Micrococcus luteus ZCP35-EB240159 with urease activity and application of micrococcus luteus ZCP35-EB240159

Abstract

The invention provides micrococcus luteus ZCP35-EB240159 with urease activity and application of the micrococcus luteus ZCP35-EB240159, and belongs to the technical field of marine microorganisms. The micrococcus luteus ZCP35-EB240159 disclosed by the invention is preserved in the Guangdong Microbial Culture Collection Center, the preservation number is GDMCC No: 65176, the preservation date is September 23, 2024, and the preservation address is the 5th building, No. 59 building, No. 100 Courtyard, Xianlie Middle Road, Guangzhou. The micrococcus luteus ZCP35-EB240159 has urease activity, the urease activity is 35.342 U / mL, urea in seawater can be decomposed into ammonia nitrogen to be utilized by eucheuma gelatinae, the micrococcus luteus ZCP35-EB240159 has a good growth promoting effect on the eucheuma gelatinae, the stress resistance of the eucheuma gelatinae under urea stress can be improved, and the micrococcus luteus ZCP35-EB240159 has high application value and is suitable for large-scale popularization and application.

Description

Technical Field

[0001] The invention relates to the technical field of marine microorganisms, and in particular to a strain of Micrococcus luteus ZCP35-EB240159 with urease activity and an application thereof. Background Art

[0002] Betaphycus gelatinum is a red algae edible seaweed, widely cultivated and eaten in Southeast Asia. It has a crispy taste and high nutritional value. It contains a variety of trace elements required by the human body and rich proteins, vitamins and carbohydrates. Now, with the increasing demand for ecological and healthy food, the cultivation and sales of Betaphycus gelatinum are attracting more and more attention.

[0003] Eucheuma requires nitrogen in its growth process and can absorb and fix nitrogen and phosphorus nutrients. In marine aquaculture, Eucheuma can reduce the concentration of nitrogen, phosphorus and other nutrients in seawater, which helps to purify seawater. The nitrogen form that can be used by Eucheuma is NH4 + and NO3 - , studies have shown that when the nitrate concentration is lower than the level required to maintain the growth of seaweed, urea in the marine environment can be used as a nitrogen source to maintain the growth of seaweed, because certain microorganisms attached to seaweed convert dissolved organic nitrogen into available inorganic nitrogen for seaweed absorption by hydrolyzing urea. Therefore, when dealing with nitrogen nutrient deficiency, urease produced by marine organisms themselves and their attached microorganisms plays a very important role in regulating the marine nitrogen cycle and maintaining the growth of organisms. However, due to the large number of marine microorganisms, it is particularly necessary to isolate microorganisms with urease activity and apply them. Summary of the invention

[0004] The purpose of the present invention is to provide a strain of Micrococcus luteus ZCP35-EB240159 with urease activity and application thereof.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] The present invention provides a strain of Micrococcus luteus ZCP35-EB240159 having urease activity, which is deposited in Guangdong Microbial Culture Collection Center with a deposit number of GDMCC No: 65176, a deposit date of September 23, 2024, and a deposit address of 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

[0007] The invention provides a method for preparing the bacterial liquid of Micrococcus luteus ZCP35-EB240159. The method comprises inoculating the Micrococcus luteus ZCP35-EB240159 into a fermentation medium for fermentation culture to obtain the bacterial liquid.

[0008] Preferably, the fermentation temperature is 25-28° C., the fermentation speed is 140-160 rpm, and the fermentation time is 23-25 ​​h.

[0009] The present invention also provides the use of the Micrococcus luteus ZCP35-EB240159 in all or part of the following (1) to (7):

[0010] (1) Application in the preparation of urease;

[0011] (2) Application in promoting the conversion of organic nitrogen sources to inorganic nitrogen sources;

[0012] (3) Application in promoting the growth of Eucheuma chinensis;

[0013] (4) Application in improving the resistance of Eucheuma to urea stress;

[0014] (5) Application in the preparation of bacterial agents that promote the conversion of organic nitrogen sources into nitrogen-free sources;

[0015] (6) Application in the preparation of a bacterial agent for promoting the growth of Eucheuma chinensis;

[0016] (7) Application in the preparation of a bacterial agent for improving the resistance of Eucheuma truncatula to urea stress.

