Engineered inhibitory tRNA molecules and methods

Abstract

In certain aspects, the invention relates to engineered inhibitory transport RNA (tRNA) molecules that restore translation of an encoding nucleic acid containing an advanced UGA / TGA termination codon by inserting arginine (Arg) into a polypeptide when decoding the UGA / TGA termination codon. In addition, the invention also encompasses expression cassettes and vectors comprising nucleic acids encoding the engineered inhibitory tRNAs, as well as compositions containing these expression cassettes, vectors and / or engineered inhibitory tRNAs, as well as methods involving the engineered inhibitory tRNA molecules for the recovery of protein translation and / or the treatment of disease.

Description

Technical Field

[0001] In certain aspects, the present invention relates to engineered inhibitory transfer RNA (tRNA) molecules that restore translation of encoding nucleic acids containing premature UGA / TGA stop codons by inserting arginine (Arg) into polypeptides when decoding UGA / TGA stop codons. In addition, the present invention also relates to expression cassettes and vectors comprising nucleic acids encoding engineered inhibitory tRNAs, compositions (e.g., pharmaceutical compositions) comprising these expression cassettes, vectors, and / or engineered inhibitory tRNAs, and methods of restoring protein translation and / or treating diseases by engineered inhibitory tRNA molecules. Background Art

[0002] Rare diseases, also known as orphan diseases, are defined based on their incidence. In the United States, a disease is considered "rare" when it affects less than one in 1,500 people; in Europe, it is considered "rare" when it affects less than one in 2,000 people. To date, 6,172 unique rare diseases have been defined. Of these, 71.9% are caused by gene mutations, while the rest are caused by viral or bacterial infections, allergic reactions, or environmental factors (Nguengang Wakap, S., et al. (2020) Estimating cumulative point prevalence of rare diseases: analysis of the Orphanet database. Eur J Hum Genet. February; 28(2): 165-173. doi: 10.1038 / s41431-019-0508-0. Epub 2019 Sep 16. PMID: 31527858; PMCID: PMC6974615). It is estimated that globally, approximately 263 million to 446 million people suffer from rare diseases at any point in time (Nguengang Wakap, S., et al. (2020) Estimating cumulative point prevalence of rare diseases: analysis of the Orphanet database. Eur J Hum Genet. Feb;28(2):165-173. doi:10.1038 / s41431-019-0508-0. Epub 2019 Sep 16. PMID:31527858; PMCID:PMC6974615). Unfortunately, 75% of patients with rare diseases are children, and 30% of them have a life expectancy of less than 5 years (Benhabiles, H., et al. (2016). Pathologies Susceptible to be Targeted for Nonsense Mutation Therapies. 10.1016 / B978-0-12-804468-1.00002-6). Due to the low prevalence of each rare disease, the market cannot support the resources required to study the pathogenesis of these diseases or develop new drugs or treatments.

[0003] Gene-related rare diseases may be caused by the insertion or deletion of one or more nucleotides in the gene (e.g., frameshift mutation) and / or point mutation (e.g., nonsense mutation or missense mutation), which can lead to the absence of gene products or loss of their function (Benhabiles, H., et al. (2016). Pathologies Susceptible to be Targeted for Nonsense Mutation Therapies. 10.1016 / B978-0-12-804468-1.00002-6). Nonsense mutation is a type of point mutation that has been studied in depth. It can cause premature termination codons (PTC) in messenger RNA (mRNA), which in turn leads to reduced mRNA stability and the production of truncated protein products (Khajavi, M., et al. (2006) Nonsense-mediated mRNA decay modulates clinical outcome of genetic disease. Eur J Hum Genet. October; 14 (10): 1074-81. doi: 10.1038 / sj.ejhg.5201649. Epub 2006 June 7. PMID: 16757948). So far, 410,743 gene mutations have been found to be associated with various human genetic diseases, of which about 11% (i.e., 45,689) are nonsense mutations (from the Human Gene Mutation Database). Data from the Human Gene Mutation Database (https: / / www.hgmd.cf.ac.uk / ac / index.php, accessed on July 4, 2023). These nonsense mutations exist in various genes and occur at different frequencies depending on the type of stop codon, including 41.8% (19,101 types) of TAG / UA G, 36.5% (16,680 types) of UGA / TGA, and 21.7% (9,908 types) of TAA / UAA premature stop codons (PTC). It is worth noting that among these nonsense mutations, the conversion of the codon encoding arginine (Arg) to UGA / TGA is the most frequent, reaching 9,302 types (from the Human Gene Mutation Database). Data, https: / / www.hgmd.cf.ac.uk / ac / index.php, accessed on July 4, 2023).

[0004] Human genetic diseases caused by nonsense mutations are closely related to the generation of truncated protein products and the rapid degradation of mRNA containing premature termination codons (PTCs). The degradation and elimination process of mRNA containing PTCs is triggered by an evolutionarily conserved RNA surveillance mechanism called nonsense-mediated mRNA degradation (NMD) (Chang, YF, et al. (2007) The nonsense-mediated decay RNA surveillance pathway. Annu Rev Biochem. 76: 51-74. doi: 10.1146 / annurev.biochem.76.050106.093909. PMID: 17352659). The operation of the NMD pathway depends on the scanning of the ribosome for the termination codon and the presence of the exon-junction complex (EJC) attached to the position of about 20-24 nucleotides (nt) upstream of the exon-exon junction. When the ribosome pauses at the stop codon and the EJC is located more than 50 nucleotides downstream, the SURF complex is recruited to the mRNA. The SURF complex consists of a protein kinase (SMG1), an RNA helicase (UPF1), and peptide release factors eRF1 and eRF3. Phosphorylation of UPF1 further leads to the recruitment of SMG5, SMG6, and SMG7, and is associated with the mRNA degradation pathway mediated by exonucleases and endonucleases (Nickless, A, et al. (2017) Control of gene expression through the nonsense-mediated RNA decay pathway. Cell Biosci. May 19; 7:26. doi:10.1186 / s13578-017-0153-7. PMID:28533900; PMCID:PMC5437625).

[0005] Over the past two decades, clinical research on the treatment of PTC has mainly focused on enhancing the readthrough of PTC by inserting amino acids, aiming to restore the production and function of defective proteins (Spelier, S., et al. (2023) Readthrough compounds for nonsense mutations: bridging the translational gap. Tre nds Mol Med. April; 29(4): 297-314. doi: 10.1016 / j.molmed.2023.01.004. Epub 2023 Feb 22. PMID: 36828712). The main strategies in this field are based on the action of small molecules in multiple aspects to promote PTC readthrough, including inhibition of ribosomal proofreading (e.g., using aminoglycoside antibiotics such as Ataluren), inhibition of the NMD pathway (e.g., amlexanox), and induction of mRNA-tRNA mispairing (e.g., pseudouridylation) (Spelier, S., et al. (2023) Readthrough compounds for nonsense mutations: bridging the translational gap. Trends Mol Med. April; 29(4): 297-314. doi: 10.1016 / j.molmed.2023.01.004. Epub 2023 Feb 22. PMID: 36828712). Although many small molecules have achieved positive results in clinical trials for the treatment of diseases caused by PTC, the uncertainty of the type of inserted amino acids increases the risk of producing inappropriate protein products and / or off-target effects. Therefore, another approach that has attracted much attention is to apply gene therapy strategies to ensure that the correct protein is produced. For example, defective genes can be edited based on CRISPR technology, or transgenic methods can be used to achieve this goal (Porter, JJ, et al. (2021) Therapeutic promise of engineered nonsense suppressor tRNAs. Wiley Interdiscip Rev R NA. July; 12(4): e1641. doi: 10.1002 / wrna.1641. Epub 2021 Feb 10. PMID: 33567469; PMCID: PMC8244042). However, the application of this approach is limited by the specificity of a single target and there is a risk of off-target effects.

[0006] With the continuous development of in vivo delivery systems and whole genome, whole transcriptome and whole proteome analysis technologies, suppressor tRNA has attracted much attention due to its potential in treating diseases caused by PTC (Wang, J., et al. (2022) AAV-delivered suppressor tRNA overcomes a nonsense mutation in mice. Nature. April; 604(7905): 343-348. doi: 10.1038 / s41586-022-04533-3. Epub 2022 Mar 23. PMID: 35322228; PMCID: PMC9446716). Suppressor tRNA is derived from naturally occurring tRNA, and its anticodon is changed to enable it to target PTC (such as TAA / UAA, TAG / UAG, UGA / TGA) and carry the desired amino acid to restore the function of mRNA containing PTC to express full-length protein. Compared with other PTC rescue strategies, suppressor tRNA shows the potential to target multiple PTC-induced genetic diseases with a single component, with a broad spectrum and fewer side effects (Wang, J., et al. (2022) AAV-delivered suppressor tRNA overcomes a nonsense mutation in mice. Nature. April; 604(7905): 343-348. doi: 10.1038 / s41586-022-04533-3. Epub 2022 Mar 23. PMID: 35322228; PMCID: PMC9446716).

[0007] All publications, including but not limited to patent documents, scientific articles, and databases cited in this disclosure are incorporated herein by reference in their entirety for all purposes and uses as if each individual publication were individually cited. Summary of the invention

[0008] One aspect of the present invention provides an engineered inhibitory transfer RNA (tRNA) for carrying arginine, which has a nucleotide sequence selected from SEQ ID NOs: 2-8 and 154. In one embodiment, the engineered inhibitory tRNA has a nucleotide sequence of SEQ ID NO: 2. In one embodiment, the engineered inhibitory tRNA has a nucleotide sequence of SEQ ID NO: 3. In one embodiment, the engineered inhibitory tRNA has a nucleotide sequence of SEQ ID NO: 4. In one embodiment, the engineered inhibitory tRNA has a nucleotide sequence of SEQ ID NO: 5. In one embodiment, the engineered inhibitory tRNA has a nucleotide sequence of SEQ ID NO: 6. In one embodiment, the engineered inhibitory tRNA has a nucleotide sequence of SEQ ID NO: 7. In one embodiment, the engineered inhibitory tRNA has a nucleotide sequence of SEQ ID NO: 8. In one embodiment, the engineered inhibitory tRNA has a nucleotide sequence of SEQ ID NO: 154.

[0009] Another aspect of the present invention provides a nucleic acid encoding any of the engineered inhibitory tRNAs in the above embodiments, or an expression cassette or vector comprising the nucleic acid. In some embodiments, the vector is a viral vector or a plasmid. In some embodiments, the viral vector is an adeno-associated virus (AAV) vector or a lentiviral vector. In some embodiments, the adeno-associated virus vector is an AAV 2 / 9 vector.

[0010] Another aspect of the present invention provides a composition comprising the engineered inhibitory tRNA, nucleic acid, expression cassette or vector of any of the above embodiments. In some embodiments, the composition is a pharmaceutical composition and further comprises a pharmaceutically acceptable carrier. In some embodiments, the pharmaceutically acceptable carrier is a liposome or a lipid nanoparticle.

[0011] Another aspect of the present invention provides a method for restoring translation of a target encoding nucleic acid containing a premature UGA / TGA stop codon in a cell. The method comprises introducing into the cell an engineered inhibitory tRNA, nucleic acid, expression cassette or vector in any of the above embodiments, wherein the introduced engineered inhibitory tRNA or the engineered inhibitory tRNA produced thereby can recognize and read through the premature UGA / TGA stop codon, thereby restoring translation of the target encoding nucleic acid containing the premature UGA / TGA stop codon. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] The accompanying drawings illustrate several features and advantages of the present invention. It should be understood that these embodiments are not intended to limit the scope of the appended claims in any way.

[0013] Figures 1A to 1S , Figure 1CC to Figure 1DD , presenting the screening of the first generation of engineered inhibitory tRNAs and their application in plasmid and viral vectors. These tRNAs are derived from natural arginine tRNAs, and their anticodons are modified to 5'-TCA-3', enabling them to recognize and read through the premature termination codon UGA in mRNA.

[0014] Figure 1A Schematic diagrams depicting two structural versions of luciferase used for engineered inhibitory tRNA screening. Nonsense mutations in these structures can be read through by engineered inhibitory tRNA, resulting in the expression of full-length luciferase and its enzymatic activity. The top and bottom panels ("Luc_V2_R3" and "Luc_V3_R3") show different versions of the structure, respectively. Among them, the black rectangle marked with "NanoLuc" represents the modified Luciferase protein encoding gene (from Promega, Madison, WI, USA) with a UGA / TGA stop codon (labeled as PTC) inserted after base pair position 195 (Luc_V2_R3) or 474 (Luc_V3_R3). Meanwhile, the modified NanoLuc protein encoding gene with a GGA (glycine) codon inserted at the same position was used as a control for Luc_V2_R3 and Luc_V3_R3, denoted as V2-R4 and V3-R4, respectively. The rectangles with hatched lines at both ends of the luciferase protein represent the glycine and serine linkers (GS linker); the rectangles with circles or plus signs represent the 3x Myc and 3x FLAG tags added to the N-terminus and C-terminus of the luciferase, respectively, which can be used for protein pull-down assays and further mass spectrometry analysis.

