An α-L-rhamnosidase gene and its application in producing L-rhamnose

Abstract

The present invention discloses an α-L-rhamnosidase gene and its application in the production of L-rhamnose. The α-L-rhamnosidase can completely hydrolyze monorhamnolipid and partially hydrolyze dirhamnolipid to produce L-rhamnose, and its amino acid sequence is shown in SEQ ID NO.1. The nucleotide sequence encoding the α-L-rhamnosidase is shown in SEQ ID NO.2. A recombinant bacterium containing an α-L-rhamnosidase gene and a recombinant Pichia pastoris engineered strain constructed using the gene can efficiently express α-L-rhamnosidase, and the enzyme has a specific activity of up to 589.264 U / mg when using rhamnolipid as a substrate. Using rhamnolipid fermented by microorganisms as raw materials, the α-L-rhamnosidase enzyme preparation produced by the gene is subjected to enzymatic treatment, which can effectively produce high-concentration L-rhamnose, providing an important enzyme resource and synthesis method for the green production of rhamnose.

Description

Technical Field

[0001] The invention belongs to the field of applied industrial microorganisms, and specifically relates to a new alpha-L-rhamnosidase gene, an engineering bacterium containing the gene and application thereof in producing L-rhamnose. Background Art

[0002] Rhamnose is also known as 6-deoxy-L-mannose, and its molecular formula is C6H 12 O5, pure rhamnose is a colorless crystalline powder with two configurations, α and β, the most common of which is α-L-rhamnose. It is most widely distributed in bacteria and plants. In bacteria, polysaccharides or lipopolysaccharides with rhamnose as the constituent sugar exist on the cell surface. This sugar chain structure often becomes an antigen-specific factor. In plants, in the leaves and flowers of Rhus verniciflua, in addition to existing in the form of free sugar, it is also distributed in the form of various glycosides such as rutin, constituent sugars of polysaccharides such as gum arabic, etc. Rhamnose has been used in many applications in the pharmaceutical industry and the food industry. For example, it can be used as a synthetic intermediate for cardiotonic drugs, an active ingredient for anti-tumor drugs, and a precursor of many other drugs. It can also be used as an additive for many foods and as a high-value raw material in cosmetics.

[0003] The traditional method of rhamnose production relies on traditional extraction technology, extracting rhamnose-containing substances from natural plants, and then through chemical acid hydrolysis or alkaline hydrolysis, extraction and other operation steps, finally obtaining pure rhamnose. However, this production method has high labor intensity, and it will produce a large amount of potential toxic substances in the extraction step, and toxic or corrosive hazardous chemicals are often used in the extraction process. At the same time, there are many problems such as seasonal and regional sources and transportation of raw materials. The method of industrial production of rhamnose is mainly fermentation. According to the difference of intermediate products, the method of producing rhamnose can be divided into two categories, using microorganisms or algae to produce polysaccharides containing rhamnose, and hydrolyzing polysaccharides to obtain rhamnose. Another is to use rhamnolipids produced by microorganisms, and hydrolyzing rhamnolipids to obtain rhamnose. This method is not only convenient and efficient, but also economical and environmentally friendly, and is very valuable for research.

[0004] α-L-rhamnosidase has a wide range of sources. It is a very important enzyme that exists in fungi, bacteria, yeast, plants, etc. in nature. The properties of α-L-rhamnosidase vary depending on its source. For example, the optimal pH of α-L-rhamnosidase from bacteria is close to neutral or alkaline, while the optimal pH of α-L-rhamnosidase from fungi is in the acidic range. At present, α-L-rhamnosidase from microorganisms has been widely used in industrial enzyme preparations, including Aspergillus niger ( Aspergillus niger) 、Penicillium( Penicillium ), Aspergillus oryzae ( Aspergillus oryzae ) Aspergillus terreus Aspergillus terreus ) and Enterococcus avium ( Enterococcus avium )、Staphylococcus xylosus( Staphylococcus xylose ), Bacillus Velez Bacillus velezensis ) etc. α-L-rhamnosidase is a hydrolase distributed in GH13, GH28, GH78 and GH106 families. α-L-rhamnosidase has a wide range of applications and can be used for deglycosylation of flavonoid components to improve the water solubility of flavonoid compounds and thus improve the medicinal value of flavonoid components.