[0017] Preferably, the organic nitrogen source comprises urea.

[0018] The invention also provides a method for improving the stress resistance of Eucheuma chinensis, wherein Eucheuma chinensis and the Micrococcus luteus ZCP35-EB240159 are co-cultured in an environment containing urea.

[0019] Preferably, the co-culture culture solution is a mixture of seawater and culture medium, the salinity of the culture solution is 28-32‰, and the culture solution contains urea, and the concentration of the urea is 75-85 mg / L.

[0020] Preferably, the bacterial solution of Eucheuma chinensis, the Micrococcus luteus ZCP35-EB240159 and the culture solution are mixed according to 5 g: 0.8-1.2 mL: 800-1200 mL, placed in the culture solution, and co-cultured; the bacterial solution concentration is 2-3×10 8 CFU / mL.

[0021] Preferably, the co-culture conditions are as follows: the light quantum flux density is 40 to 100 μmol / (m 2 ·s), the temperature is 25-28°C, and the light culture time is 10-14h / d.

[0022] By adopting the above technical scheme, the present invention has the following beneficial effects: the Micrococcus luteus ZCP35-EB240159 of the present invention has urease activity, and the urease activity is 35.342U / mL, and can decompose urea in seawater into ammonia nitrogen for use by Eucheuma chinensis, has a good growth-promoting effect on Eucheuma chinensis, and can also improve the stress resistance of Eucheuma chinensis under urea stress, and has a high application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 The left side shows the growth of the strain on urea agar chromogenic medium, and the right side shows the blank control.

[0024] Figure 2 This is a graph showing the changes in urea and ammonia nitrogen in the culture medium during 1 to 3 days of co-culture.

[0025] Figure 3 This is a graph showing the growth indicators of Eucheuma in each group after 21 days of co-cultivation.

[0026] Figure 4 This is a graph of the stress resistance indicators of Eucheuma japonicum in each group after 21 days of co-cultivation.

[0027] Figure 5 This is a photo of Eucheuma japonicum.

[0028] Biological Deposit Description

[0029] The Micrococcus luteus ZCP35-EB240159 provided by the present invention is deposited in the Guangdong Provincial Microbiological Culture Collection Center, with a deposit number of GDMCC No: 65176, a deposit date of September 23, 2024, and a deposit address of 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou. DETAILED DESCRIPTION

[0030] The present invention provides a strain of Micrococcus luteus ZCP35-EB240159 having urease activity, which is deposited in Guangdong Microbial Culture Collection Center with a deposit number of GDMCC No: 65176, a deposit date of September 23, 2024, and a deposit address of 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

[0031] The present invention also provides a method for preparing the bacterial liquid of Micrococcus luteus ZCP35-EB240159, wherein the Micrococcus luteus ZCP35-EB240159 is inoculated into a fermentation medium for fermentation culture to obtain the bacterial liquid; the fermentation culture temperature is 25 to 28°C, more preferably 26 to 27°C, and more preferably 26.5°C; the fermentation culture rotation speed is 140 to 160 rpm, and the fermentation culture time is 23 to 25 hours.

[0032] The present invention also provides the use of the Micrococcus luteus ZCP35-EB240159 in all or part of the following (1) to (7):

[0033] (1) Application in the preparation of urease;

[0034] (2) Application in promoting the conversion of organic nitrogen sources to inorganic nitrogen sources;

[0035] (3) Application in promoting the growth of Eucheuma chinensis;

[0036] (4) Application in improving the resistance of Eucheuma to urea stress;

[0037] (5) Application in the preparation of bacterial agents for promoting the conversion of organic nitrogen sources into inorganic nitrogen sources;

[0038] (6) Application in the preparation of a bacterial agent for promoting the growth of Eucheuma chinensis;

[0039] (7) Application in the preparation of a bacterial agent for improving the resistance of Eucheuma truncatula to urea stress.