[0015] Figure 1B and Figure 1C Shown respectively from Figure 1ANanoLuc luciferase assay results for two structural versions (Luc_V2_R3 and Luc_V3_R3) described in Example 1. The assay was performed for a series of engineered inhibitory tRNAs (R3-1, R3-2, R3-3, R3-4, R3-5, R3-6, R3-7, R3-8, R3-9, R3-10, R3-11, R3-12, R3-13, R3-14, R3-15, R3-147, R3-148, R3-149, R3-150 and R3-151) and the corresponding positive controls V2_R4 and V3_R4 as described in Example 1. The x-axis indicates the engineered inhibitory tRNA tested and the y-axis indicates the measured luciferase activity in Relative Luminescence Units. Error bars represent standard deviation of biological triplicates, with Scr1-4 (scrambled sequence derived from R3-147) serving as a negative control.

[0016] Figure 1D and Figure 1E demonstrated that in DMS1114 cells ( Figure 1D ) and Calu6 cells ( Figure 1E ), Western blot of rescued full-length p53 expression (top row), truncated p53 expression (middle row) and GAPDH expression (bottom row) after transfection with specific engineered inhibitory tRNAs (R3-7, R3-8, R3-13, R3-147, R3-148, R3-149) or scrambled sequence Scr1-4, or treatment with different concentrations of G418 compared to the positive control cell line A549.

[0017] Figure 1F and Figure 1G showed that in DMS1114 cells ( Figure 1F ) and Calu6 cells ( Figure 1G ) RT-qPCR results of p53 mRNA levels containing premature UGA stop codons after transfection with specific engineered inhibitory tRNAs or scrambled sequences Scr1-4, or treated with different concentrations of G418, compared with the positive control cell line A549. The x-axis shows the sample source, and the y-axis shows the relative abundance of p53 mRNA containing premature UGA stop codons in each sample relative to the abundance of p53 mRNA without PTC in the A549 control (corrected by GAPDH). The error bars also represent the standard deviation of three biological replicates.

[0018] Figure 1H Detailed presentation from Figure 1ANanoLuc luciferase assay results for the structural version Luc_V2_R3 described in . The assay was performed on a series of modified engineered inhibitory tRNAs (including R3-147, M2 to M8), and the specific experimental steps were as described in Example 2. At the same time, in order to more comprehensively evaluate the experimental results, we also added water and G148-treated cells as controls, and also used Scr1-4 (a scrambled sequence derived from R3-147) as a negative control. Figure 1H In the figure, the x-axis indicates the tested engineered inhibitory tRNAs, and the y-axis indicates the measured luciferase activity, which is measured in relative luminescence units. Error bars represent the standard deviation of three biological replicates.

[0019] FIG. 1I to FIG. 1O The results of tRNA sequencing after transfection of Luc_V2_R3 cell line with plasmid expressing engineered inhibitory tRNA are presented. These results elaborate on the engineered inhibitory tRNA ( Figure 1I-1J ) and its corresponding endogenous tRNA( Figure 1K ) expression levels, and the steady-state status of the endogenous tRNA group ( Figure 1L-Figure 1O ). Figure 1I-1K Line graphs depicting the normalized total reads of selected engineered inhibitory tRNAs and their endogenous counterparts detected in different samples. The horizontal axis represents the Sprinzl position from the 5' end to the 3' end of the reference tRNA, and the vertical axis shows the normalized total reads. These graphs ( Figure 1I-1K Each line in the figure corresponds to a specific plasmid transfection sample: R3-8 (black dashed line), R3-147 (black solid line), and R3-147-M54 (black dotted line). Among them, Scr1-4 (gray solid line) serves as a negative control, while H2O-treated cells (gray dashed line) serve as a blank control. The top of the figure shows the reference sequences used for comparison, including R3-8 ( Fig. 1I , left, derived from natural tRNA Arg-CCT-4-1), R3-147 ( Fig. 1I , right, derived from natural tRNA Arg-TCT-1-1), R3-147-M54 ( Figure 1J , further engineered from R3-147 and named M54), and the natural tRNAs Arg-CCT-4-1 ( Figure 1K , left) and Arg-TCT-1-1 ( Figure 1K , right). Figure 1L to Figure 1OThe endogenous tRNA expression levels were compared between the Luc_V2_R3 cell line transfected with Scr1-4 (y-axis) and various engineered inhibitory tRNAs (x-axis). This includes R3-8 ( Figure 1L ), R3-147( Figure 1M ), R3-147-M54( Figure 1N ), and blank control ( Fig.1O ). The total normalized reads (log10(normalized reads)) are shown on each axis in log10 format. The Pearson correlation coefficient (r) for each comparison is indicated in the upper left corner of each panel. In addition, each figure ( Figure 1L-Figure 1O ) are divided into three sub-panels: the left panel shows the analysis of all cytoplasmic tRNAs at the single tRNA level, the middle panel presents the analysis at the isodecoder level (i.e., tRNAs with the same anticodon), while the right panel is focused on the analysis at the isoacceptor level (i.e., tRNAs carrying the same amino acid).

[0020] Figure 1P Western blot results of full-length NanoLuc protein rescued by various engineered inhibitory tRNAs are shown. In the figure, "WCE" stands for whole cell extract, which is used as a loading control to confirm the presence and enrichment of the target NanoLuc protein. "FT" represents the flowthrough sample collected during the immunoprecipitation process, which is used to evaluate the success of immunoprecipitation, while "IP" stands for the immunoprecipitated sample. Engineered inhibitory tRNAs R3-8, R3-147 and R3-147-M54 (abbreviated as M54) were expressed in the LUC_V2_R3 cell line by plasmid transfection. The upper band in the figure represents the rescued NanoLuc protein, which is the same as Figure 1A The lower band represents the NanoLuc protein without the 3x Myc tag and the pre-GS linker, which is produced by the translation starting from the start codon of the NanoLuc gene instead of the start codon of the Myc tag. Scr1-4 is used as a negative control here. The sample source is marked above the figure, and the position of the band is marked on the left side of the figure.

[0021] Figure 1Q-Figure 1SNanoLuc luciferase assay (left panel) and transduction efficiency (right panel, measured as the proportion of GFP-positive cells) results are shown for Luc-V2-R3 cell lines, including R3-5 ( Figure 1Q )、R3-8( Figure 1R ) and R3-147( Figure 1S ). The figure shows the two different lentiviral multiplicities of infection (MOIs) used, as shown on the x-axis. The y-axis of the bar graph in the left panel represents relative luminescence units, while the y-axis of the bar graph in the right panel shows the percentage of GFP-positive cells (GFP+cells(%)). Error bars represent the standard deviation of biological triplicates. In addition, a blank control experiment without lentiviral transduction was performed.

[0022] Figure 1T Western blots showing read-through full-length p53 expression (top row) and GAPDH expression (bottom row) in Calu6 cells (left panel) and DMS1114 cells (right panel) after transfection with specific engineered inhibitory tRNAs (including R3-147, M2 to M8) or scrambled sequences Scr1-4, or treatment with G418, compared to the positive control cell line A549. Figure 1U The results further show the RT-qPCR results of p53 mRNA levels containing a premature UGA stop codon after transfection with specific engineered inhibitory tRNA or scrambled sequence Scr1-4, or treatment with G418 in the same cell line, compared with the positive control cell line A549. Figure 1U In the figure, the x-axis indicates the sample source, and the y-axis indicates the relative abundance of p53 mRNA containing premature UGA stop codon in each sample relative to the abundance of p53 mRNA without PTC in A549 control (the data have been corrected by GAPDH). Error bars indicate the standard deviation of three biological replicates.

[0023] Figure 1V to Figure 1BB The results of tRNA sequencing after transfection of Luc_V2_R3 cell line with plasmid expressing engineered inhibitory tRNA are presented. These results elaborate on the engineered inhibitory tRNA ( Figure 1V-Figure 1W ) and its corresponding endogenous tRNA( Figure 1X ) expression levels, and the steady-state status of the endogenous tRNA group ( Figure 1Y-Figure 1BB ). Figure 1V-Figure 1XLine graphs depicting the normalized total reads of selected engineered inhibitory tRNAs and their endogenous counterparts detected in different samples. The horizontal axis represents the Sprinzl position from the 5' end to the 3' end of the reference tRNA, and the vertical axis shows the normalized total reads. These graphs ( Figure 1V-Figure 1X ) corresponds to a specific plasmid transfection sample: R3-147 (gray solid line), R3-147-M2 (black solid line), R3-147-M3 (black dashed line), R3-147-M4 (black dotted line). Among them, Scr1-4 (gray dotted line) is used as a negative control. The top of the figure shows the reference sequences used for comparison, including R3-147 ( Figure 1V , left), R3-147-M2( Figure 1V , right), R3-147-M3( Figure 1V , left), R3-147-M4( Figure 1W , left), Scr1-4 ( Figure 1W , right figure, the horizontal black solid line in the figure represents the lower limit of detection (LLOD)) and the natural tRNA Arg-TCT-1-1 ( Figure 1X ). Figure 1Y to Figure 1BB The endogenous tRNA expression levels were compared between the Luc_V2_R3 cell line transfected with Scr1-4 (y-axis) and various engineered inhibitory tRNAs (x-axis). This includes R3-147 ( Figure 1Y ), R3-147-M2( Figure 1Z ), R3-147-M3( Figure 1AA ), and R3-147-M4( Figure 1BB ). The total normalized reads (log10(normalized reads)) are shown on each axis in log10 format. The Pearson correlation coefficient (r) for each comparison is indicated in the upper left corner of each panel. In addition, each figure ( Figure 1Y-Figure 1BB ) are divided into three sub-panels: the left panel shows the analysis of all cytoplasmic tRNAs at the single tRNA level, the middle panel presents the analysis at the isodecoder level (i.e., tRNAs with the same anticodon), while the right panel is focused on the analysis at the isoacceptor level (i.e., tRNAs carrying the same amino acid).

[0024] Figure 1CC to Figure 1DDShown is a schematic diagram of the construction of recombinant adeno-associated virus (rAAV) and the results of NanoLuc luciferase assay in the Luc-V2-R3 cell line after infection with rAAV carrying engineered inhibitory tRNA. Figure 1CC The structure of the scAAV-1xU6 vector is described in detail. The vector contains, from 5' to 3', a mutated adeno-associated virus inverted terminal repeat sequence (AAV2ΔITR), a U6 expression cassette (including U6 promoter, engineered inhibitory tRNA and poly-T termination signal), human cytomegalovirus enhancer (CMVenhancer), chicken β-actin promoter, reporter gene mCherry and a normal adeno-associated virus inverted terminal repeat sequence (AAV2 ITR). Fig. 1DD The results of the NanoLuc luciferase assay after the Luc-V2-R3 cell line was infected with rAAV carrying engineered inhibitory tRNA genes. In this experiment, rAAV was transduced into the Luc-V2-R3 cell line at a gradient of multiplicities of infection (MOIs), with the specific values ​​shown on the x-axis, and the values ​​increasing from right to left, and the y-axis represents relative fluorescence units (relative luminescence units). The bottom of the bar graph clearly indicates the chain type and serotype of AAV, and clearly indicates the specific engineered inhibitory tRNA genes carried by rAAV, which are R3-5 (such as Fig. 1DD As shown in the left figure), R3-5 (as Fig. 1DD As shown in the middle figure) and R3-147 (as shown in Fig. 1DD The error bars represent the standard deviation of biological triplicates.