[0005] At present, the research on enzymatic conversion of rhamnolipids to produce rhamnose is still in its infancy. Both domestic and foreign research on this project is still at the basic exploratory level, which is one of the important reasons why rhamnose is very expensive. Many α-L-rhamnosidases studied at home and abroad can only act on the glycosidic bonds in the middle and outer sides of disrhamnolipids and release one rhamnose unit. Although the enzyme sources are different, the mechanism of action can only hydrolyze exogenous glycosidic bonds, can only hydrolyze disrhamnolipids and release one rhamnose unit, and lack hydrolysis activity for monorhamnolipids, so it is impossible to completely hydrolyze rhamnolipids to obtain high concentrations of rhamnose. Summary of the invention

[0006] The purpose of the present invention is to provide an α-L-rhamnosidase capable of completely hydrolyzing rhamnolipid, wherein the enzyme can act on the bond between the rhamnosyl group and the fatty acid chain located inside the monorhamnolipid, and can completely hydrolyze the rhamnolipid to obtain a high concentration of rhamnose.

[0007] Another object of the present invention is to provide the gene of the α-L-rhamnosidase and a genetically engineered strain containing the gene.

[0008] Another object of the present invention is to provide the application of the α-L-rhamnosidase gene and the protein encoded by it.

[0009] The technical solution adopted by the present invention is:

[0010] An α-L-rhamnosidase, the amino acid sequence of which is shown in SEQ ID NO.1,

[0011] Alternatively, a fusion protein obtained by fusion protein tag at the carboxyl or amino terminal of the protein shown in SEQ ID NO.1;

[0012] Alternatively, the amino acid sequence shown in SEQ ID NO.1 is substituted and / or deleted and / or added with one or more amino acid residues to obtain a protein having α-L-rhamnosidase activity;

[0013] Alternatively, a protein molecule having 80%, 85% or higher than 90% identity with the protein molecule defined by the amino acid sequence shown in SEQ ID NO.1.

[0014] An alpha-L-rhamnosidase gene, which encodes an alpha-L-rhamnosidase with an amino acid sequence as shown in SEQ ID NO.1.

[0015] An α-L-rhamnosidase gene, the nucleotide sequence of which is shown in SEQ ID NO. 2, has a total length of 3042 bp, a G+C% of 41%, encodes 1014 amino acids, and a theoretical molecular weight of the protein of 110.72 kDa. The gene of the invention is a novel α-L-rhamnosidase gene, which is derived from Penicillium Penicillium cataractarum The hypotheticalprotein PEBR_08653 has the highest homology, which is 94.57%.

[0016] The nucleotide sequence of the gene is shown in SEQ ID NO.2; or, a DNA molecule having 80%, 85% or higher than 90% identity with the DNA molecule defined by the nucleotide sequence shown in SEQ ID NO.2 and encoding a protein with a sequence as shown in SEQ ID NO.1.

[0017] A recombinant expression plasmid, expression cassette, transgenic cell line, recombinant bacteria or recombinant virus containing the above gene.

[0018] The recombinant expression plasmid is obtained by cloning the α-L-rhamnosidase gene into pPIC9K.

[0019] A recombinant microorganism containing the recombinant expression plasmid.

[0020] The recombinant microorganism is obtained by linearizing the recombinant expression plasmid and then transforming it into Pichia pastoris GS115 cells.

[0021] The optimal reaction pH of the α-L-rhamnosidase of the present invention is 4.0, and the optimal reaction temperature is 50°C. After incubation at 50°C for 30 min, 80% of the original enzyme activity remains; after incubation at 4°C for 24 h in a buffer solution with a pH value of 3-6, more than 50% of the enzyme activity still remains, showing good stability.

