relationships can exist. For example, A and / or B can represent: A existing alone, A and B existing simultaneously, or B existing alone. A and B can be singular or plural. The character " / " generally indicates that the preceding and following related objects have an "or" relationship.

[0031] In this application, "at least one" means one or more, and "more than one" means two or more. "At least one of the following" or similar expressions refer to any combination of these items, including any combination of single or multiple items. For example, "at least one of a, b, or c", or "at least one of a, b, and c", can both mean: a, b, c, ab (i.e., a and b), ac, bc, or abc, where a, b, and c can be single or multiple.

[0032] It should be understood that in the various embodiments of this application, the order of the above processes does not imply the order of execution. Some or all steps may be executed in parallel or sequentially. The execution order of each process should be determined by its function and internal logic, and should not constitute any limitation on the implementation process of the embodiments of this application.

[0033] The terminology used in the embodiments of this application is for the purpose of describing particular embodiments only and is not intended to be limiting of this application. The singular forms “a,” “the,” and “the” used in the embodiments of this application and the appended claims are also intended to include the plural forms unless the context clearly indicates otherwise.

[0034] The weights of the relevant components mentioned in the embodiments of this application can refer not only to the specific content of each component, but also to the proportional relationship between the weights of the components. Therefore, any scaling up or down of the content of the relevant components according to the embodiments of this application is within the scope disclosed in the embodiments of this application. Specifically, the mass described in the embodiments of this application can be a mass unit known in the chemical industry, such as μg, mg, g, or kg.

[0035] The terms "first" and "second" are used for descriptive purposes only, to distinguish objects, such as substances, from one another, and should not be construed as indicating or implying relative importance or implicitly specifying the number of technical features indicated. For example, without departing from the scope of the embodiments of this application, "first XX" may also be referred to as "second XX," and similarly, "second XX" may also be referred to as "first XX." Thus, features defined with "first" and "second" may explicitly or implicitly include one or more of that feature.

[0036] The first aspect of this application provides a strain of dark-colored septate endophytic fungus, namely, the dark-colored septate endophytic fungus strain YMF1.068, with the depositary name of dark-colored septate endophytic fungus (Paraphoma vinacea), deposited at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, on May 20, 2024; with the accession number CGMCC No. 41305.

[0037] In some embodiments, the ITS gene sequence of the dark-colored septate endophytic fungal strain is the nucleotide sequence shown in SEQ ID No. 1.

[0038] The second aspect of this application provides a dark-colored septate endophytic fungal agent prepared from a strain of dark-colored septate endophytic fungi.

[0039] In some embodiments, the active ingredient is at least one of the following (a), (b), and (c):

[0040] (a) Fermentation culture of dark-colored septate endophytic fungi;

[0041] (b) The resulting suspension of dark-colored septate endophytic fungi spores;

[0042] (c) The obtained dark-colored septate endophytic fungal cells were lysed by ultrasound and precipitated.

[0043] The third aspect of this application provides a method for preparing a dark-colored, septate endophytic fungal inoculant, comprising the following steps:

[0044] (1) YMF1.068 strain in vitro slant seed culture: The strain was inoculated onto the slant of PDA medium and cultured at 28℃ for 5 days to obtain slant seeds;

[0045] (2) Liquid seed culture of YMF1.068 strain: The slant seed was inoculated into an Erlenmeyer flask containing PDB medium and cultured on a shaker at 28℃ and 150rpm for 4 days to obtain liquid seed.

[0046] (3) Large-scale culture of YMF1.068 strain in fermenter: Liquid seed was inoculated into a fermenter containing PDB medium at a volume ratio of 5%. The culture conditions in a 1000-liter fermenter were controlled as follows: temperature 28℃, stirring speed 120-180rpm, fermentation time 72-96 hours.