[0040] Preferably, the organic nitrogen source includes but is not limited to urea.

[0041] The present invention also provides a method for improving the stress resistance of Eucheuma chinensis, wherein Eucheuma chinensis and the bacterial liquid of Micrococcus luteus ZCP35-EB240159 are co-cultured.

[0042] In the present invention, firstly, Eucheuma chinensis is taken, attachments on the surface of the algae are removed, and the algae are soaked in sterile seawater and then ultrasonically cleaned. Then, the Eucheuma chinensis is immersed in sterile seawater containing a mixed antibiotic solution to obtain sterile Eucheuma chinensis. The present invention preferably selects Eucheuma chinensis with vigorous growth, and then removes attachments on the surface of the algae, wherein the attachments on the surface of the algae include epiphytic microorganisms and sand particles loosely attached to the surface of the algae. After removing the attachments on the surface of the algae, the algae are soaked in sterile seawater, and the soaking time is 3 to 5 hours, more preferably 3.5 hours to 4.5 hours, and more preferably 4 hours. After soaking, ultrasonic cleaning is performed, and the power of the ultrasonic cleaning is 40 to 60 W, more preferably 45 to 55 hours, and more preferably 50 hours. The time of the ultrasonic cleaning is 8 to 12 minutes, more preferably 9 to 11 minutes, and more preferably 10 minutes. After ultrasonic cleaning, the Eucheuma truncatum is immersed in sterile seawater containing a mixed antibiotic solution, wherein the mixed antibiotics include ampicillin, streptomycin sulfate and kanamycin sulfate, and the final concentrations of ampicillin, streptomycin sulfate and kanamycin sulfate in sterile seawater are independently 0.4-0.6 g / L, further preferably 0.45-0.55 g / L, and more preferably 0.5 g / L; the immersion time is 23-25 ​​h, further preferably 23.5-24.5 h, and more preferably 24 h.

[0043] Then, Eucheuma agaricus and the bacterial solution of Micrococcus luteus ZCP35-EB240159 were co-cultured, wherein the bacterial solution concentration of Micrococcus luteus ZCP35-EB240159 was 2-3×10 8 CFU / mL, more preferably 2.2 to 2.8×10 8 CFU / mL, more preferably 2.5×10 8 CFU / mL; the mixing ratio of the bacterial solution of Eucheuma agaricus and Micrococcus luteus ZCP35-EB240159 and the culture solution is 5g:0.8~1.2mL:800~1200mL, more preferably 5g:0.9~1.1mL:900~1100mL, more preferably 5g:1mL:1000mL. The culture solution is a mixture of seawater and F / 2 culture medium, and the salinity of the culture solution is 28~32‰, more preferably 29~31‰, and more preferably 30‰. Urea is added to the culture solution, and the concentration of urea in the culture solution is 1~100mg / L, more preferably 50~90mg / L, and more preferably 80mg / L. The conditions for co-culture are: light quantum flux density 40~100μmol / (m 2 ·s), more preferably 70 to 90 μmol / (m 2 ·s), more preferably 80 μmol / (m 2·s); the temperature is 25-28°C, more preferably 26-27°C, and more preferably 26.5°C; the culture includes light culture and dark culture, and the light culture time is 10-14h / d, more preferably 11-13h, and more preferably 12h. During the culture process, 1 / 2 of the total volume of the culture solution is replaced every 2-3d, and after the culture solution is replaced, a corresponding volume of bacterial solution and a corresponding concentration of urea are added.