[0022] The α-L-rhamnosidase described in the present invention is a new multifunctional glycosidase. Compared with the α-L-rhamnosidase disclosed in the prior art, the α-L-rhamnosidase Bra can hydrolyze the endogenous glycosidic bonds of rhamnolipids that other rhamnosidases cannot hydrolyze, and the recombinant α-L-rhamnosidase exhibits good hydrolysis activity.

[0023] The enzyme can act on the bond between the rhamnose group and the fatty acid chain located on the inner side of monorhamnolipid and can completely hydrolyze monorhamnolipid to obtain a high concentration of rhamnose.

[0024] The enzyme can completely hydrolyze monorhamnolipids and partially hydrolyze dirhamnolipids.

[0025] The monorhamnolipid is a monosaccharide disolipid, and the disrhamnolipid is a disaccharide disolipid.

[0026] A recombinant plasmid containing an alpha-L-rhamnosidase gene having a nucleotide sequence as shown in SEQ ID NO.2.

[0027] The recombinant plasmid is preferably obtained by cloning the α-L-rhamnosidase gene into pPIC9K.

[0028] A recombinant microorganism containing the recombinant plasmid.

[0029] The recombinant microorganism is preferably Pichia pastoris ( Pichia pastoris GS115) was used as the host bacteria.

[0030] The construction method of the recombinant microorganism is: amplifying the terminal containing Not I and EcoN I restriction site, and ligated it to the expression vector pPIC9K EcoN I and Not I restriction site, transformed into expression host bacteria P. pastoris GS115 obtained a genetically engineered strain with an integrated α-L-rhamnosidase gene P. pastoris GS115.

[0031] Inducible expression of α-L-rhamnosidase:

[0032] Recombinant microbial strains P. pastoris GS115 was streaked on plates and single colonies were picked and placed in liquid YPD medium at 25-30 °C for 20-30 h. The supernatant was then discarded by centrifugation and the bacteria were resuspended in BMMY medium to begin inducing yeast cell expression. The culture was continued at 25-30 °C, and methanol was added every 24 h to a final concentration of 1% (v / v) for a total of 96 h. After the culture was completed, the fermentation supernatant was collected by centrifugation to obtain the crude α-L-rhamnosidase enzyme solution.

[0033] The α-L-rhamnosidase is used in preparing L-rhamnose by enzymatic hydrolysis.

[0034] The invention discloses an application of α-L-rhamnosidase in the enzymatic hydrolysis of rhamnolipid and the production of L-rhamnose.

[0035] In the application, α-L-rhamnosidase is used to hydrolyze rhamnolipid at a temperature of 30-60°C and a pH of 3.0-6.0 to obtain L-rhamnose.

[0036] The rhamnolipid may be a monorhamnolipid, a disrhamnolipid or any mixture of the two.

[0037] 1-20g / L rhamnolipid is reacted with 0.001mg / mL-0.2mg / mL α-L-rhamnosidase Bra at 30-60℃ and pH 3.0-6.0 for 24 h. The rhamnose on the monorhamnolipid can be completely hydrolyzed into L-rhamnose, and the disrhamnolipid can be partially hydrolyzed.

[0038] Beneficial Effects

[0039] 1. The present invention provides a novel α-L-rhamnosidase gene derived from Penicillium Penicillium cataractarum The hypothetical protein PEBR_08653 has the highest homology, which is 94.57%.

[0040] 2. Amplify the terminal end by PCR Not I and EcoN I restriction site, named Bra . Connect it to Pichia pastoris P. pastoris GS115 high expression vector pPIC9K EcoN I and Not I restriction site, transformed into expression host bacteria P. pastoris GS115 was induced with methanol, and the induced expression level was 104.5 mg / L.