[0047] (4) Preparation of YMF1.068 inoculant: Microbial cells and their metabolites obtained by fermentation in a fermenter are mixed with an appropriate amount of diatomaceous earth and dried or air-dried at a temperature below 65°C until the moisture content is less than 5%. After pulverization, a dark-colored septate endophytic fungal inoculant is obtained.

[0048] The application of the dark-colored septate endophytic fungal strains or dark-colored septate endophytic fungal agents provided in the fourth aspect of this application in the preparation of agents for the prevention and control of root-knot nematode disease.

[0049] The present invention will be further described in detail below with reference to the embodiments. The microbial inoculants in the embodiments are prepared according to conventional methods of microbial fermentation and conventional methods of microbial inoculant preparation.

[0050] Example 1

[0051] 1. Cultivation and preparation of the YMF1.068 strain in this invention

[0052] YMF1.068 strain in vitro slant seed culture: The strain was inoculated onto PDA medium slant and cultured at 28℃ for 5 days to obtain slant seeds.

[0053] Liquid seed culture of YMF1.068 strain: The slant seed was inoculated into an Erlenmeyer flask containing PDB medium and cultured on a shaker at 28℃ and 150rpm for 4 days to obtain liquid seed.

[0054] Large-scale fermentation of YMF1.068 strain: Liquid seed was inoculated into a fermenter containing PDB medium at a ratio of 5% (V / V). The culture conditions in a 1000-liter fermenter were controlled as follows: temperature 28℃, stirring speed 120-180 rpm, fermentation time 72-96 hours.

[0055] Strain YMF1.068 was cultured on PDA medium at 28°C for 5 days. Colonies were 6.7 cm in diameter, with a grayish-white, fluffy surface and neat edges; the reverse side was dark brown. Substrate hyphae were brown, while aerial hyphae were white. The hyphae were septate and could form "micro-sclerotia" structures within plant root cells and intercellular spaces. PDA medium was used for solid-state culture, and PDB medium was used for liquid culture. Strain YMF1.068 was amplified by PCR using universal ITS primers. The obtained ITS sequence, serial number PQ459953, is available in the GeneBank database and is the main molecular characteristic for identifying this strain.

[0056] The ITS nucleotide sequence of Paraphoma vinacea YMF1.068 is as follows:

[0057] ATCTCGCCTCTCCGTTCTGCCTGTATTCTACCCTTGTTTGTCATATACTATTATTTCCTCGGCAGGCTTGCCTGCCGAGTGAAACCATTTATAACCTTTTTAATTTTCAATCAGCGTCTGAAAAAAATTAATAATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTT TGAACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCTTCAAGCTTTGCTTGGTGTTGGGTGTTTGTCCCGCGGGACTCGCCTTAAAGTAATTGGCAGCCAGTGTTTGGTTTTGAAGCGCAGCACAAGTCGCGATTCAAGGCTACACGCCCGCTTCCACAAGCCTTTTTTCACTTTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATC

[0058] Preparation of YMF1.068 inoculum: Microbial cells and their metabolites obtained from fermentation tank culture are mixed with an appropriate amount of diatomaceous earth, dried at below 65℃ or air-dried until the moisture content is less than 5%, and then pulverized. The viable count of YMF1.068 strain in the inoculum must be maintained at 1×10⁻⁶. 8 CFU / g or higher.

[0059] Experimental Example 1

[0060] Lethal activity of YMF1.068 culture against second instar (J2) larvae of root-knot nematodes.

[0061] 1) Preparation of J2

[0062] Tomato roots infected with southern root-knot nematodes were washed with sterile water. Oocysts of the root-knot nematodes were picked from the root nodules with a dissecting needle and placed in a 5ml centrifuge tube. The oocysts were lysed with 0.1% NaClO solution for 5 minutes. The NaClO solution was removed by centrifugation and the oocysts were washed three times with sterile water. The obtained eggs were placed in sterile water and incubated at 25℃ for 4-6 days. J2 was then collected by centrifugation.