[0025] FIG. 2A to FIG. 2J The results show that the tRNA Arg-TCT-1-1 from human (HGNC:34695, NCBI gene:100189133) (such as Figure 2A ) to a series of engineered inhibitory tRNAs: specifically, R3-147 ( Figure 2B )、M2( Figure 2C )、M3( Figure 2D )、M4( Figure 2E )、M5( Figure 2F )、M6( Figure 2G )、M7( Figure 2H )、M8( Fig.2I ) and M54( Figure 2J). Each panel depicts the secondary structure of the corresponding tRNA, where A, G, C, and U represent the relative positions of the bases adenine, guanine, cytosine, and uracil, respectively, dots represent base pairing, and numbers indicate the sequence Sprinzl position from 5' to 3'. In each figure, the T arm is on the right, the D arm is on the left, the anticodon arm is at the bottom (the three bases at the bottom of each schematic indicate a trinucleotide anticodon), and the acceptor arm is at the top. Figure 2B The arrow in shows the change in R3-147 compared to human tRNA Arg-TCT-1-1. FIG. 2B to FIG. 2J In the figure, the anticodon is marked in black, indicating that the anticodon has changed from UCU to UCA in the corresponding engineered inhibitory tRNA compared with human tRNA Arg-TCT-1-1. Figure 2C to Figure 2J The boxes in the figure show the changes in the corresponding engineered inhibitory tRNA compared to R3-147. Figure 2A Human tRNA Arg-TCT-1-1. Figure 2B The engineered inhibitory tRNA R3-147 (corresponding to the sequence shown in SEQ ID NO: 1) is displayed, whose anticodon is UCA (the anticodon of human tRNA Arg-TCT-1-1 is UCU), and the rest of the sequence is the same as human tRNA Arg-TCT-1-1. Figure 2C An engineered inhibitory tRNA M2 (ie, R3-147-M2, corresponding to the sequence shown in SEQ ID NO: 2) is shown, which has a U to C substitution at the fourth nucleotide after the 3' end of the anticodon of R3-147, and the rest of the sequence is the same as R3-147. Figure 2D An engineered inhibitory tRNA M3 (ie, R3-147-M3, corresponding to the sequence shown in SEQ ID NO: 3) is shown, which has a CCA sequence attached to the 3' end of the acceptor arm, and the rest of the sequence is identical to R3-147. Figure 2E An engineered inhibitory tRNA M4 (ie, R3-147-M4, corresponding to the sequence shown in SEQ ID NO: 4) was shown, which had an A to G substitution at the first nucleotide after the 3' end of the anticodon of R3-147, and the rest of the sequence was the same as R3-147. Figure 2F An engineered inhibitory tRNA M5 (ie, R3-147-M5, corresponding to the sequence shown in SEQ ID NO: 5) is shown, which contains nucleotide changes in both M2 and M3. Figure 2G An engineered inhibitory tRNA M6 (ie, R3-147-M6, corresponding to the sequence shown in SEQ ID NO:6) is shown, which contains nucleotide changes in both M2 and M4. Figure 2HAn engineered inhibitory tRNA M7 (ie, R3-147-M7, corresponding to the sequence shown in SEQ ID NO: 7) is shown, which contains nucleotide changes in both M3 and M4. Fig.2I An engineered inhibitory tRNA M8 (ie, R3-147-M8, corresponding to the sequence shown in SEQ ID NO: 8) is shown, which simultaneously comprises nucleotide changes in M1, M2, and M3. Figure 2J An engineered inhibitory tRNA M54 (ie, R3-147-M54, corresponding to the sequence shown in SEQ ID NO: 154) is shown, which contains nucleotide changes at both M2 and some other positions.

[0026] FIG. 3A to FIG. 3B demonstrated the engineering of inhibitory tRNA R3-5( Figure 3A ) and R3-8( Figure 3B ), where A, G, C, and U represent the relative positions of the bases adenine, guanine, cytosine, and uracil, respectively, dots represent base pairings, and numbers indicate the sequence Sprinzl positions from 5' to 3'. In each diagram, the T arm is on the right, the D arm is on the left, the anticodon arm is at the bottom (the three bases at the bottom of each diagram indicate a trinucleotide anticodon), and the acceptor arm is at the top. FIG. 3A to FIG. 3B In the figure, the anticodon is marked in black, indicating that the anticodon has been changed to UCA in the corresponding engineered inhibitory tRNA compared with its corresponding endogenous tRNA. Figure 3A The engineered tRNA R3-5 (whose sequence corresponds to SEQ ID NO: 13) is shown. The tRNA is derived from endogenous tRNA Arg-CCT-1-1 (whose sequence corresponds to SEQ ID NO: 32). The anticodon of Arg-CCT-1-1 is replaced from CCU to UCA, while the rest of the sequence remains consistent with the human tRNAArg-CCT-1-1. Figure 3B The engineered tRNA R3-8 (whose sequence corresponds to SEQ ID NO: 16) is presented. The tRNA is derived from endogenous tRNA Arg-CCT-4-1 (whose sequence corresponds to SEQ ID NO: 35). The anticodon of Arg-CCT-4-1 is replaced from CCU to UCA, while the rest of the sequence remains consistent with the human tRNA Arg-CCT-4-1.

[0027] Figure 4A Shows from Figure 1ANanoLuc luciferase assay results for the structural version Luc_V2_R3 described in . The test was performed on the modified engineered inhibitory tRNA M54 (i.e., R3-147-M54), comparing it with R3-147 and the negative control Scr1-4, and the specific experimental steps are as described in Example 3. The vertical axis represents the fold change in relative fluorescence units relative to cells transfected and expressing tRNAR3-147 plasmid, while the horizontal axis shows the tested engineered inhibitory tRNA. The error bars reflect the standard deviation of three biological replicates. The horizontal dotted line in the figure represents the baseline with a fold of 1.

[0028] Figure 4B-4C The effect of engineered inhibitory tRNA on the read-through of the PTC (premature stop codon) on the X-linked Alport syndrome-associated COL4A5 (Collagen alpha-5 (IV)) gene was demonstrated. Specifically, site-directed mutagenesis was performed on the COL4A5 gene in the A549 cell line, resulting in a read-through of position 1563 in the COL4A5 protein sequence (labeled "COL4A5 R1563", see Figure 4B Left panel) and position 373 (labeled “COL4A5 R373”, see Figure 4B The arginine codon in the right panel was converted to a stop codon (based on the NCBI reference sequence: NP_000486.1). Subsequently, cells were infected with lentivirus carrying various engineered inhibitory tRNAs. Figure 4B In the figure, RT-qPCR results show the relative levels of COL4A5 mRNA in samples treated with engineered inhibitory tRNA R3-147 and R3-147-M54 transduced with lentivirus. The x-axis indicates the sample name, and the y-axis shows the relative abundance of COL4A5 mRNA in A549 cells treated with PTC relative to the abundance of COL4A5 mRNA in wild-type (WT) samples (i.e., A549 cells without PTC) (this data has been GAPDH corrected). "Blank" represents PTC cells that were not treated with lentivirus and was used as a negative control. Error bars represent the standard deviation of three biological replicates. Figure 4C Figure 1 shows the results of an immunofluorescence analysis that measures the COL4A5 signal density normalized to the number of cells, showing the recovery of full-length COL4A5 protein in the COL4A5 R373*PTC cell line treated with lentivirus containing the engineered inhibitory tRNA R3-147-M54. The x-axis indicates the sample name, and "Blank" refers to PTC cells that were not treated with lentivirus and used as a negative control. Cells treated with only the secondary antibody were also included in the analysis to confirm that the observed signal was not due to nonspecific binding.

[0029] FIG. 4D to FIG. 4F Shown is a schematic diagram of the construction of recombinant adeno-associated virus (rAAV) and the results of NanoLuc luciferase assay in the Luc-V2-R3 cell line after infection with rAAV carrying engineered inhibitory tRNA. Figure 4D The structure of the ssAAV-2xU6 vector is depicted in detail. The vector contains, from 5' to 3', the following: adeno-associated virus inverted terminal repeat sequence (AAV2 ITR), two identical U6 expression cassettes (each cassette contains a U6 promoter, engineered inhibitory tRNA and a poly-T termination signal (poly(T) signal)), a human cytomegalovirus enhancer (CMV enhancer), a chicken β-actin promoter (chickenβ-actin promoter), a reporter gene mCherry, a poly A signal (ploy(A) signal) and another AAV2 ITR. Figure 4E and Figure 4F The NanoLuc luciferase assay results (left panel) and transduction efficiency (right panel, assessed by measuring the proportion of mCherry-positive cells) after rAAV carrying the ssAAV-2xU6 vector carrying the engineered inhibitory tRNA gene was shown. In this experiment, rAAV was transduced into the Luc-V2-R3 cell line at a gradient of multiplicities of infection (MOIs), as shown on the x-axis, increasing from right to left. The y-axis of the bar graph in the left panel represents relative luminescence units, while the y-axis of the bar graph in the right panel represents the percentage of mCherry-positive cells (mCherry+cells(%)). The bottom of the bar graph indicates the chain type and serotype of AAV, and indicates the specific engineered inhibitory tRNA genes carried in the rAAV, which are R3-147 ( Figure 4E ) and R3-147-M54( Figure 4F ). Error bars represent standard deviation of biological triplicates.

[0030] Figure 4G-4H demonstrated that male X-linked Alport syndrome mice injected with Figure 4DChanges in the relative levels of urine protein in mice after being injected with ssAAV2 / 9 constructed in . These mice have a premature stop codon (PTC) mutation at position 471 of the COL4A5 protein sequence (based on NCBI reference sequence: NP_000486.1), that is, the arginine codon is converted to PTC ("COL4A5-R471*"). In the figure, the y-axis represents the ratio of urine albumin (U-ALB) to urine creatinine (U-CRE), as an indicator of disease progression; the x-axis represents the age of the mouse (in weeks). Figure 4G In the figure, mice were classified according to the dose of rAAV injected: mice injected with normal saline ("Normal Saline", n=9) are represented by a black solid line; mice injected with a dose of 5E11 vg of rAAV (carrying engineered inhibitory tRNA R3-147) per mouse ("ssAAV2 / 9_R3-147 5E11 vg", n=9) are represented by a black dashed line; mice injected with a dose of 1.5E12 v.g. of rAAV (carrying engineered inhibitory tRNA R3-147) per mouse ("ssAAV2 / 9_R3-147 1.5E12 vg", n=9) are represented by a black dotted line; wild-type Col4a5 mice ("Col4a5 WT / Y mouse", n=3) are represented by a gray solid line. Tail vein injections were performed at 4 weeks of age, as indicated by the arrows below the figure. Error bars represent the standard deviation of repeated experiments. Figure 4H In the figure, mice were also categorized according to the dose of rAAV injected: mice injected with normal saline ("Normal Saline", n = 6) are represented by gray solid line; mice injected with 1.5E11 vg of rAAV (carrying engineered inhibitory tRNA R3-147-M54) per mouse ("ssAAV2 / 9_R3-147-M54 1.5E11 vg", n = 6) are represented by black solid line; mice injected with 5E11 vg of rAAV (carrying engineered inhibitory tRNA R3-147-M54) per mouse ("ssAAV2 / 9_R3-147-M54 5E11 vg", n = 6) are represented by black dashed line; mice injected with 1.5E12 vg of rAAV (carrying engineered inhibitory tRNA R3-147-M54) per mouse Mice with ssAAV2 / 9_R3-147-M54 ("ssAAV2 / 9_R3-147-M54 1.5E12 vg", n=6) are indicated by black dotted lines. Tail vein injections were also performed at 4 weeks of age, as indicated by the arrows below the graph. Error bars represent standard deviations of replicate experiments. DETAILED DESCRIPTION

[0031] The present invention provides an innovative engineered arginine-carrying tRNA (also referred to herein as "engineered inhibitory tRNA" or "inhibitory tRNA"), which is designed to inhibit premature UGA / TGA stop codons. Compared with those inhibitory tRNAs that have been extensively screened and identified as being particularly efficient in inhibiting premature UGA / TGA stop codons, the engineered inhibitory tRNA of the present invention incorporates one or more carefully designed modifications. These modifications mainly include: i) substitution of A to G at the first nucleotide position after the 3' end of the anticodon; ii) substitution of U to C at the fourth nucleotide position after the 3' end of the anticodon; and iii) introduction of a CCA sequence in the nucleic acid sequence encoding the inhibitory tRNA to ensure that it is connected to the 3' end of the acceptor arm. The clever integration of these modifications further improves the read-through efficiency, allowing the engineered tRNA to show excellent performance in inhibiting premature stop codons. It is worth noting that during the biosynthesis of natural tRNA, the 3' end of its acceptor arm usually adds a CCA sequence in the post-transcriptional stage. However, surprisingly, compared with adding the CCA sequence in post-transcriptional processing, a higher read-through efficiency was observed when the CCA sequence was directly introduced into the nucleic acid sequence encoding the inhibitory tRNA. This extraordinary discovery reveals that a slight adjustment of the nucleotide sequence of the inhibitory tRNA can significantly optimize its performance, which is undoubtedly a surprising discovery worthy of further exploration.

[0032] Therefore, an important aspect of the present invention is to provide eight engineered inhibitory tRNAs specifically for carrying arginine, which can accurately recognize and effectively read through the premature UGA / TGA stop codon. Compared with the inhibitory tRNA having the sequence of SEQ ID NO:1, the engineered inhibitory tRNA in the present invention incorporates one or more modifications. In addition, the present invention also covers nucleic acid sequences encoding the engineered inhibitory tRNA, expression cassettes and vectors containing such nucleic acids, and specific methods of using engineered inhibitory tRNAs, nucleic acids encoding engineered inhibitory tRNAs, expression cassettes and vectors.