[0041] 3. The present invention measures the enzyme activity of the α-L-rhamnosidase gene expression product using p-nitrophenol rhamnoside pNPR as a substrate. The α-L-rhamnosidase can effectively act on monorhamnolipids with a specific activity of up to 589.264 U / mg.

[0042] 4. The engineered strain constructed using this gene can efficiently express α-L-rhamnosidase. When a mixture of mono- and di-rhamnolipids is used as substrate, mono-rhamnolipids are completely hydrolyzed and di-rhamnolipids are partially hydrolyzed after 12 hours of treatment. After treatment with recombinant α-L-rhamnosidase Bra, a high yield of about 1.93 mg / mL of L-rhamnose was obtained.

[0043] 5. The engineered strain constructed using this gene can efficiently express α-L-rhamnosidase, and when di-rhamnolipid is used as the target substrate, after treatment with recombinant α-L-rhamnosidase Bra, a yield of about 0.76 mg / mL of L-rhamnose was obtained in 120 h of reaction. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1 Electrophoresis diagram of PCR amplification of α-L-rhamnosidase gene; where: 1: DL5000 nucleic acid marker; 2: PCR amplification of α-L-rhamnosidase gene;

[0045] Figure 2 Diagram of the strategy for cloning the α-L-rhamnosidase gene;

[0046] Figure 3 SDS-PAGE electrophoresis of recombinant α-L-rhamnosidase; where: M: protein marker; 1: pure enzyme;

[0047] Figure 4 Enzymatic properties of α-L-rhamnosidase; where: a: optimal temperature of α-L-rhamnosidase; b: temperature stability; c: optimal pH of α-L-rhamnosidase; d: pH stability;

[0048] Figure 5 TLC diagram of α-L-rhamnosidase Bra hydrolyzing mono- and di-rhamnolipids; wherein: 1: a parallel system without adding rhamnolipid hydrolase as a control treatment; 2-7: TLC thin plate detection diagrams of samples after α-L-rhamnosidase hydrolyzed rhamnolipid for 12h, 24h, 48h, 72h, 96h, and 120h respectively;

[0049] Figure 6 The DNS method was used to detect the product of L-rhamnose produced by the hydrolysis of mono- and di-rhamnolipid mixture by α-L-rhamnosidase;

[0050] Figure 7 TLC diagram of α-L-rhamnosidase Bra enzymatic hydrolysis of di-rhamnolipid; where: 1-3: sampling at 24h, 48h, and 72h; 4: parallel system without rhamnolipid hydrolase added as control treatment; 5: TCL thin plate detection diagram at the end of 120 h;

[0051] Figure 8 The product diagram of L-rhamnose produced by the hydrolysis of dirhamnolipid by α-L-rhamnosidase detected by DNS method. DETAILED DESCRIPTION

[0052] In the following examples, the enzyme activity determination method is as follows: a certain amount of enzyme solution is added to 500 μL 20 mM PBS (pH 7.0), and then 80 μL containing 10 mg / mL p-nitrophenol rhamnoside is added, reacted at 40°C for 20 min, and then 400 μL DNS colorimetric reagent is added to measure the activity at 405 nm absorbance. The enzyme activity unit is defined as the amount of enzyme (mg) required to hydrolyze 1 μmol p-nitrophenol-α-rhamnoside (pNPR) per hour to produce the equivalent of p-nitrophenol (pNP), which is one unit (1 U).

[0053] Host bacteria P. pastoris GS115 was purchased from Invitrogen;

[0054] The vector pPIC9K was purchased from Novegen.

[0055] Example 1 Cloning of α-L-rhamnosidase gene and construction of expression vector

[0056] 1.1 PCR amplification of α-L-rhamnosidase gene

[0057] The bacterial genome data screened was compared with NCBI to find out the genome Penicillium brasilianum The genomic DNA of 08653 bacteria was similar to that of the α-L-rhamnosidase gene. The primers were designed with the full-length sequence of the α-L-rhamnosidase gene as a template, and the α-L-rhamnosidase gene was amplified by PCR. The primers used were F and R. The results are shown in Figure 1 . For the specific process, please refer to Figure 2 .