[0044] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0045] Example 1 Isolation and Identification of Micrococcus luteus ZCP35-EB240159

[0046] Eucheuma truncatum was collected in Haiwei Town, Changjiang City, Hainan Province. The collected Eucheuma truncatum was washed three times with sterile seawater to remove epiphytic microorganisms, sand particles and other attachments loosely attached to the surface of the algae. The epiphytic bacteria firmly attached to the algae were repeatedly wiped with a sterile cotton swab, and then the cotton swab was spread on a modified marine agar 2216E (2% Eucheuma truncatum homogenate and 0.2% glucose were added to the standard 2216E formula) plate for bacterial separation and purification. The purified bacteria were initially screened using urea agar colorimetric medium. If the color of the culture medium changed from light orange to pink or purple-red, the isolate was preliminarily identified as positive for urease activity. A urease-producing strain was screened out using urea agar colorimetric medium, and the color of the culture medium changed from orange to purple-red ( Figure 1 ), and the strain was numbered ZCP35-EB240159.

[0047] Strain rescreening: PCR amplification of the primary screening strains was performed using urease gene (ureC) amplification primers. A clear band was found at 400 bp of the target product, and the amplified product was sent for sequencing. The rescreened strains with urease gene were subjected to 16S rDNA molecular identification.

[0048] The genomic DNA of Micrococcus luteus ZCP35-EB240159 was extracted using a bacterial DNA extraction kit (Guangzhou Meiji Biotechnology Co., Ltd.). The genomic DNA of the strain was used as a template, and the urease gene (ureC) of the strain ZCP35-EB240159 was amplified using the forward primer L2F: 5'-ATHGGYAARGCNGGNAAYCC-3' (SEQ ID NO.1) and the reverse primer L2R: 5'-GTBSHNCCCCARTCYTCRTG-3' (SEQ ID NO.2). The amplification system was: 2 μL DNA template, 1 μL of upstream and downstream primers each, 12.5 μL of 2*FlashPCR MasterMix, and ddH2O was supplemented to 25 μL. The amplification program was: pre-denaturation at 98°C for 2 min, denaturation at 94°C for 10 s, annealing at 55°C for 15 s, extension at 72°C for 15 s (10 s / kb), and final extension at 72°C for 1 min, for 33 cycles. The urease gene (ureC) nucleotide sequence obtained by amplification is shown in SEQ ID NO.3, and the amplified fragment size is 367 bp:

[0049] TTTGGCAATGTGATATCCATTGGTAGTACAACTGATATTATTTCTGCAGAAGGGAAAATCGTAACAGCTGGTGGTATTGATACTCATGTTCACTTTATCAATCCTGAGCAAGCAGAAGTCGCATTAGAAAGCGGTATTACAACACATATCGGTGGTGGTACTGGTGCTTCAGAAGGTGCAAA AGCAACAACTGTAACCCCTGGTCCTTGGCATATACATCGTATGTTAGAAGCTGCAGAAGCATTACCTATCAATGTTGGTTTTACAGGTAAAGGACAAGCAGTCAATCACACAGCACTTATCGAACAAATCCATGCTGGTGTTATTGGTTTAAAAGTTCATGAAGACTGGGGGCACCACCACAA.

[0050] The 16S rDNA gene of strain ZCP35-EB240159 was unidirectionally amplified using 27F / 1492R universal primers: upstream primer 27F: 5'-AGAGTTTGATCA( / C)TGGCTCAG-3' (SEQ ID NO.4), downstream primer 1492R: 5'-TACGGC( / T)TACCTTGTTACGACTT-3' (SEQ ID NO.5). The amplification system was: 2 μL DNA template, 1 μL each of upstream and downstream primers, 12.5 μL of 2*Flash PCR MasterMix, and ddH2O supplemented to 25 μL. The amplification program was: pre-denaturation at 98°C for 2 min, denaturation at 94°C for 10 s, annealing at 55°C for 15 s, extension at 72°C for 15 s (10 s / kb), final extension at 72°C for 1 min, and 33 cycles. The 16S rDNA (27F unidirectional sequencing) nucleotide sequence of strain ZCP35-EB240159 is shown in SEQ ID NO.6:

[0051]

[0052] The size of the amplified fragment is 1176bp. The 16S rDNA sequence of the strain is most similar to that of the strain Micrococcus luteus, with a homology of 98.12%. The strain has a close relationship and the same taxonomic status. Therefore, it can be determined that the strain belongs to the phylum Actinobacteria, class Actinomycetia, order Micrococcales, family Micrococcaceae, genus Micrococcus, and Micrococcus luteus.