[0033] I. Definitions

[0034] Unless otherwise expressly defined herein, all professional terms, symbols, and other technical and scientific terms or expressions used are intended to have the same meaning as commonly understood by those of ordinary skill in the art related to the subject matter of the patent. In certain embodiments, some terms with commonly understood meanings are defined for clarity of expression and / or ease of reference. However, the inclusion of such definitions herein does not imply a substantial difference from the meanings generally understood in the art.

[0035] In various parts of the present disclosure, various aspects of the patent subject matter are described in a range format. It should be understood that the description of this range format is only for convenience and brevity, and should not be interpreted as a fixed or immutable limitation on the scope of the patent subject matter. Therefore, it should be considered that the description of the range has implicitly disclosed all possible sub-ranges within the range, as well as the various numerical values ​​within the range. For example, when providing a numerical range, it should be understood that each intermediate value between the upper and lower limits of the range, as well as any other explicitly stated values ​​or intermediate values ​​within the range, are included in the scope of the patent subject matter. The upper and lower limits of these smaller ranges can be independently included in a smaller range, and are also included in the scope of the patent subject matter, subject to any explicitly excluded restrictions in the stated range. If the range includes one or two limiting values, then the range excluding any one or two of these limiting values ​​is also included in the patent subject matter. This principle applies regardless of the width of the range.

[0036] As used herein, the terms "transfer RNA", "transfer RNA" or "tRNA" all refer to nucleic acid molecules that assist in the translation of mRNA into protein. At the same time, "anticodon", "anticodon" and "anti-codon" are used interchangeably herein as synonyms. Each tRNA is able to "carry" the amino acid corresponding to the mRNA codon recognized by its anticodon, and this process may be mediated by aminoacyl-tRNA synthetase.

[0037] As used herein, "premature stop codon", "premature stop codon", "premature termination codon" and "PTC" are used synonymously to refer to a stop codon that, when present, results in the production of an abnormal truncated product relative to the wild-type polypeptide.

[0038] "Engineered tRNA" herein refers to a tRNA having at least one difference in its sequence compared to a reference wild-type tRNA (e.g., relative to human tRNA Arg-TCT-1-1). "Inhibitory tRNA," "engineered inhibitory tRNA," "tRNA inhibitor," or "engineered tRNA inhibitor" refers to engineered tRNAs that can inhibit premature stop codons in mRNAs from terminating translation.

[0039] As used herein, "effective amount" refers to an amount sufficient to achieve the desired effect.

[0040] Herein, the term "restoration" with respect to protein expression refers to the ability to stably express full-length protein from mRNA containing a PTC, whereas the protein expression was previously truncated due to the presence of the PTC.

[0041] As used herein, the term "mutation" refers to a change in a nucleic acid sequence and / or polypeptide sequence relative to a reference sequence.

[0042] As used herein, the terms "disease," "disorder," "disease state," or "disease phenotype" refer to one or more characteristics of a mammalian cell caused by a stop codon within a coding region of a gene within the cell (eg, caused by a nonsense mutation).

[0043] In this article, the term "cell transduction" refers to the process of introducing nucleic acids into cells using DNA or RNA viruses rather than transfection. In particular, RNA viruses that introduce nucleic acids into cells are retroviruses or lentiviruses. The exogenous genetic material carried by these viruses will be integrated into the genome of the transduced cells. In contrast, cells that are "transduced" using chimeric DNA viruses (such as adeno-associated viruses) do not integrate exogenous genetic material into their genomes, but can express these exogenous genetic materials in the form of extra chromosomes inside the cells. "Transduced genes" refer to genes introduced into cells through viral infection and proviral integration.

[0044] The term "expression cassette" herein refers to a nucleic acid sequence that is capable of directing the expression of a specific nucleotide sequence in an appropriate host cell.

[0045] The term "operably linked" herein refers to different nucleic acid sequences being associated with each other on a single nucleic acid fragment so that the function of one sequence is affected by the other sequence. For example, in some cases, when the regulatory DNA sequence in the two sequences affects the expression of the coding DNA sequence (i.e., the coding sequence is under the transcriptional control of the promoter), we can consider the regulatory DNA sequence to be "operably linked" or "associated" with the DNA sequence encoding RNA or polypeptide.

[0046] The use of ordinal terms such as "first", "second", "third", etc. to modify claim elements in the claims does not imply any priority, precedence or order to these elements, nor does it imply an order of execution of the method. These ordinal terms are merely used as labels to distinguish a claim element with a particular name from another claim element with the same name (but using an ordinal term). Similarly, the use of labels such as a), b), etc. or i), ii), etc., by themselves, does not imply any priority, precedence or order to the steps in the claim. The use of these terms in the specification also does not imply any prescribed priority, precedence or order.

[0047] Unless the context clearly indicates otherwise, in this specification and the appended claims, the singular forms "a / an" should be understood to include the plural forms. Thus, for example, when referring to "a molecule", this actually includes a plurality of molecules and the like.

[0048] The term "about" as used herein refers to the usual error range of the corresponding value recognized by those skilled in the art. Reference to "about" values ​​or parameters includes (and describes) embodiments involving the value or parameter itself.

[0049] The term "nucleic acid" herein generally refers to a polymer comprising one or more nucleic acid subunits or nucleotides. These nucleic acids may include one or more subunits selected from adenine (A), cytosine (C), guanine (G), thymine (T) and uracil (U) or their variants. Nucleotides may include A, C, G, T, U or their variants, and any subunits that participate in nucleic acid chain growth. Such subunits may be A, C, G, T or U, or one or more subunits specifically complementary to A, C, G, T or U, or any other subunit complementary to purine (e.g., A or G, or their variants) or pyrimidine (e.g., C, T or U or their variants). Subunits may be decomposed into individual nucleic acid bases or base groups (e.g., AA, TA, AT, GC, CG, CT, TC, GT, TG, AC, CA or their uracil counterparts). In some examples, nucleic acids are deoxyribonucleic acids (DNA) or ribonucleic acids (RNA) or their derivatives, and may be single-stranded or double-stranded.

[0050] The terms "polynucleotide", "nucleic acid molecule", "nucleic acid sequence" or "nucleotide sequence" herein generally refer to a polymer of nucleotides (ribonucleotides or deoxyribonucleotides) of any length with given sequence information, and it may be necessary to know the presence or quantity of the given nucleic acid sequence. This includes, but is not limited to, single-stranded, double-stranded or multi-stranded DNA or RNA; genomic DNA; cDNA; DNA-RNA hybrids; or polymers including purine and pyrimidine bases or other natural, chemically modified or biochemically modified nucleotide bases, and non-natural or derived nucleotide bases. The backbone of the polynucleotide may contain sugar and phosphate groups commonly found in RNA or DNA, or modified or replaced sugar or phosphate groups. The nucleotide sequence may contain RNA or DNA, or a sequence derived from RNA or DNA. Typical nucleotide sequences are, for example, natural or synthetic RNA or DNA (including genomic DNA and messenger RNA) sequences.

[0051] As used herein, the term "sequencing" generally refers to methods and techniques for determining the sequence of nucleotide bases in one or more polynucleotides. These polynucleotides can be nucleic acid molecules, such as DNA or RNA and variants or derivatives thereof (such as single-stranded DNA). Sequencing can be performed by a variety of currently available systems, including but not limited to Sanger sequencing, Pacific Biosciences Oxford or Life Technologies Etc. In addition, sequencing can also be performed in combination with nucleic acid amplification technology, polymerase chain reaction (PCR) (e.g., digital PCR, quantitative PCR, or real-time PCR) or isothermal amplification technology. Such systems can generate a variety of raw genetic data corresponding to the genetic information of the subject based on the sample provided by the subject.

[0052] The term "treatment" as used herein refers to a drug or other interventional regimen from which a recipient obtains a beneficial or desired result. These beneficial or desired results include, but are not limited to, one or more therapeutic benefits and / or preventive benefits. "Therapeutic benefit" may be understood as the eradication or amelioration of symptoms or underlying disease. "Preventive effect" may be understood as delaying, preventing or eliminating the onset of a disease or condition, delaying or eliminating the onset of symptoms of a disease or condition, slowing, stopping or reversing the progression of a disease or condition, or any combination thereof, even if a diagnosis of the disease may not yet be determined.

[0053] II. Transfer RNA Sequence and Structure

[0054] Transfer RNAs (tRNAs) are typically RNA molecules of approximately 70-90 nucleotides in length. They fold into a cloverleaf-like secondary structure consisting of three hairpin loop "arms" and an acceptor arm containing the 3' and 5' ends of the tRNA. From 5' to 3', the structure of the tRNA consists of: a D stem and its terminal D loop, an anticodon stem and its terminal anticodon loop (which contains a three-nucleotide anticodon sequence), a variable region, and a T stem and its terminal T loop. The function of the anticodon is to recognize the corresponding codon on the mRNA. During natural tRNA processing, a 3'CCA tail is added to the end of the tRNA after transcription, and this sequence is not usually present in the DNA sequence encoding the tRNA in mammalian cells.

[0055] tRNA acts as a linker, linking mRNA to its protein product by recognizing the codon on the mRNA and adding the amino acid it carries to the peptide chain. When tRNA recognizes the codon corresponding to its anticodon, it transfers the amino acid it carries to the growing amino acid chain to form a polypeptide or protein. Endogenous tRNA can be loaded with the corresponding amino acid by endogenous aminoacyl-tRNA synthetase.

[0056] The synthesis and processing of tRNA involves multiple steps, including transcription into precursor tRNA (pre-tRNA) by polymerase, followed by intron splicing by splicing endonuclease (this step is only performed on tRNA containing introns, not every tRNA contains introns), followed by cleavage of the 5' and 3' ends by endonucleases and / or exonucleases, followed by addition of a CCA tail by nucleotidyltransferases, and finally modification of multiple nucleotide residues (Sekulovski S, Trowitzsch S. Transfer RNA processing-from a structural and disease perspective. Biol Chem. 2022 Jun 21; 403(8-9): 749-763. doi: 10.1515 / hsz-2021-0406. PMID: 35728022). Each step requires a series of proteases and energy (Sekulovski S, Trowitzsch S. Transfer RNA processing-from a structural and disease perspective. Biol Chem. 2022 Jun 21;403(8-9):749-763. doi:10.1515 / hsz-2021-0406. PMID:35728022).

[0057] The standard Sprinzl positioning method (MSprinzl., et al. (1998) Compilation of tRNA sequences and sequences of tRNA genes. Nucleic Acids Res. January; 26(1): 148-53. doi: 10.1093 / nar / 26.1.148) is usually used to describe the nucleotide positions on tRNA. This system assigns specific numbers to each nucleotide based on the clover-shaped secondary structure of tRNA.

[0058] The present invention provides an engineered inhibitory tRNA for carrying arginine, wherein the nucleotide sequence is as shown in any one of SEQ ID NOs: 2-8 and 154, the engineered inhibitory tRNA comprises a T arm, a D arm, an anticodon arm, a variable region and an acceptor arm, wherein the anticodon arm comprises a trinucleotide anticodon, wherein the anticodon is 5'-UCA-3' and recognizes a UGA stop codon, wherein the engineered inhibitory tRNA comprises one or more modifications compared to a tRNA having a sequence of SEQ ID NO: 1, and wherein the one or more modifications are selected from:

[0059] i) an A to G substitution at the first nucleotide after the 3' end of the anticodon (i.e., Sprinz1 position 37); ii) a U to C substitution at the fourth nucleotide after the 3' end of the anticodon (i.e., Sprinz1 position 40); and iii) a CCA sequence attached to the 3' end of the acceptor arm (e.g., introduced on the nucleic acid encoding the inhibitory tRNA or on the isolated tRNA).

[0060] In some embodiments, an engineered inhibitory tRNA for carrying arginine is provided, wherein the nucleotide sequence is as shown in SEQ ID NO: 4. The engineered inhibitory tRNA comprises a T arm, a D arm, an anticodon arm, a variable region, and an acceptor arm, wherein the anticodon arm comprises a trinucleotide anticodon 5'-UCA-3', which can recognize the UGA stop codon. Compared to the tRNA having the sequence of SEQ ID NO: 1, the engineered inhibitory tRNA has an A to G substitution at the first nucleotide after the 3' end of the anticodon (i.e., Sprinz1 position 37).