[0058] F: GAGAGGCTGAAGCTTACGTAGAATTCGAATTC( EcoR I) (SEQ ID NO. 3)

[0059] R:ATTGGAATAACACCACCACCACCACCACTGAG(Not I)(SEQ ID NO. 4)

[0060] The PCR amplification system is shown in Table 1, and the PCR amplification conditions are shown in Table 2.

[0061] Table 1 PCR amplification system

[0062]

[0063] Table 2 PCR amplification conditions

[0064]

[0065] The PCR amplification products were recovered by 0.75% agarose gel electrophoresis.

[0066] 1.2 E. coli Preparation of DH5α normal competent cells

[0067] E. coli DH5α was streaked onto SOB plates, and a single colony was picked and cultured at 37°C for 16-20 h, then inoculated with SOB liquid medium and cultured overnight at 18°C. To measure bacterial density, take a culture solution with an OD of about 0.45, place the culture on ice for 10 min, centrifuge at 4,000 rpm for 10 min, discard the liquid, add 80 mL of pre-cooled 0.1 mM CaCl2 conversion buffer, lightly suspend the bacteria in an ice water bath, centrifuge for 10 min, repeat the above operation, and add 1.5 mL of DMSO. Mix the bacterial suspension, place it on ice for 10 min, aliquot it into 200 μL per tube, freeze it in liquid nitrogen, and transfer it to a -80°C refrigerator for later use.

[0068] 1.3 Enzyme-linked transformation

[0069] The α-L-rhamnosidase DNA fragment generated by PCR was mixed with pMD19-T Vector (TaKaRa) at a molar ratio of 3:1 and incubated in a water bath at 16°C overnight under the action of ligase solution. The enzyme ligation system is shown in Table 3.

[0070] Table 3 Enzyme-linked system

[0071]

[0072] The enzyme-linked product was added to the E. coli DH5α competent cells, placed in an ice bath for 30 minutes, and heat-shocked for 90 seconds. The cells were quickly transferred to an ice bath and cooled for 3 minutes, and LB liquid medium was added to revive the cells. The cells were centrifuged at 4000 rpm for 3 minutes, and the remaining 200 μL competent cells were spread on an ampicillin-resistant LB plate and inverted and cultured in a 37 ℃ incubator.

[0073] 1.4 Extraction and sequencing of target gene plasmid

[0074] The single colony in 1.3 was picked and cultured overnight in LB medium containing ampicillin, the bacteria were collected by centrifugation, and the plasmid was extracted and sent for testing. Results The full length of the gene was 3042 bp, the G+C content was 41%, and the sequence was SEQ ID NO.2; the gene encoded 1014 amino acids, and its amino acid sequence was SEQ ID NO.1.

[0075] 1.5 Use the recombinant plasmid extracted in 1.4 EcoR I and Not I Double enzyme digestion, the enzyme digestion system is shown in Table 4.

[0076] Table 4 Enzyme digestion system

[0077]

[0078] The reaction system was placed in a 37°C water bath for overnight reaction, and the enzyme cleavage products were recovered by agarose gel electrophoresis.

[0079] 1.6 The expression vector pPIC9K (purchased from Novegen) was used EcoR I and Not I Double restriction enzyme digestion (refer to 1.5).

[0080] 1.7 Enzyme-linked transformation: the system is shown in Table 5.

[0081] Table 5 Enzyme-linked transformation system

[0082]

[0083] The system was placed in a 16 ℃ water bath overnight to react and obtain the recombinant plasmid pPIC9K-Bra containing the target gene. E. coli After being transformed into DH5α, the plate was spread on LB plate with 250 µg / mL G418 resistance, and the transformant plasmid was picked for restriction enzyme digestion verification. After sequencing was correct, the bacteria were preserved.