[0053] Example 2 Determination of urease activity of Micrococcus luteus ZCP35-EB240159

[0054] The urease activity was determined by the Berthelot reaction colorimetric method. The specific steps are as follows:

[0055] Urease-producing bacteria contain 0.005% Ni 2+ (nickel nitrate, inducing urease production) 2216E liquid medium, 28 ° C, 150rpm culture for 24h; after culturing for 24h, the bacterial solution was centrifuged at 8000rpm for 10min, and the supernatant was discarded; the bacteria were resuspended with 5mL PBS buffer, placed on ice for ultrasonic disruption for 3min (300W, 4s / 4s); after ultrasonication, centrifuged at 4 ° C, 14000rpm for 5min, and the supernatant was collected, which was the crude enzyme solution of the bacteria;

[0056] Preparation of nitrogen standard stock solution and working solution:

[0057] a. Nitrogen standard stock solution (800 mg / L): Weigh 0.08 g NH4Cl, dissolve it in a small amount of water, transfer the entire amount to a 100 mL volumetric flask, dilute to the mark with water, mix well, and store at low temperature.

[0058] b. Nitrogen standard working solution (8 mg / L): Pipette 1 mL of nitrogen standard stock solution into a 100 mL volumetric flask and dilute to the mark with water. Mix well and use immediately.

[0059] The reaction solution required for drawing the nitrogen standard curve is prepared according to Table 1:

[0060] Table 1 Preparation of reaction solution for drawing nitrogen standard curve

[0061] <![CDATA[Standard solution concentration / mg·L -1 > 0 0.4 1.2 2.0 2.8 3.6 4.4 5.2 Standard use volume / mL 0 0.1 0.3 0.5 0.7 0.9 1.1 1.3 <![CDATA[DdH2O / mL]]> 2.0 1.9 1.7 1.5 1.3 1.1 0.9 0.7 Sodium phenolate solution / mL 0.4 0.4 0.4 0.4 0.4 0.4 0.4 0.4 Sodium hypochlorite solution / mL 0.3 0.3 0.3 0.3 0.3 0.3 0.3 0.3

[0062] ① Place the above reaction solution in a 40℃ water bath and incubate for 20 minutes;

[0063] ② After the color development is stabilized, the absorbance of the reaction solution is measured at a wavelength of 578 nm, and a standard curve is drawn with the nitrogen solution concentration as the horizontal axis and the absorbance value as the vertical axis.

[0064] Determination of urease activity in crude enzyme solution:

[0065] The urease activity was determined by the Berthelot reaction colorimetric method (Creno et al., 1970). The specific steps are as follows:

[0066] ① Take 2.5mL 10% urea solution and 5mL PBS buffer, mix thoroughly and add 10μL crude enzyme solution;

[0067] ② Place the above reaction solution in a 40℃ water bath and incubate for 20 minutes;

[0068] ③After incubation, aspirate 50 μL of the reaction solution and add 0.4 mL of sodium phenol solution. Mix well, then add 0.3 mL of 0.9% sodium hypochlorite solution. Mix well and place in a 40°C water bath for 20 min.

[0069] ④ Within 1 hour, take 250 μL of the reaction solution after color development and stabilization and measure the absorbance at a wavelength of 578 nm (for the blank control, replace the crude enzyme solution with an equal volume of PBS buffer and perform the same operation);

[0070] ⑤ Definition of enzyme activity U: 1U equals to 1μmol NH released after 1mg crude enzyme solution reacts for 1min at 40℃ 3+ .