[0063] 2) Preparation of YMF1.068 strain culture

[0064] The liquid seed was inoculated into an Erlenmeyer flask containing PDB medium at a ratio of 5% (V / V) and cultured for 4 days in a shaker at 28°C and 150 rpm.

[0065] 3) Activity assay

[0066] Add 1.9 ml of the above culture to a sterile culture dish with a diameter of 3.5 cm, then add 0.1 ml of nematode suspension containing more than 200 J2 worms, mix well, and let stand at room temperature. Use an equal volume of PDB medium as a control for YMF1.068 strain culture, with three replicates for each treatment. At 24 h, 48 h, and 96 h of standing, count the number of dead J2 worms under a dissecting microscope, and calculate the J2 mortality rate and corrected mortality rate using the following formula.

[0067] Mortality rate (%) = (Number of surviving J2s / Total number of J2s counted) × 100

[0068] Corrected mortality rate (%) = (treatment group mortality rate - control mortality rate) / (1 - control mortality rate) × 100

[0069] The results showed that the YMF1.068 strain culture exhibited extremely strong lethal activity against root-knot nematode J2, with corrected mortality rates of 84.67%, 93.75%, and 95.62% against J2 at 24h, 48h, and 96h, respectively.

[0070] Experimental Example 2

[0071] Field control efficacy of YMF1.068 inoculant against tomato root-knot nematode disease

[0072] Experimental location: Greenhouse of the Tropical Zone Research Institute of Yunnan Academy of Agricultural Sciences, Yuanmou County, Yunnan Province.

[0073] Experimental crop: Tomato (variety: Fendu-80).

[0074] Test reagent: YMF1.068 bacterial agent, viable count of 2×10⁻⁶. 9 1 / gram, prepared according to the method described above in this invention; 5% abamectin emulsifiable concentrate (Hebei Weiyuan Biochemical Co., Ltd.).

[0075] Experimental method: Three treatments were set up, with three replicates for each treatment and 120 tomato plants per replicate.

[0076] Treatment 1: The dosage of YMF1.068 inoculant is 2.5 kg / mu. At the time of transplanting, dissolve 1 kg of inoculant in about 100 kg of water, mix well, and soak the roots of the tomato seedlings in the solution for about 10 minutes before transplanting. 20 days after transplanting, dissolve 1.5 kg of inoculant in 500 kg of water, stir well, and then drench the roots of each plant with 200 ml of the solution.

[0077] Treatment 2: 5% abamectin EC, diluted 1000 times, drench the roots with 200 ml / plant.

[0078] Treatment 3: Blank control without the application of any nematicides.

[0079] Investigation and statistical methods: 180 days after transplanting, the root nodule disease severity index of the plants was investigated (Grade 0: no root nodules; Grade 1: 1-20% of the root system has root nodules; Grade 2: 21-40% of the root system has root nodules; Grade 3: 41-60% of the root system has root nodules; Grade 4: 61-80% of the root system has root nodules; Grade 5: 81-100% of the root system has root nodules). The disease index and control efficacy were calculated using the following formula:

[0080] Disease index (%) = [(n1×1+n2×2+n3×3+n4×4+n5×5) / (S×5)]×100, where n1-n5 represent the total number of plants corresponding to root nodule disease grades 1-5, and S represents the total number of plants surveyed.

[0081] Efficacy (%) = 100 × (1 - x / y), where x and y represent the disease index of the treatment and the blank control, respectively.

[0082] Experimental Results: Table 1 shows that the control efficacy of 2.5 kg / mu of YMF1.068 microbial agent against tomato root-knot nematodes reached 68.72%, although significantly lower than that of 5% abamectin EC (75.85%). However, YMF1.068 microbial agent is a biological pesticide, safe for humans, livestock, and the environment, and therefore has good application prospects. The control efficacy of YMF1.068 microbial agent against tomato root-knot nematodes is shown in Table 1.