[0061] In some embodiments, an engineered inhibitory tRNA for carrying arginine is provided, wherein the nucleotide sequence is as shown in SEQ ID NO: 2. The engineered inhibitory tRNA comprises a T arm, a D arm, an anticodon arm, a variable region, and an acceptor arm, wherein the anticodon arm comprises a trinucleotide anticodon 5'-UCA-3', which can recognize the UGA stop codon. Compared to the tRNA with the sequence of SEQ ID NO: 1, the engineered inhibitory tRNA has a U to C substitution at the 4th nucleotide after the 3' end of the anticodon (i.e., Sprinz1 position 40).

[0062] In some embodiments, an engineered inhibitory tRNA for carrying arginine is provided, wherein the nucleotide sequence is as shown in SEQ ID NO: 3. The engineered inhibitory tRNA comprises a T arm, a D arm, an anticodon arm, a variable region, and an acceptor arm, wherein the anticodon arm comprises a trinucleotide anticodon 5'-UCA-3', which can recognize the UGA stop codon. Compared to the tRNA having the sequence of SEQ ID NO: 1, the engineered inhibitory tRNA has a CCA sequence attached to the 3' end of the acceptor arm, and this modification can be introduced on the nucleic acid encoding the engineered inhibitory tRNA, or on the isolated tRNA.

[0063] In some embodiments, an engineered inhibitory tRNA for carrying arginine is provided, wherein the nucleotide sequence is as shown in SEQ ID NO:6. The engineered inhibitory tRNA comprises a T arm, a D arm, an anticodon arm, a variable region, and an acceptor arm, wherein the anticodon arm comprises a trinucleotide anticodon 5'-UCA-3', which can recognize the UGA stop codon. Compared to the tRNA with the sequence of SEQ ID NO:1, the engineered inhibitory tRNA has both an A to G substitution at the first nucleotide after the 3' end of the anticodon (i.e., Sprinz1 position 37), and an U to C substitution at the fourth nucleotide after the 3' end of the anticodon (i.e., Sprinz1 position 40).

[0064] In some embodiments, an engineered inhibitory tRNA for carrying arginine is provided, wherein the nucleotide sequence is as shown in SEQ ID NO: 7. The engineered inhibitory tRNA comprises a T arm, a D arm, an anticodon arm, a variable region, and an acceptor arm, wherein the anticodon arm comprises a trinucleotide anticodon 5'-UCA-3', which can recognize the UGA stop codon. Compared to the tRNA with the sequence of SEQ ID NO: 1, the engineered inhibitory tRNA has both an A to G substitution at the first nucleotide after the 3' end of the anticodon (i.e., Sprinz1 position 37), and a CCA sequence is attached to the 3' end of the acceptor arm.

[0065] In some embodiments, an engineered inhibitory tRNA for carrying arginine is provided, wherein the nucleotide sequence is as shown in SEQ ID NO:5. The engineered inhibitory tRNA comprises a T arm, a D arm, an anticodon arm, a variable region, and an acceptor arm, wherein the anticodon arm comprises a trinucleotide anticodon 5'-UCA-3', which can recognize the UGA stop codon. Compared to the tRNA with the SEQ ID NO:1 sequence, the engineered inhibitory tRNA has both a U to C substitution at the 4th nucleotide after the 3' end of the anticodon (i.e., Sprinz1 position 40), and a CCA sequence is attached to the 3' end of the acceptor arm.

[0066] In some embodiments, an engineered inhibitory tRNA for carrying arginine is provided, wherein the nucleotide sequence is as shown in SEQ ID NO:8. The engineered inhibitory tRNA comprises a T arm, a D arm, an anticodon arm, a variable region, and an acceptor arm, wherein the anticodon arm comprises a trinucleotide anticodon 5'-UCA-3', which can recognize the UGA stop codon. Compared to the tRNA with the SEQ ID NO:1 sequence, the engineered inhibitory tRNA has both an A to G substitution at the first nucleotide after the 3' end of the anticodon (i.e., Sprinz1 position 37), and an U to C substitution at the fourth nucleotide after the 3' end of the anticodon (i.e., Sprinz1 position 40), and a CCA sequence is attached to the 3' end of the acceptor arm.

[0067] In some embodiments, an engineered inhibitory tRNA for carrying arginine is provided, wherein the nucleotide sequence is as shown in SEQ ID NO: 154. The engineered inhibitory tRNA comprises a T arm, a D arm, an anticodon arm, a variable region, and an acceptor arm, wherein the anticodon arm comprises a trinucleotide anticodon 5'-UCA-3', which can recognize the UGA stop codon. Compared to the tRNA with the sequence of SEQ ID NO: 1, the engineered inhibitory tRNA has a U to C substitution at the 4th nucleotide after the 3' end of the anticodon (i.e., Sprinz1 position 40), and also has nucleotide substitutions at other positions.

[0068] In some embodiments, the engineered inhibitory tRNA can be any one of the nucleic acid sequences in SEQ ID NO: 2-8 and 154. In some embodiments, the engineered inhibitory tRNA sequence can also include any one of the nucleic acid sequences in SEQ ID NO: 2-8 and 154. In some embodiments, introns of any length are inserted into the engineered inhibitory tRNA sequence, and these introns will be spliced ​​during the tRNA maturation process. In some embodiments, engineered precursor tRNAs that can be processed into any of the above-mentioned engineered inhibitory tRNAs are also included.

[0069] In some embodiments, one or more nucleotides in the engineered inhibitory tRNA sequence are chemically modified. These chemical modifications include, but are not limited to, pseudouracil, inosine, wyosine, wyobutyric acid, acetyl, isopentenyl, hydroxyl, peroxy, ribosyl, carbamoyl, carboxyl, methoxy, carbonyl, methyl, dimethyl, trimethyl, formyl, cyano, galactosyl, glutamyl, fluoro, methoxyethyl, ethyl, phosphate, amide, ester, amino, or "modified residues" (Genesilico, https: / / genesilico.pl / modomics / modifications , accessed on July 25, 2023) or any combination of the above modifications. In some embodiments, the engineered inhibitory tRNA may include a chemical modification comprising a methyl group, a fluoro group, a methoxyethyl group, an ethyl group, a phosphate group, an amide group, an ester group, or any combination of the above modifications.

[0070] In some embodiments, the engineered inhibitory tRNA is exogenously synthesized. In some embodiments, the engineered inhibitory tRNA comprises both a deoxyribonucleic acid sequence (DNA) and a ribonucleic acid sequence (RNA). Specifically, when the engineered inhibitory tRNA comprises both a DNA and an RNA sequence, it can be a single ribonucleotide contained in the DNA sequence, or a single deoxyribonucleotide contained in the RNA sequence. In addition, in some embodiments, the engineered inhibitory tRNA comprises both a DNA sequence and an RNA sequence. Finally, in some embodiments, the engineered inhibitory tRNA is transcribed from a DNA template sequence or its reverse, complementary, or reverse complementary corresponding sequence. III. Nucleic Acids Encoding Engineered Inhibitory tRNA

[0071] The engineered inhibitory tRNA of the present invention can be encoded by a nucleic acid. Therefore, in certain aspects, the present invention provides a nucleic acid encoding an engineered inhibitory tRNA of the present invention. In some embodiments, the nucleic acid is DNA. In some embodiments, the nucleic acid is RNA. In other embodiments, the nucleic acid is directly tRNA.

[0072] In another aspect, the present invention provides a nucleic acid encoding an engineered inhibitory tRNA for carrying arginine of the present invention (or an expression cassette comprising such a nucleic acid, or a vector comprising such an expression cassette, such as a viral vector). In addition, the present invention also provides a nucleic acid encoding a precursor of the engineered inhibitory tRNA of the present invention (or an expression cassette comprising such a nucleic acid, or a vector comprising such an expression cassette, such as a viral vector). The precursor can be processed to form an engineered inhibitory tRNA for carrying arginine, and its structural features are the same as those of the above-mentioned engineered inhibitory tRNA, and it also contains one or more specific modifications.

[0073] In some embodiments, the present invention provides a nucleic acid encoding an engineered inhibitory tRNA for carrying arginine according to the present invention (or an expression cassette comprising such a nucleic acid, or a vector comprising such an expression cassette, such as a viral vector). The engineered inhibitory tRNA comprises a nucleotide sequence of SEQ ID NO: 4, which comprises a T arm, a D arm, an anticodon arm, a variable region, and an acceptor arm, wherein the anticodon arm comprises a trinucleotide anticodon 5'-UCA-3', which can recognize a UGA stop codon. Compared with a tRNA having a sequence of SEQ ID NO: 1, the engineered inhibitory tRNA has a substitution of A to G at the first nucleotide after the 3' end of the anticodon (i.e., Sprinz1 position 37). In some embodiments, the nucleic acid encoding the engineered inhibitory tRNA comprises a nucleotide sequence of SEQ ID NO: 4, or its reverse, complementary, or reverse complementary sequence. In some embodiments, the nucleic acid encoding the engineered inhibitory tRNA comprises a DNA sequence encoding a nucleotide sequence of SEQ ID NO: 4, or its reverse, complementary, or reverse complementary sequence.

[0074] In some embodiments, the present invention provides a nucleic acid encoding an engineered inhibitory tRNA for carrying arginine according to the present invention (or an expression cassette comprising such a nucleic acid, or a vector comprising such an expression cassette, such as a viral vector). The engineered inhibitory tRNA comprises a nucleotide sequence of SEQ ID NO: 2, which comprises a T arm, a D arm, an anticodon arm, a variable region, and an acceptor arm, wherein the anticodon arm comprises a trinucleotide anticodon 5'-UCA-3', which can recognize a UGA stop codon. Compared with a tRNA having a sequence of SEQ ID NO: 1, the engineered inhibitory tRNA has a U to C substitution at the 4th nucleotide after the 3' end of the anticodon (i.e., Sprinz1 position 40). In some embodiments, the nucleic acid encoding the engineered inhibitory tRNA comprises a nucleotide sequence of SEQ ID NO: 2, or its reverse, complementary, or reverse complementary sequence. In some embodiments, the nucleic acid encoding the engineered inhibitory tRNA comprises a DNA sequence encoding a nucleotide sequence of SEQ ID NO: 2, or its reverse, complementary, or reverse complementary sequence.

[0075] In some embodiments, the present invention provides a nucleic acid encoding an engineered inhibitory tRNA for carrying arginine according to the present invention (or an expression cassette comprising such a nucleic acid, or a vector comprising such an expression cassette, such as a viral vector). The engineered inhibitory tRNA comprises a nucleotide sequence of SEQ ID NO: 3, which comprises a T arm, a D arm, an anticodon arm, a variable region, and an acceptor arm, wherein the anticodon arm comprises a trinucleotide anticodon 5'-UCA-3', which can recognize a UGA stop codon. Compared with the tRNA having the sequence of SEQ ID NO: 1, the engineered inhibitory tRNA has a CCA sequence attached to the 3' end of the acceptor arm, and this feature can be achieved by introducing a corresponding sequence into the nucleic acid encoding the engineered inhibitory tRNA, or directly modifying the isolated tRNA. In some embodiments, the nucleic acid encoding the engineered inhibitory tRNA comprises a nucleotide sequence of SEQ ID NO: 3, or its reverse, complementary, or reverse complementary sequence. In some embodiments, the nucleic acid encoding the engineered inhibitory tRNA comprises a DNA sequence encoding a nucleotide sequence of SEQ ID NO: 3, or its reverse, complementary, or reverse complementary sequence.

[0076] In some embodiments, the present invention provides a nucleic acid encoding an engineered inhibitory tRNA for carrying arginine of the present invention (or an expression cassette comprising such a nucleic acid, or a vector comprising such an expression cassette, such as a viral vector). The engineered inhibitory tRNA comprises a nucleotide sequence of SEQ ID NO: 6, which comprises a T arm, a D arm, an anticodon arm, a variable region, and an acceptor arm, wherein the anticodon arm comprises a trinucleotide anticodon 5'-UCA-3', which can recognize a UGA stop codon. Compared with a tRNA having a sequence of SEQ ID NO: 1, the engineered inhibitory tRNA has a U to C substitution at the 4th nucleotide after the 3' end of the anticodon (i.e., Sprinz1 position 40), and an A to G substitution at the 1st nucleotide after the 3' end of the anticodon (i.e., Sprinz1 position 37). In some embodiments, the nucleic acid encoding the engineered inhibitory tRNA comprises a nucleotide sequence of SEQ ID NO: 6, or its reverse, complementary, or reverse complementary sequence. In some embodiments, the nucleic acid encoding the engineered inhibitory tRNA comprises a DNA sequence encoding the nucleotide sequence of SEQ ID NO: 6, or its reverse, complementary, or reverse complementary sequence.