[0084] 1.8 Linearization of recombinant plasmid pPIC9K-Bra

[0085] Restriction enzymes S C I linearized and recovered the recombinant plasmid.

[0086] The reaction system is shown in Table 6.

[0087] Table 6 Recombinant plasmid linearization reaction system

[0088]

[0089] 1.9 P. pastoris Preparation of GS115 competent cells

[0090] Pick a single colony into 50 mL YPD medium (medium formula: 1% yeast extract, 2% peptone, 2% glucose) and culture until OD 600 The value is between 1.0 and 1.5; aspirate the culture solution and inoculate it into 50 mL YPD medium at a 5% inoculum volume, and culture until the OD 600value is between 0.3-0.5; collect the cells by centrifugation at 4500 rpm; gently mix the cells with the yeast cell competent mother solution, place at room temperature for 30 min, and gently shake every 10 min; collect the cells by centrifugation; resuspend with pre-cooled 1 M sorbitol, and then collect the cells by centrifugation at 4 ℃, 4000 rpm, repeat three times; then resuspend with 100 µL pre-cooled 1 M sorbitol, dispense 80 µL into each tube, and store at -80 ℃.

[0091] 1.10 Electroporation

[0092] After the electroporation cup is precooled, turn on the electroporation instrument, adjust the required parameters, add 1-3 µg of the linearized DNA fragment in 1.6 to the prepared yeast competent cells, mix well, place on ice for 5 min, and then transfer to the electroporation cup; immediately after electroporation, add 1 mL of precooled 1 M sorbitol to the electroporation cup, transfer to a 1.5 mL centrifuge tube, and place it in a 30 ℃ incubator for 1 h; centrifuge at 4000 rpm for 3 min at room temperature, discard the supernatant, collect the cells and resuspend them in YPDS; spread 100 µL of the cell suspension on a YPD plate containing 500 µg / mL G418. Colony PCR verification to detect whether the target gene is integrated into the yeast chromosome; the strain with the α-L-rhamnosidase gene integrated is the genetically engineered strain. P. pastoris GS115 (pPIC9K-Bra).

[0093] Example 2. α-L-rhamnosidase gene expression and purification

[0094] 2.1 Expression of α-L-rhamnosidase gene

[0095] Recombinant microbial strains P. pastorisGS115 (pPIC9K-Bra) was streaked on YPD (culture medium formula: 1% yeast extract, 2% peptone, 2% glucose, 2% agar powder) plates for 2-3 days, and a single colony was picked into a 50 mL liquid YPD Erlenmeyer flask and cultured at 28°C and 200 rpm for 24 h; then centrifuged at 4500 rpm at room temperature for 10 min, the supernatant was discarded, and the bacteria were resuspended in 25 mL BMMY culture medium to begin inducing yeast cell expression; BMMY was used as the culture medium for inducing expression and continued to be cultured at 28°C and 200 rpm, methanol was added every 24 h to a final concentration of 1% (v / v), and a total of 96 h was cultured; after the culture was completed, the fermentation supernatant was collected by centrifugation to obtain the crude α-L-rhamnosidase enzyme solution. A certain amount of enzyme solution was added to 500 μL 20 mM PBS (pH 7.0), and then 80 μL containing 10 mg / mL p-nitrophenol rhamnoside was added. After reacting at 40°C for 20 min, 400 μL DNS colorimetric agent was added to measure the activity at 405 nm absorbance. The enzyme activity of the target protein was detected, and the results showed that the α-L-rhamnosidase was highly expressed in Pichia pastoris.