[0071] The urease activity of strain EB240159 was determined to be 35.342 U / mL.

[0072] Example 3 Growth-promoting effect of Micrococcus luteus ZCP35-EB240159 on Eucheuma chinensis

[0073] Take 5g of vigorously growing Eucheuma chinensis, remove the epiphytic microorganisms, sand and other attachments loosely attached to the surface of the algae, soak it in 1L sterile seawater for 4h, and perform ultrasonic cleaning for 10min (50W, 5s / 5s). Then, soak the Eucheuma chinensis in 1L sterile seawater containing a mixed antibiotic solution (final concentrations of ampicillin, streptomycin sulfate, and kanamycin sulfate were 0.5g / L, respectively) for 24h.

[0074] Micrococcus luteus ZCP35-EB240159 was inoculated into liquid 2216E medium and cultured at 28°C and 150 rpm until the strain concentration reached 2.5×10 8 CFU / mL.

[0075] Eucheuma agaricus and Micrococcus luteus ZCP35-EB240159 were mixed and co-cultured. The co-culture culture medium was prepared by adding sterile seawater to F / 2 culture medium. Culture conditions: light quantum flux density 80 μmol / (m 2 ·s), temperature 27℃, salinity 31‰, pH=8.2, photoperiod: light culture 12h / dark culture 12h, replace 1 / 2 of the total volume of culture medium every 3d, add corresponding volume of bacterial liquid and corresponding concentration of urea after replacing the culture medium, detect relevant indicators after 21d of culture, the experiment is divided into 3 groups: G1-G3, each group has 4 parallel experiments, the experimental settings are shown in Table 1.

[0076] Table 1 Experimental settings

[0077] Group G1 G2 G3 Sterile sea water 1 1 1 Eucheuma chinensis(g) 5 5 5 Urea(mg / L) 80 80 / Bacterial liquid (mL) / 1 /

[0078] Urea and ammonia nitrogen values ​​in the culture medium were detected on the 1st to 3rd day of co-cultivation. Urea was detected using a urea detection kit (Beijing Solebold Technology Co., Ltd.), and ammonia nitrogen was detected using a Lovibond SpectroDirect multi-parameter water quality spectrophotometer and ammonia nitrogen consumption reagent (purchased from the Lovibond official website, item number 535600). The results are as follows: Figure 2 As shown. Figure 2 It can be seen that from the second day, the urea value of G2 group was significantly lower than that of G1 group ( Figure 2 a), the ammonia nitrogen value of G2 group was significantly higher than that of G1 and G3 groups ( Figure 2 b) in the figure indicates that Micrococcus luteus ZCP35-EB240159 can effectively convert urea in the water into ammonia nitrogen for absorption and utilization by algae.

[0079] After 21 days of co-cultivation, the contents of chlorophyll, carotenoids, phycocyanin, phycoerythrin, and other growth indicators of Eucheuma chinensis were determined. Figure 3 The results showed that the carotenoid content in the G2 group was significantly higher than that in the G1 group ( Figure 3 b), there was no significant difference in chlorophyll a, phycoerythrin and phycocyanin among the three experimental groups ( Figure 3 a in Figure 3 c and Figure 3 d), the weight gain rate and specific growth rate of the G2 group after co-culture with the urease-producing bacteria EB240159 for 21 days were significantly higher than those of the G1 group and G3 group without the strain ( Figure 3 e in Figure 3 f) in the figure indicates that the co-cultivation of urease-producing bacteria EB240159 and Eucheuma chinensis can significantly promote the growth of Eucheuma chinensis.