[0077] In some embodiments, the present invention provides a nucleic acid encoding an engineered inhibitory tRNA for carrying arginine according to the present invention (or an expression cassette comprising such a nucleic acid, or a vector comprising such an expression cassette, such as a viral vector). The engineered inhibitory tRNA comprises a nucleotide sequence of SEQ ID NO:7, which comprises a T arm, a D arm, an anticodon arm, a variable region, and an acceptor arm, wherein the anticodon arm comprises a trinucleotide anticodon 5'-UCA-3', which can recognize a UGA stop codon. Compared with the tRNA having the sequence of SEQ ID NO:1, the engineered inhibitory tRNA undergoes a substitution of A to G at the first nucleotide after the 3' end of the anticodon (i.e., Sprinzl position 37), and a CCA sequence is attached to the 3' end of the acceptor arm (this feature can be achieved by introducing a corresponding sequence into the nucleic acid encoding the engineered inhibitory tRNA, or directly modifying the isolated tRNA). In some embodiments, the nucleic acid encoding the engineered inhibitory tRNA comprises a nucleotide sequence of SEQ ID NO:7, or its reverse, complementary, or reverse complementary sequence. In some embodiments, the nucleic acid encoding the engineered inhibitory tRNA comprises a DNA sequence encoding the nucleotide sequence of SEQ ID NO: 7, or its reverse, complementary, or reverse complementary sequence.

[0078] In some embodiments, the present invention provides a nucleic acid encoding an engineered inhibitory tRNA for carrying arginine according to the present invention (or an expression cassette comprising such a nucleic acid, or a vector comprising such an expression cassette, such as a viral vector). The engineered inhibitory tRNA comprises a nucleotide sequence of SEQ ID NO:5, which comprises a T arm, a D arm, an anticodon arm, a variable region, and an acceptor arm, wherein the anticodon arm comprises a trinucleotide anticodon 5'-UCA-3', which can recognize a UGA stop codon. Compared with the tRNA having the sequence of SEQ ID NO:1, the engineered inhibitory tRNA undergoes a U to C substitution at the 4th nucleotide after the 3' end of the anticodon (i.e., Sprinzl position 40), and a CCA sequence is attached to the 3' end of the acceptor arm (this feature can be achieved by introducing a corresponding sequence into the nucleic acid encoding the engineered inhibitory tRNA, or by directly modifying the isolated tRNA). In some embodiments, the nucleic acid encoding the engineered inhibitory tRNA comprises a nucleotide sequence of SEQ ID NO:5, or its reverse, complementary, or reverse complementary sequence. In some embodiments, the nucleic acid encoding the engineered inhibitory tRNA comprises a DNA sequence encoding the nucleotide sequence of SEQ ID NO: 5, or its reverse, complementary, or reverse complementary sequence.

[0079] In some embodiments, the present invention provides a nucleic acid encoding an engineered inhibitory tRNA for carrying arginine of the present invention (or an expression cassette comprising such a nucleic acid, or a vector comprising such an expression cassette, such as a viral vector). The engineered inhibitory tRNA comprises a nucleotide sequence of SEQ ID NO: 8, which comprises a T arm, a D arm, an anticodon arm, a variable region, and an acceptor arm, wherein the anticodon arm comprises a trinucleotide anticodon 5'-UCA-3', which can recognize a UGA stop codon. Compared with the tRNA having the sequence of SEQ ID NO: 1, the engineered inhibitory tRNA has a U to C substitution at the 4th nucleotide after the 3' end of the anticodon (i.e., Sprinz1 position 40), and an A to G substitution at the 1st nucleotide after the 3' end of the anticodon (i.e., Sprinz1 position 37), and a CCA sequence is attached to the 3' end of the acceptor arm (this feature can be achieved by introducing the corresponding sequence into the nucleic acid encoding the engineered inhibitory tRNA, or directly modifying the isolated tRNA). In some embodiments, the nucleic acid encoding the engineered inhibitory tRNA comprises the nucleotide sequence of SEQ ID NO: 8, or its reverse, complementary, or reverse complementary sequence. In some embodiments, the nucleic acid encoding the engineered inhibitory tRNA comprises a DNA sequence encoding the nucleotide sequence of SEQ ID NO: 8, or its reverse, complementary, or reverse complementary sequence.

[0080] In some embodiments, the present invention provides a nucleic acid encoding an engineered inhibitory tRNA for carrying arginine according to the present invention (or an expression cassette comprising such a nucleic acid, or a vector comprising such an expression cassette, such as a viral vector). The engineered inhibitory tRNA comprises the nucleotide sequence of SEQ ID NO: 154, which comprises a T arm, a D arm, an anticodon arm, a variable region, and an acceptor arm, wherein the anticodon arm comprises a trinucleotide anticodon 5'-UCA-3', which can recognize a UGA stop codon. Compared with the tRNA having the sequence of SEQ ID NO: 1, the engineered inhibitory tRNA undergoes a U to C substitution at the 4th nucleotide after the 3' end of the anticodon (i.e., Sprinzl position 40), and nucleotide substitutions also occur at other positions. In some embodiments, the nucleic acid encoding the engineered inhibitory tRNA comprises the nucleotide sequence of SEQ ID NO: 154, or its reverse, complementary, or reverse complementary sequence. In some embodiments, the nucleic acid encoding the engineered inhibitory tRNA comprises a DNA sequence encoding the nucleotide sequence of SEQ ID NO: 154, or its reverse, complementary, or reverse complementary sequence.

[0081] In some embodiments, the present invention provides a nucleic acid molecule comprising RNA, wherein the sequence contained in the RNA molecule can encode any engineered inhibitory tRNA sequence selected from SEQ ID NOs: 2-8 and 154. In addition, in some embodiments, a nucleic acid molecule comprising DNA is also provided, wherein the sequence contained in the DNA molecule can also encode any engineered inhibitory tRNA sequence selected from SEQ ID NOs: 2-8 and 154.

[0082] IV. Nonsense Mutation Suppression

[0083] The present invention provides engineered arginine transfer RNA (Arg tRNA) molecules that can inhibit UGA / TGA premature stop codons, thereby achieving read-through of premature UGA stop codons present in template mRNA. These molecules are also referred to as "engineered tRNA inhibitory molecules," "engineered inhibitory tRNAs," "inhibitory tRNAs," "sup-tRNAs," "engineered tRNA inhibitors," or "Arg-UGA sup-tRNAs." In this article, "inhibition" and "read-through" are used interchangeably and refer to the activity of the engineered inhibitory tRNA disclosed herein.

[0084] The engineered inhibitory tRNA of the present invention has an anticodon sequence that base pairs with the UGA / TGA premature termination codon (also referred to herein as PTC). This enables the engineered inhibitory tRNA to add arginine to the growing polypeptide molecule being translated when carrying arginine, thereby achieving read-through of the premature termination codon.

[0085] PTC can be introduced into the coding sequence by means of, for example, mutation. Such mutations can occur in DNA molecules and RNA molecules (such as mRNA), or in any combination of the above molecules. In some embodiments, the reference sequence is obtained from a database (such as the NCBI Reference Sequence Database (RefSeq)). In some embodiments, the mutation includes substitution, deletion, insertion, inversion and / or conversion of one or more nucleotides. The mutation may involve two or more sequence changes in different alleles, or two or more sequence changes in a single allele. Mutations can also occur in two different nucleotides at one position in an allele, such as mosaics or chimeras. Mutations can be present in malignant tissues and may lead to the appearance of premature termination codons (PTCs). In some embodiments, mutations can change a codon encoding Arg to a UGA / TGA premature termination codon. The presence or absence of a mutation may indicate whether the risk of suffering from a certain disease or condition is increased, or whether a certain disease or condition is suffered. Mutations may also be present in benign tissues, and the lack of a mutation may but does not necessarily indicate that the tissue or sample is benign.

[0086] The engineered inhibitory tRNA of the present invention can recognize the early UGA stop codons that appear in the process of mRNA encoding polypeptides, and partially decode these early stop codons, add the correct arginine to the growing peptide chain, and thus produce a non-pathogenic protein product. This early stop codon decoding, also known as early stop codon read-through or PTC read-through (the two terms are synonymous in this article), can restore about 1% to about 100% of the full-length polypeptide relative to the polypeptide produced by the control mRNA lacking the early stop codon. In some specific embodiments, the recovery capacity can reach at least about 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 99%. Additionally, the recovery capacity may also be within a specific range, such as at least about 1% to about 10%, 5% to about 20%, 10% to about 35%, 25% to about 50%, 40% to about 70%, 60% to about 80%, 75% to about 90%, or about 85% to about 100%.

[0087] In some embodiments, the read-through efficiency of a PTC includes the efficiency of a PTC being read-through in vitro. This can be measured by the following steps: (a) transfecting a vector encoding an engineered inhibitory tRNA and another vector encoding a marker protein (such as a luciferase protein or a green fluorescent protein) into a cell line (such as a human cell), wherein the mRNA encoded by the marker protein gene carried by the second vector contains a premature stop codon; (b) transfecting a third vector encoding the above marker protein into another cell line (such as the above human cell), wherein the mRNA encoded by the marker protein gene carried by the third vector does not contain a premature stop codon; and (c) comparing the production of normal marker proteins expressed in the above two cells or some conveniently measured indirect output (for example, fluorescence or luminescence).

[0088] In some embodiments, the read-through efficiency of a PTC may include the efficiency with which a PTC is read-through in vivo. In some embodiments, the efficiency with which a PTC is read-through in vivo can be determined by at least partially treating the effect of a disease or condition. Specifically, the efficiency with which a PTC is read-through in vivo can be measured by observing improvements in specific indicators and characteristics associated with a disease or condition. At the same time, it can also be measured by evaluating the degree of improvement in the ability to produce a specific full-length protein, especially when the absence or truncated form of such a full-length protein is directly related to a disease or disorder. In addition, the efficiency with which a PTC is read-through in vivo can be further measured by a series of non-limiting examples, including but not limited to improving hearing ability, visual ability, motor ability, cognitive ability, or a combination of any of the above abilities.

[0089] In some embodiments, the engineered inhibitory tRNA exhibits significantly enhanced PTC readthrough ability compared to the tRNA having the sequence of SEQ ID NO: 1. This enhanced ability can, in some cases, be attributed to the improvement of tRNA performance, which can be verified by a variety of methods, such as NanoLuc luciferase assay, RT-qPCR, and protein blotting. In other embodiments, the enhanced PTC readthrough ability is derived from the increase in tRNA abundance, which can also be accurately measured by tRNA sequencing technology. It is worth noting that in some cases, the enhanced PTC readthrough ability may be the result of the combined action of one or more mechanisms discussed above. Similarly, changes in PTC readthrough ability may also be the result of the mutual antagonism of one or more mechanisms discussed above.

[0090] In some embodiments, the engineered inhibitory tRNA also exhibits a significant increase in PTC readthrough in vivo compared to the tRNA having the sequence of SEQ ID NO: 1. In order to accurately assess this enhancement, we used a method to compare the percentage of the amount of full-length polypeptide produced in vivo by mRNA containing a premature UGA stop codon with the amount of full-length polypeptide produced in vivo by a control mRNA without a premature stop codon, thereby accurately determining the readthrough efficiency of PTC in vivo.

[0091] In some embodiments, the engineered inhibitory tRNA exhibits enhanced PTC readthrough in vitro compared to a tRNA having a sequence of SEQ ID NO: 1. This enhanced readthrough ability, in some embodiments, is determined by measuring the in vitro PTC readthrough efficiency. In some embodiments, the in vitro readthrough efficiency of PTC is determined by comparing the amount of full-length polypeptide produced in vitro by mRNA containing a premature UGA stop codon or a conveniently measured indirect output (e.g., fluorescence or fluorescence) with the amount of full-length polypeptide produced in vitro by a control mRNA without a premature stop codon or a conveniently measured indirect output (e.g., fluorescence or fluorescence). In some embodiments, the in vitro readthrough efficiency of PTC is determined by comparing the amount of full-length polypeptide produced in vitro by mRNA containing a premature UGA stop codon between different engineered inhibitory tRNAs, or by measuring a conveniently detected indirect output (e.g., fluorescence or fluorescence).

[0092] The in vitro read-through efficiency of a PTC can be a wide range, from about 1% to 100%, about 10% to 100%, about 20% to 100%, about 30% to 100%, about 40% to 100%, about 50% to 100%, about 60% to 100%, about 70% to 100%, about 75% to 100%, about 80% to 100%, about 85% to 100%, about 90% to 100%, about 95% to 100%, or about 98% to 100%, compared to the amount of full-length polypeptide produced in vitro by a control mRNA that does not contain a premature stop codon or some conveniently measured indirect output (e.g., fluorescence or luminescence). In some specific embodiments, the in vitro read-through efficiency of a PTC can be about 30% to 50% of the amount of full-length polypeptide produced in vitro by a control mRNA that does not contain a premature stop codon.