[0096] 2.2 Purification of α-L-rhamnosidase

[0097] Pick P. pastoris The fermentation supernatant of GS115 (pPIC9K-Bra) after 96 hours of induced expression was first concentrated by salting out. Gradual precipitation was performed according to the 0-80% ammonium sulfate saturation gradient. Operation steps: Measure the volume of the fermentation enzyme solution, pour it into a beaker, place a magnetic rotor in the beaker, place the beaker on ice, and turn on the magnetic stirrer. Slowly add ammonium sulfate according to the volume of the crude enzyme solution to make the saturation reach 80%, centrifuge at 4°C, 13,000 rpm for 20 min, resuspend the precipitate with a small amount of 50 mM Tris-HCl pH7.0 buffer without ammonium sulfate, and determine the protein content and enzyme activity. The resuspended enzyme solution was dialyzed in 50 mM Tris-HCl pH7.0 buffer at 4°C overnight. Load the dialyzed enzyme solution onto Ni pre-equilibrated with two column volumes of 50 mM Tris-HCl pH7.0 2+-NTA affinity chromatography column, incubate at 4℃ for 1 h, wash away impurities with 5 column volumes of 50 mMTris-HCl (pH7.0, 50 mM imidazole), then perform gradient elution with 50 mM Tris-HCl (pH7.0, 100 mM, 300 mM imidazole), and collect and combine the eluates with the highest purity of the recombinant enzyme after enzyme activity determination and SDS-PAGE electrophoresis. At 4℃, dialyze overnight in 50 mM Tris-HCl (pH 7.0) buffer with a dialysis bag with a molecular weight cutoff of 10 KDa to remove imidazole and obtain pure enzyme solution α-L-rhamnosidase. The purified recombinant protein was tested by SDS-PAGE, and the results are as follows: Figure 3 As shown, the Coomassie brilliant blue stained gel showed a single target band, reaching the electrophoresis purification standard, but inconsistent with the predicted molecular weight of 110.79 kDa. This is due to the glycosylation of the protein expressed in Pichia pastoris, which is a normal phenomenon and does not affect the function of the protein. When an appropriate amount of α-L-rhamnosidase Bra pure enzyme solution is taken with pNPR as the substrate, the specific activity of α-L-rhamnosidase is 589.264 U / mg.

[0098] Example 3. Study on the enzymatic properties of α-L-rhamnosidase

[0099] 3.1 Effect of temperature on enzyme activity

[0100] Determination of the optimal reaction temperature: The activity of the purified recombinant enzyme was measured at different temperatures (30°C, 40°C, 45°C, 50°C, 55°C, 60°C, 70°C, 80°C) and pH 4.0, and the highest enzyme activity was set as 100% ( Figure 4 a). Determination of thermal stability: The purified enzyme solution of the recombinant enzyme was incubated at 30℃, 40℃, 45℃, 50℃, 60℃, 70℃, 80℃, pH4.0 for 1 h, then quickly cooled on ice, and the residual enzyme activity was determined for each, with the enzyme activity without incubation as 100% ( Figure 4 (b) The optimal reaction temperature of the recombinant enzyme Bra is 50°C, and the enzyme activity is maintained above 60% in the range of 30-60°C.

[0101] 3.2 Effect of pH on enzyme activity

[0102] Determination of the optimal reaction pH: Enzyme activity was measured in buffer systems with different pH values: citric acid buffer (pH 3-6); 20 mM Tris-HCl buffer (pH 6-9); 20 mM Gly-NaOH buffer (pH 9-10). The activity of the purified recombinant enzyme solution was measured at 50°C, and the highest activity was set as 100% ( Figure 4c). Determination of pH stability: The recombinant enzyme was placed in buffer solutions of different pH values ​​at 4°C for 24 h, then added to the activity test system and reacted at 50°C for 20 min before the residual activity was determined. The enzyme activity at pH 4.0 was taken as 100% ( Figure 4 d in the figure). The optimum pH value of Bra is 4.0. The enzyme activity is maintained above 85% at pH 4.0-5.0, showing a wide pH adaptability. At the same time, it is most stable in a buffer with a pH value of 3.0-6.0. After incubation in the buffer in this pH range for 24 h, it still maintains 70% of the original enzyme activity.