[0080] Fv / Fm is the maximum photochemical efficiency and is an important indicator for measuring the light energy conversion efficiency of the PSII reaction center. When subjected to external environmental stress, the Fv / Fm value will drop significantly, which can directly reflect the degree of stress on the algae. Various antioxidant substances and antioxidant enzymes in plants constitute the total antioxidant capacity (T-AOC). After suffering a certain degree of stress, the body adjusts its own antioxidant system to increase the T-AOC content, thereby enhancing its adaptability to the environment. Superoxide dismutase (SOD) is an important resistance enzyme in plants that can remove free radicals in the body and reduce the damage of free radicals to the body. Low plant malondialdehyde (MDA) content means that the plant has strong antioxidant properties and can better resist external pressure.

[0081] After 21 days of cultivation, the Fv / Fm value, T-AOC content, SOD content, MDA content and other related stress resistance indicators of Eucheuma were determined. Figure 4 shown. Figure 4 The results showed that the Fv / Fm value, T-AOC content and SOD content of G2 group were not significantly different from those of G1 and G3 groups ( Figure 4 a in Figure 4 b and Figure 4 c), the MDA content in G1 and G2 groups was significantly lower than that in G3 group ( Figure 4 d) in the figure indicates that the addition of Micrococcus luteus ZCP35-EB240159 is harmless to Eucheuma chinensis and improves its stress resistance.

[0082] From the above examples, it can be seen that the present invention provides a strain of Micrococcus luteus ZCP35-EB240159 having urease activity and its application. The Micrococcus luteus ZCP35-EB240159 of the present invention has urease activity, can decompose urea in seawater into ammonia nitrogen for use by Eucheuma truncatum, has a good growth-promoting effect on Eucheuma truncatum, and can also improve the stress resistance of Eucheuma truncatum under urea stress.

[0083] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A strain of Micrococcus luteus ZCP35-EB240159 having urease activity, characterized in that: It is deposited in Guangdong Provincial Microbiological Culture Collection Center, with the deposit number GDMCC No: 65176, the deposit date is September 23, 2024, and the deposit address is 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

2. The method for preparing the bacterial solution of Micrococcus luteus ZCP35-EB240159 according to claim 1, characterized in that: The Micrococcus luteus ZCP35-EB240159 is inoculated into a fermentation medium for fermentation culture to obtain a bacterial liquid.

3. The preparation method according to claim 2, characterized in that: The fermentation temperature is 25-28° C., the fermentation speed is 140-160 rpm, and the fermentation time is 23-25 ​​h.

4. Use of the Micrococcus luteus ZCP35-EB240159 of claim 1 in all or part of the following (1) to (7): (1) Application in the preparation of urease; (2) Application in promoting the conversion of organic nitrogen sources to inorganic nitrogen sources; (3) Application in promoting the growth of Eucheuma chinensis; (4) Application in improving the resistance of Eucheuma to urea stress; (5) Application in the preparation of bacterial agents for promoting the conversion of organic nitrogen sources into inorganic nitrogen sources; (6) Application in the preparation of a bacterial agent for promoting the growth of Eucheuma chinensis; (7) Application in the preparation of a bacterial agent for improving the resistance of Eucheuma to urea stress.

5. The use according to claim 4, characterized in that: The organic nitrogen source includes urea.

6. A method for improving the resistance of Eucheuma to urea stress, characterized in that: The Eucheuma agaricus and the Micrococcus luteus ZCP35-EB240159 described in claim 1 are co-cultured in an environment containing urea.

7. The method according to claim 6, characterized in that The co-cultured culture solution is a mixture of seawater and culture medium, the salinity of the culture solution is 28-32‰, and the culture solution contains urea, and the concentration of the urea is 75-85 mg / L.

8. The method according to claim 6, characterized in that The Eucheuma australis, the bacterial solution of Micrococcus luteus ZCP35-EB240159 and the culture solution were mixed in the ratio of 5 g: 0.8-1.2 mL: 800-1200 mL, placed in the culture solution for co-culture; the bacterial solution concentration was 2-3×10 8 CFU / mL.

9. The method according to claim 8, characterized in that The co-culture conditions are as follows: the light quantum flux density is 40-100 μmol / (m 2 ·s), the temperature is 25-28°C, and the light culture time is 10-14h / d.

Images