[0083] Table 1

[0084]

[0085] Experimental Example 3

[0086] Field control efficacy of YMF1.068 inoculant against cucumber root-knot nematode disease

[0087] Experiment location: Vegetable greenhouse in Huanian Town, Yuxi City, Yunnan Province.

[0088] Experimental crop: cucumber (variety: Zhongnong 203).

[0089] Test reagent: YMF1.068 bacterial agent, viable count of 2×10⁻⁶. 9 1 / gram, prepared according to the above method of the present invention; , prepared according to the above method of the present invention; 5% abamectin emulsifiable concentrate (Hebei Weiyuan Biochemical Co., Ltd.).

[0090] Experimental method: Three treatments were set up, with three replicates for each treatment and 120 cucumber plants per replicate.

[0091] Treatment 1: The dosage of YMF1.068 inoculant is 2.5 kg / mu. At the time of transplanting, dissolve 1 kg of inoculant in about 100 kg of water, mix well, and soak the roots of cucumber seedlings in the solution for about 10 minutes before transplanting. 20 days after transplanting, dissolve 1.5 kg of inoculant in 500 kg of water, stir well, and then drench the roots of each seedling with 200 ml of the solution.

[0092] Treatment 2: 5% abamectin EC, diluted 1000 times, drench the roots with 200 ml / plant.

[0093] Treatment 3: Blank control without the application of any nematicides.

[0094] Investigation and statistical methods: 180 days after transplanting, the root nodule disease severity index of the plants was investigated (Grade 0: no root nodules; Grade 1: 1-20% of the root system has root nodules; Grade 2: 21-40% of the root system has root nodules; Grade 3: 41-60% of the root system has root nodules; Grade 4: 61-80% of the root system has root nodules; Grade 5: 81-100% of the root system has root nodules). The disease index and control efficacy were calculated using the following formula:

[0095] Disease index (%) = [(n1×1+n2×2+n3×3+n4×4+n5×5) / (S×5)]×100, where n1-n5 represent the total number of plants corresponding to root nodule disease grades 1-5, and S represents the total number of plants surveyed.

[0096] Efficacy (%) = 100 × (1 - x / y), where x and y represent the disease index of the treatment and the blank control, respectively.

[0097] Experimental results: Table 2 shows that the control efficacy of 2.5 kg / mu of YMF1.068 inoculant against cucumber root-knot nematodes is as high as 73.2%, which is comparable to the control efficacy of 5% abamectin EC (72.4%). The control efficacy of YMF1.068 inoculant against cucumber root-knot nematodes is shown in Table 2:

[0098] Table 2

[0099]

[0100] Test Example 4

[0101] The efficacy of YMF1.068 microbial agent in controlling tobacco root-knot nematodes

[0102] Test location: Eshan County, Yuxi City, Yunnan Province.

[0103] Experimental crop: Tobacco (variety: K326).

[0104] Test reagent: YMF1.068 bacterial agent, viable count of 2×10⁻⁶. 91 / gram, prepared according to the above method of the present invention; , prepared according to the above method of the present invention; 5% abamectin emulsifiable concentrate (Hebei Weiyuan Biochemical Co., Ltd.).

[0105] Experimental method: Three treatments were set up, with three replicates for each treatment and 120 tobacco plants per replicate.

[0106] Treatment 1: The dosage of YMF1.068 inoculant is 2.5 kg / mu. At the time of transplanting, dissolve 1 kg of inoculant in about 100 kg of water, mix well, and soak the roots of the tobacco seedlings in the solution for about 10 minutes before transplanting. 20 days after transplanting, dissolve 1.5 kg of inoculant in 500 kg of water, stir well, and then drench the roots of each seedling with 200 ml of the solution.

[0107] Treatment 2: 5% abamectin EC, diluted 1000 times, drench the roots with 200 ml / plant.

[0108] Treatment 3: Blank control without the application of any nematicides.