[0103] Example 4. Application of α-L-rhamnosidase to hydrolyze a mixture of mono- and di-rhamnolipids to prepare L-monorhamnose

[0104] The engineered strain constructed using this gene can efficiently express α-L-rhamnosidase. Prepare 50ml of 50mM sodium acetate buffer, add 2mL of 95% pure 250g / L mono- and di-rhamnolipid mixture (monorhamnolipid: di-rhamnolipid ratio is 1:3) as substrate, add 800μL 0.1045mg / mL Bra enzyme, stir in a water bath at 50℃, 800rmp, incubate for 120h, add 50mL 50mM sodium acetate buffer and take samples after 12h, take samples at 12, 24, 48, 72h, and 120h, measure the content of rhamnose by DNS method, extract the remaining rhamnolipid with 1:0.8 ratio of hydrolyzed sample: ethyl acetate, and run a thin layer to see the remaining rhamnolipid ratio. The DNS method detected 1.93mg / mL of rhamnose ( Figure 6 ), TLC showed that the remaining monorhamnolipids gradually disappeared after 24 h ( Figure 5 ), the amount of disrhamnolipid also gradually decreased, indicating that α-L-rhamnosidase Bra has the ability to completely hydrolyze monorhamnolipid and partially hydrolyze disrhamnolipid.

[0105] Example 5. Study on the application of α-L-rhamnosidase in hydrolyzing dirhamnolipid to prepare L-rhamnose

[0106] The soluble protein liquid secreted by the homologous recombinant strain Pichia pastoris GS115-pPIC9K-Bra was purified to obtain a pure enzyme liquid with a concentration of 0.1045 mg / mL α-L-rhamnosidase. 50 ml of 50 mM sodium acetate buffer was prepared, and a final concentration of 10 g / L disrhamnolipid was used as a substrate (0.51 g of disaccharide disaccharide rhamnolipid powder with a purity of 98% was added) and 800 μL of 0.1045 mg / mL α-L-rhamnosidase was reacted in 50 ml of 50 mM sodium acetate buffer at a temperature of 50 ° C and pH 4.0 for 96 h. The rhamnose on the disrhamnolipid can be partially hydrolyzed. TLC showed that the disrhamnolipid gradually began to decrease after 24 hours ( Figure 7 ), 0.76 mg / mL of L-rhamnose was detected at the end of the DNS reaction at 120 h ( Figure 8 ), indicating that α-L-rhamnosidase Bra has the ability to partially hydrolyze di-rhamnolipid.

Claims

1. An α-L-rhamnosidase, characterized in that Its amino acid sequence is shown in SEQ ID NO.

1.

2. An α-L-rhamnosidase gene, characterized in that: Encodes the α-L-rhamnosidase according to claim 1.

3. The α-L-rhamnosidase gene according to claim 2, characterized in that Its nucleotide sequence is shown in SEQ ID NO.

2.

4. A recombinant expression plasmid carrying the α-L-rhamnosidase gene according to claim 2 or 3.

5. The recombinant expression plasmid according to claim 4, characterized in that: The α-L-rhamnosidase gene according to claim 2 or 3 is cloned into a pPIC9K vector.

6. A recombinant microorganism containing the recombinant expression plasmid according to claim 4.

7. The method for constructing a recombinant microorganism according to claim 6, characterized in that: The recombinant expression plasmid according to claim 4 is linearized and then transformed into Pichia pastoris GS115 cells.

8. Use of the α-L-rhamnosidase according to claim 1 in hydrolyzing rhamnolipid to prepare L-rhamnose.

9. The use according to claim 8, characterized in that: α-L-rhamnosidase is used to hydrolyze rhamnolipid at a temperature of 30-60°C and a pH of 3.0-6.0 to obtain L-rhamnose.

10. The use according to claim 9, characterized in that: The rhamnolipids include monorhamnolipids and dirhamnolipids.

Images