[0093] The engineered inhibitory tRNA disclosed in the present invention has the ability to read through premature stop codons. Specifically, this engineered tRNA is able to read through premature stop codons UGA / TGA produced by mutation. In various embodiments, this premature stop codon is produced by mutation of the codon encoding arginine (Arg) to the UGA / TGA stop codon. At the same time, there are also cases where codons encoding amino acids other than arginine mutate to the UGA / TGA stop codon. It is worth noting that the protein produced by reading through PTC (premature stop codon) may have a sequence that is the same as or different from the protein sequence produced by the control coding sequence without PTC.

[0094] In some embodiments, determining the amount or function of the full-length protein can be used to measure the read-through of premature stop codons. In some embodiments, the mutation from the codon encoding Arg to the UGA / TGA stop codon is in mammalian cells. In some embodiments, the mutation from the codon encoding Arg to the UGA / TGA stop codon occurs in human cells. In some embodiments, the mutation from the codon encoding Arg to the UGA / TGA stop codon can cause a disease or condition.

[0095] In some embodiments, the engineered inhibitory tRNA does not read through natural stop codons other than premature UGA / TGA stop codons. These natural stop codons are usually termination signals for producing full-length functional proteins / polypeptides during translation, and are mostly located at the end of the protein coding sequence (CDS). In some embodiments, the engineered inhibitory tRNA does not read through stop codons other than UGA / TGA stop codons. In some embodiments, the efficiency of reading through natural UGA / TGA stop codons is significantly reduced compared to the efficiency of the engineered inhibitory tRNA reading through premature UGA / TGA stop codons. In some embodiments, the efficiency of reading through natural UGA / TGA stop codons may be less than about 10%, or even less than about 1%. When the engineered inhibitory tRNA reads through the natural UGA / TGA stop codon and inserts additional amino acids, this may change the function of the protein, but it may also not affect its function.

[0096] In some embodiments, the engineered inhibitory tRNA of the present invention exhibits an enhanced PTC read-through efficiency compared to the corresponding parental tRNA, for example, compared to SEQ ID NO: 1 (i.e., R3-147, a derivative of human tRNA Arg-TCT-1-1, also referred to as Arg-TGA sup-tRNA). In some embodiments, the PTC read-through efficiency of these engineered inhibitory tRNAs relative to SEQ ID NO: 1 may be increased by about 30%, 50%, 70%, 90%, 100%, 150%, 200%, 250%, 300%, 350% or even 400%. In some embodiments, the PTC read-through efficiency of the engineered inhibitory tRNA is more than about 300% higher than the PTC read-through efficiency of SEQ ID NO: 1.

[0097] In some embodiments, the use of the engineered inhibitory tRNA can restore less than 10% of the translation of a coding nucleic acid containing a premature UGA / TGA stop codon, compared to the translation level of a control coding nucleic acid that does not contain a premature UGA / TGA stop codon. In some embodiments, the use of the engineered inhibitory tRNA can restore at least 5% of the translation of a coding nucleic acid containing a premature UGA / TGA stop codon, relative to the translation level of a control coding nucleic acid that does not contain a premature UGA / TGA stop codon. In some embodiments, the use of the engineered inhibitory tRNA can restore at least 10% of the translation of a coding nucleic acid containing a premature UGA / TGA stop codon, compared to a control coding nucleic acid that does not contain a premature UGA / TGA stop codon. In some embodiments, use of the engineered inhibitory tRNA is able to restore translation levels of about 10%-20%, 20%-30%, 30%-40%, 40%-50%, 50%-60%, 60%-70%, 70%-80%, 80%-90%, or even 90%-100% of an encoding nucleic acid containing a premature UGA / TGA stop codon compared to a control encoding nucleic acid that does not contain a premature UGA / TGA stop codon.

[0098] In some embodiments, the presence of the engineered inhibitory tRNA restores the function of a protein expressed from a coding nucleic acid comprising a PTC. In some embodiments, the use of the engineered inhibitory tRNA can restore less than 10% of the function of a protein translated from a coding nucleic acid comprising a premature UGA / TGA stop codon, as compared to the function of a protein translated from a control coding nucleic acid that does not contain a premature UGA / TGA stop codon. In some embodiments, the use of the engineered inhibitory tRNA can restore at least 5% of the function of a protein translated from a coding nucleic acid comprising a premature UGA / TGA stop codon, relative to the function of a protein translated from a control coding nucleic acid that does not contain a premature UGA / TGA stop codon. In some embodiments, the use of the engineered inhibitory tRNA can restore at least 10% of the function of a protein translated from a coding nucleic acid comprising a premature UGA / TGA stop codon, as compared to a control coding nucleic acid that does not contain a premature UGA / TGA stop codon. In some embodiments, use of the engineered inhibitory tRNA is capable of restoring function to about 10%-20%, 20%-30%, 30%-40%, 40%-50%, 50%-60%, 60%-70%, 70%-80%, 80%-90%, or even 90%-100% of the translated protein of the encoding nucleic acid containing the premature UGA / TGA stop codon as compared to a control encoding nucleic acid that does not contain the premature UGA / TGA stop codon.

[0099] In some embodiments, the mRNA targeted by the engineered inhibitory tRNA contains an early UGA stop codon. Further, these mRNAs may contain one, two, three, four, five or even more than five early UGA stop codons in certain embodiments. In addition, considering the diversity of genes, different alleles of a given gene may contain one or more different UGA / TGA early stop codons at different positions. In some cases, different alleles of a gene in an individual or individual may contain multiple different UGA / TGA early stop codons, forming a compound heterozygote. What's more, each copy of a gene present in some individuals or individuals may contain UGA / TGA early stop codons, and the presence of these early stop codons has a significant effect on the production and function of proteins. In some embodiments, the presence of one or more UGA / TGA early stop codons will result in a complete loss of function of the protein encoded by the gene in which it is located. In other embodiments, this presence may only result in a partial loss of protein function. Therefore, the importance of the engineered inhibitory tRNAs as described in the present invention is highlighted, and they can read through any or all of the above one or more early stop codons, thereby at least partially restoring the full-length polypeptide. Such restoration may, in certain embodiments, include at least partially treating the disease or disorder caused by these premature stop codons.

[0100] In some embodiments, the engineered inhibitory tRNA has the ability to reduce or prevent mRNA containing one or more UGA / TGA premature stop codons from undergoing nonsense-mediated degradation (NMD). NMD is an mRNA quality control pathway responsible for degrading mRNA containing PTC. Certain embodiments encompass methods of inhibiting NMD, which involve introducing and expressing the engineered inhibitory tRNA of the present invention into a cell. In some cases, relative to untreated background measurements, expressing the engineered inhibitory tRNA of the present invention can result in a significant increase in the abundance of mRNA containing UGA premature stop codons in cells. Further, some embodiments provide methods for inhibiting NMD of mRNA containing one or more UGA premature stop codons in a subject, the method comprising administering an engineered inhibitory tRNA to a subject. In certain embodiments, such administration can prevent or reduce the degradation of mRNA containing one or more UGA premature stop codons induced by NMD in a subject. Relative to untreated background measurements, the administration may also result in an increase in the abundance of mRNA containing one or more UGA premature stop codons.

[0101] In some embodiments, the engineered inhibitory tRNA can significantly reduce the degradation of mRNA containing one or more UGA premature termination codons induced by NMD. Specifically, this reduction can reach 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or 100%, or the range between any two percentage values ​​​​above. Further, in other embodiments, the engineered inhibitory tRNA can at least reduce the degradation of mRNA containing one or more UGA premature termination codons induced by NMD to the following range: about 1% to about 10%, about 5% to about 20%, about 10% to about 35%, about 25% to about 50%, about 40% to about 70%, about 60% to about 80%, about 75% to about 90%, or about 85% to about 100%.

[0102] V. Expression Cassettes, Vectors, Pharmaceutical Compositions and Delivery

[0103] A. Expression cassette

[0104] In some embodiments, the engineered inhibitory tRNA is encoded by an expression cassette comprising a nucleic acid encoding the engineered inhibitory tRNA. In order to introduce the engineered inhibitory tRNA into cells, some embodiments use standard conventional genetic engineering techniques to achieve this purpose by using a vector. In some embodiments, the engineered inhibitory tRNA sequence is operably linked to a promoter sequence.

[0105] The composition of the expression cassette can be diversified, for example, it can include one or more promoter sequences operably connected to the target nucleotide sequence. This target nucleotide sequence can also be further operably connected to one or more termination sequences. In addition, the expression cassette can also contain other sequences required for the correct transcription of the nucleotide sequence. The expression cassette containing the target nucleotide sequence can be chimeric, which means that it can contain recombined naturally occurring sequences for heterologous expression. The expression of the nucleotide sequence in the expression cassette can be controlled by a variety of promoters, such as constitutive promoters, cell-specific promoters, transient promoters and / or adjustable promoters. In particular, this adjustable promoter will only initiate transcription when the host cell is exposed to a specific stimulus. In embodiments involving multicellular organisms, the promoter used can also be specific to, for example, specific tissues, organs and / or developmental stages. Further, in some embodiments, the expression of exogenous genetic material is driven by an RNA polymerase III promoter, such as a U6 promoter, a H1 promoter and a 7SK promoter. In other embodiments, the expression of exogenous genetic material is driven by constitutive promoters, which can be derived from any of the following "housekeeping" genes: hypoxanthine phosphoribosyltransferase (HPRT), dihydrofolate reductase (DHFR), adenosine deaminase, phosphoglycerol kinase (PGK), pyruvate kinase, phosphoglycerol mutase, actin. Alternatively, they can also be viral promoters that function continuously in eukaryotic cells, such as the early and late promoters of SV40, the long terminal repeats (LTR) of Moloney leukemia virus and other retroviruses, and the thymidine kinase promoter of herpes simplex virus. The coding sequence can be operably linked to the regulatory sequence in a sense or antisense direction.

[0106] B. Carrier

[0107] In some embodiments, the nucleotide expression cassette or nucleic acid of the present invention is contained in an appropriate gene transfer vector and then used to transduce cells to express inhibitory tRNA. The gene delivery vector can be any type known in the art, including, for example, naked DNA transfection mediated by receptors and / or lipids, and various types of vectors. These vectors include, but are not limited to, eukaryotic vectors, prokaryotic vectors (such as bacterial vectors), and viral vectors. Exemplary viral vectors include retroviral vectors, adenoviral vectors, adeno-associated viral vectors, lentiviral vectors (including humans and other animals, such as pigs), herpes virus vectors, Epstein-Barr virus vectors, SV40 virus vectors, poxvirus vectors, and pseudovirus vectors. In some embodiments, genes are introduced into "target cells" or host cells by viral vectors. In some embodiments, lentivirus is used for transduction. In some embodiments, adeno-associated viruses are used for transduction. The present invention covers transgenic vectors suitable for this purpose, which can be connected in series with any target gene (or "marker gene" or "reporter gene" for indicating infection or gene expression).

[0108] The present invention also provides vectors encoding engineered inhibitory tRNA molecules. In some cases, these vectors are viral vectors. At the same time, the present invention also discloses various constructs for packaging engineered inhibitory tRNA coding sequences into viral vectors, which constructs may include one or more engineered inhibitory tRNA coding sequences, markers (such as GFP or mCherry), stuffer sequences or any combination thereof. In addition, the present invention also provides a method for delivering engineered inhibitory tRNA or a vector encoding engineered inhibitory tRNA by packaging into a virus.

[0109] In some embodiments, the vector can encode an engineered inhibitory tRNA or an engineered precursor tRNA. In these embodiments, the vector can be a plasmid or a viral vector. Further, there are embodiments that relate to administering a vector encoding an engineered inhibitory tRNA or an engineered precursor tRNA to a subject. Exemplary viral vectors include adeno-associated virus (AAV) vectors, lentiviral vectors, and any portion or combination of these vectors. In certain embodiments, the vector comprises DNA (such as double-stranded DNA or single-stranded DNA). At the same time, there are also embodiments in which the vector comprises RNA. In addition, there are also embodiments that employ recombinant vectors or modified naturally occurring vectors. In general, any type of vector can be utilized to achieve the purpose of the present invention.