[0109] Investigation and statistical methods: 180 days after transplanting, the root nodule disease severity index of the plants was investigated (Grade 0: no root nodules; Grade 1: 1-20% of the root system has root nodules; Grade 2: 21-40% of the root system has root nodules; Grade 3: 41-60% of the root system has root nodules; Grade 4: 61-80% of the root system has root nodules; Grade 5: 81-100% of the root system has root nodules). The disease index and control efficacy were calculated using the following formula:

[0110] Disease index (%) = [(n1×1+n2×2+n3×3+n4×4+n5×5) / (S×5)]×100, where n1-n5 represent the total number of plants corresponding to root nodule disease grades 1-5, and S represents the total number of plants surveyed.

[0111] Efficacy (%) = 100 × (1 - x / y), where x and y represent the disease index of the treatment and the blank control, respectively.

[0112] Experimental results: Table 3 shows that applying 2.5 kg of YMF1.068 microbial agent per mu (approximately 0.067 hectares) achieved a control efficacy of up to 70.52% against tobacco root-knot nematodes, comparable to the control efficacy of applying 5% abamectin EC (71.55%). The control efficacy of YMF1.068 microbial agent against tobacco root-knot nematodes is shown in Table 3.

[0113] Table 3

[0114]

[0115] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely illustrative of the principles of the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope. The scope of protection of the present invention is defined by the appended claims, specification, and their equivalents.

Claims

1. A strain of *Heterostilbene burgundy* ( Paraphoma vinacea YMF1.068, characterized in that: This bacterium has been deposited at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing. The deposit date is May 20, 2024, and the accession number is CGMCC No. 41305.

2. The *Pyrophorus burgundy* strain according to claim 1, characterized in that: The ITS gene sequence of the *Heterostigma burgundy* strain is the nucleotide sequence shown in SEQ ID No.

1.

3. The wine-red heterostem mold agent prepared according to claim 1.

4. The burgundy stem spot fungicide according to claim 3, wherein the active ingredient is at least one of the following (a), (b), and (c): (a) The fermentation culture of *Pyrodactylus burgundy* as described in claim 1; (b) The spore suspension of *Impatiens rubrum* obtained according to claim 1; (c) The ultrasonic lysis and precipitation of the wine-red styrax cells obtained in claim 1.

5. The preparation method of the burgundy stem spot fungicide according to claim 3, characterized in that... Includes the following steps: (1) YMF1.068 strain test tube slant seed culture: The strain described in claim 1 was inoculated onto a PDA medium slant and cultured at 28°C for 5 days to obtain slant seeds; (2) Liquid seed culture of YMF1.068 strain: The slant seed was inoculated into an Erlenmeyer flask containing PDB medium and cultured on a shaker at 28℃ and 150 rpm for 4 days to obtain liquid seed; (3) Large-scale culture of YMF1.068 strain in fermenter: The liquid seed was inoculated into a fermenter containing PDB medium at a volume ratio of 5%. The culture conditions in the 1000-liter fermenter were controlled as follows: temperature 28℃, stirring speed 120-180 rpm, fermentation time 72-96 hours. (4) Preparation of YMF1.068 microbial agent: The microbial cells and their metabolites obtained by fermentation in a fermenter are mixed with an appropriate amount of diatomaceous earth and dried or air-dried at below 65°C until the moisture content is less than 5%. After pulverization, wine red heterostem mold agent is obtained.

6. The use of the *Heterophyllum rubrum* strain according to claim 1 or the *Heterophyllum rubrum* agent according to claim 3 in the preparation of a formulation for the control of root-knot nematode disease.

Citation Information

Patent Citations

  • AMF+DSE combined fungicide and application thereof in preparing preparation for promoting cucumber growth and resisting root-knot nematode

    CN104877913A

  • Bacillus siamensis, microbial agent and application of bacillus siamensis

    CN116083328A