[0110] In some embodiments, the vector comprises an adeno-associated virus (AAV) vector. In some embodiments, the vector will be modified. In some embodiments, AAV is a recombinant AAV (rAAV) vector. rAAV is composed of a capsid sequence and structure substantially similar to that in wild-type AAV (wtAAV), but the genome encapsulated by rAAV does not substantially contain an AAV protein coding sequence, but a therapeutic gene expression cassette is placed in the corresponding position, such as an engineered inhibitory tRNA expression cassette. In some embodiments, the production sequence of the virus can be an inverted terminal repeat (ITR) sequence, which can guide genome replication and packaging during vector production. Suitable AAV vectors can be selected from any AAV serotype or a combination of serotypes, for example, AAV vectors can be any one of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12 or any combination thereof. In some embodiments, the selection of the vector is based on its natural tissue tropism. In addition, in some embodiments, the serotype of the vector is selected based on its ability to cross the blood-brain barrier, such as AAV9 and / or AAV10. In some embodiments, the AAV vector is a chimera of at least two serotypes, for example, the AAV vector can be a chimera of serotypes AAV2 and AAV9. In some embodiments, the chimeric AAV vector can include rep and ITR sequences from AAV2 and cap sequences from AAV9. At the same time, there are also some embodiments in which the AAV vector does not include a rep sequence, but uses the rep gene (e.g., from AAV2) in trans for AAV production. In addition, in some embodiments, the AAV vector can be self-complementary and can include an inverted terminal repeat (ITR) sequence. Further, in some embodiments, the AAV vector can include a mutated inverted terminal repeat sequence. In some embodiments, the AAV vector can be a single-stranded adeno-associated virus (ssAAV) or a self-complementary adeno-associated virus (scAAV). In some embodiments, rep, cap and ITR sequences can be selected and combined from any or all AAV serotypes provided by the present invention. At the same time, there are also some embodiments in which suitable AAV vectors are further modified to include modifications such as on the capsid or rep protein, such modifications may include deletions, insertions, mutations, and combinations thereof. Finally, in some embodiments, the vector may be modified to reduce immunogenicity, thereby allowing repeated administration. When repeated administration is required, the serotype of the vector used may be changed to reduce and / or eliminate immunogenicity.

[0111] In some embodiments, the AAV vector can be selected from a variety of AAV serotypes, specifically including AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, and a series of pseudotyped AAVs, such as AAV-DJ, AAV-DJ / 8, AAV-Rh10, AAV-Rh74, AAV-retro, AAV-PHP.B, AAV8-PHP.eB, AAV-PHP.S, and AAV-2i8. In some embodiments, the AAV vector comprises a genome that incorporates the rep gene and inverted terminal repeat sequence from a first AAV serotype and the cap gene from a second AAV serotype. In particular, the AAV vectors in some embodiments include AAV 2 / 5 vectors, AAV 2 / 6 vectors, AAV 2 / 7 vectors, AAV2 / 8 vectors, and AAV 2 / 9 vectors.

[0112] In some embodiments, each viral genome contained in the vector contains 2 to 6 copies of nucleic acids encoding engineered inhibitory tRNAs. In some embodiments, each viral genome has multiple copies of different engineered inhibitory tRNAs. The specific copy number range may include 1 to 2, 1 to 3, 1 to 4, 1 to 5, 1 to 6, 1 to 7, 1 to 8, 1 to 9, 1 to 10, 2 to 3, 2 to 4, 2 to 5, 2 to 6, 2 to 7, 2 to 8, 2 to 9 or 2 to 10 copies. More broadly, some embodiments cover situations in which each viral genome contains 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 copies. In addition, there are embodiments that allow each viral genome to contain 1 to 5, 1 to 10, 1 to 15, 1 to 20, 1 to 25, 1 to 30, 1 to 35, 1 to 40, 1 to 45 or 1 to 50 copies.

[0113] After the lentiviral vector is transfected into the packaging cell line, the transgenic vector it carries is transcribed into RNA. Subsequently, these RNAs are carefully packaged into infectious viral particles, which can then infect target cells. Once infection occurs, the RNA in the viral particles is reverse transcribed into DNA, and this DNA is stably integrated into the cell's genome as a proviral element, thereby achieving the goal of effectively delivering the target gene to the target cell.

[0114] C. Compositions (eg, pharmaceutical compositions)

[0115] In some embodiments, the engineered inhibitory tRNA or expression cassettes, vectors and / or nucleic acids encoding the engineered inhibitory tRNA are contained in specific compositions. Further, these compositions are pharmaceutical compositions in some embodiments, and they also contain a pharmaceutically acceptable carrier, which can be an excipient, a diluent, or a combination of the two. In some embodiments, the pharmaceutically acceptable carrier is a liposome or a lipid nanoparticle.

[0116] In some embodiments, liposomes are used to mediate the delivery of engineered inhibitory tRNA. In some embodiments, lipid nanoparticles (LNPs) are used to mediate the delivery of engineered inhibitory tRNA. In addition, in some embodiments, LNPs are used to deliver synthetic RNA.

[0117] The present invention provides engineered inhibitory tRNA molecules or vectors encoding engineered inhibitory tRNA molecules, which can be packaged into viral particles to mediate the delivery of engineered inhibitory tRNA molecules to cells or tissues. The composition of the present invention comprises (one or more) engineered inhibitory tRNA molecules or vectors encoding (one or more) engineered inhibitory tRNA molecules, which can be delivered to cells and subjects via AAV vectors. The delivery of AAV vectors can achieve long-term effects through a single dose and provide multiple targeting opportunities.

[0118] In some embodiments, the engineered inhibitory tRNA, the vector encoding the engineered inhibitory tRNA, or both are present in a delivery system. The delivery system can include viral particles, liposomes, nanoparticles, exosomes, extracellular vesicles, nanonets, charged polymers, uncharged polymers, surfactants, penetration enhancers, gene transfer agents, phospholipids, micelles, synthetic carriers, macromolecules, dendrimers, biopolymers, or any combination thereof. In some embodiments, the engineered inhibitory tRNA or the vector encoding the engineered inhibitory tRNA can be present in viral particles, liposomes, nanoparticles, exosomes, extracellular vesicles, nanonets, or any combination thereof. In addition, in some embodiments, the carrier can be encapsulated in a polypeptide shell.

[0119] In some embodiments, the composition comprises an excipient. Excipient may include a cryopreservative, such as DMSO, glycerol, polyvinyl pyrrolidone (PVP) or any combination thereof. Excipient may also include other cryopreservatives, such as sucrose, trehalose, starch, salts of these substances, derivatives or any combination thereof. Excipient may include a pH regulator (for example, for minimizing the oxidation or reduction reaction of a composition component), a stabilizer (for example, for preventing the change or degradation of a composition component), a buffer (for example, for enhancing temperature stability), a solubilizer (for example, for increasing protein solubility) or any combination thereof. Excipient may also include a surfactant, a sugar, an amino acid, an antioxidant, a salt, a nonionic surfactant, a solubilizer, a triglyceride, an alcohol or any combination thereof. Specific excipients can include sodium carbonate, acetate, citrate, phosphate, polyethylene glycol (PEG), human serum albumin (HSA), sorbitol, sucrose, trehalose, polysorbate 80, sodium phosphate, disodium phosphate, mannitol, polysorbate 20, histidine, citrate, albumin, sodium hydroxide, glycine, sodium citrate, arginine, sodium acetate, hydrochloric acid (HCl), disodium edetate, lecithin, glycerol, xanthan gum, soybean isoflavones, ethanol, water, teprenone or any combination thereof. Excipient can be any excipient described in Handbook of Pharmaceutical Excipients (Handbook of Pharmaceutical Excipients, American Pharmaceutical Association, 1986).

[0120] The composition of the present invention may include a naturally occurring or non-naturally occurring carrier. In some embodiments, the carrier is inert (e.g., a detectable agent or label). In other embodiments, the carrier is active (e.g., an adjuvant, a diluent, a binder, a stabilizer, a buffer, a salt, a lipophilic solvent, a preservative, etc.). In certain embodiments, the carrier includes a pharmaceutically acceptable carrier. The carrier may include a pharmaceutical excipient and additionally added proteins, peptides, amino acids, lipids, and carbohydrates (e.g., sugars, including monosaccharides; oligosaccharides, such as disaccharides, trisaccharides, tetrasaccharides, etc.; derived sugars, such as sugar alcohols, aldonic acids, esterified sugars, etc.; and polysaccharides or sugar polymers). These carriers may exist alone or in combination, ranging from 1% to 99.99% (by weight or volume). Exemplary protein excipients include serum albumin, such as human serum albumin (HSA), recombinant human albumin (rHA), gelatin, casein, etc. Representative amino acid components, antibody components or a combination of the two include alanine, arginine, glycine, betaine, histidine, glutamic acid, aspartic acid, cysteine, lysine, leucine, isoleucine, valine, methionine, phenylalanine and aspartame, which also have buffering capacity. In certain embodiments, carbohydrate excipients may include monosaccharides such as fructose, maltose, galactose, glucose, D-mannose, sorbose, etc.; disaccharides such as lactose, sucrose, trehalose, cellobiose, etc.; polysaccharides such as raffinose, melezitose, maltodextrin, dextran, starch, etc.; and sugar alcohols such as mannitol, xylitol, maltitol, lactitol, sorbitol (glucitol) and inositol.

[0121] The composition provided by the present invention may include a diluent, such as water, glycerol, methanol, ethanol and other similar biocompatible diluents. In some embodiments, the diluent is an aqueous acid, such as acetic acid, citric acid, maleic acid, hydrochloric acid, phosphoric acid, nitric acid, sulfuric acid or the like. In other embodiments, the diluent is an alkali metal carbonate, such as calcium carbonate; an alkali metal phosphate, such as calcium phosphate; an alkali metal sulfate, such as calcium sulfate; a cellulose derivative, such as cellulose, microcrystalline cellulose or cellulose acetate; and magnesium oxide, dextrin, fructose, dextrose, stearyl palmitin, lactitol, choline, lactose, maltose, mannitol, simethicone, sorbitol, starch, pregelatinized starch, talc, xylitol and / or their anhydrates, hydrates and pharmaceutically acceptable derivatives thereof, or a combination of these ingredients.

[0122] D. Delivery

[0123] In some embodiments, the nucleic acid encoding the engineered inhibitory tRNA can be delivered to the host cell by a virus or a non-viral method. The method of non-viral delivery of nucleic acid includes liposome transfection, nuclear transfection, microinjection, biolistics, virosomes, liposomes, immunoliposomes, polycations or lipid-nucleic acid conjugates, electroporation, nanoparticles, exosomes, microvesicles, naked DNA and artificial virions. See literature, such as Sambrook et al. (2012, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York).

[0124] The use of RNA or DNA virus-based nucleic acid delivery systems is extremely efficient in targeting viruses to specific cells and effectively transporting the viral payload to the cell nucleus.

[0125] In some embodiments according to the method of the present invention, the method encompasses the process of introducing a viral vector (e.g., AAV or lentiviral vector) encoding an engineered inhibitory tRNA nucleic acid into a host cell. In certain embodiments, the vector used is a recombinant adeno-associated virus (rAAV) vector. In some embodiments, the flank of the construction vector comprises one or more AAV inverted terminal repeat (ITR) sequences. These ITRs can be ITRs of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAV2R471A, AAV DJ, goat AAV, bovine AAV or mouse AAV serotypes. In particular, in certain embodiments, the ITR of the AAV is the ITR of AAV2. In addition, the vector in some embodiments further comprises a stuffer nucleic acid, which may be located upstream or downstream of the nucleic acid encoding the tRNA. In certain embodiments, the vector is a self-complementary rAAV (sc-rAAV) vector. Such a vector may comprise a first nucleic acid sequence encoding an engineered inhibitory tRNA nucleic acid and a second nucleic acid sequence encoding a complementary sequence thereof, wherein the first nucleic acid sequence can form intrachain base pairs with the second nucleic acid sequence over most or all of its length. Further, in some embodiments, the first nucleic acid sequence and the second nucleic acid sequence are connected by a mutant AAV ITR sequence, which has a missing D region and comprises a mutation in a terminal melting sequence. In certain embodiments, the vector is encapsidated in rAAV particles, which may comprise capsids of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAV2R471A, AAV2 / 2-7m8, AAV DJ, AAV2N587A, AAV2 E548A, AAV2 N708A, AAV2 V708K, AAV2-HBKO, AAVDJ8, AAV-PHP.B, AAV-PHP.eB, AAV-BR1, AAVHSC15, AAVHSC17, goat AAV, chimeric AAV1 / AAV2, bovine AAV, mouse AAV, or rAAV2 / HboV1 serotypes.

[0126] In some embodiments, it is related to introduce a nucleic acid plasmid encoding an engineered inhibitory tRNA into a host cell. In addition, in some embodiments, the method includes introducing a nucleic acid encoding an engineered inhibitory tRNA (e.g., a synthetic nucleic acid encoding an engineered inhibitory tRNA) into a host cell by electroporation. In some other embodiments, the method involves transfecting a nucleic acid encoding an engineered inhibitory tRNA into a host cell.

[0127] In some embodiments, the engineered inhibitory tRNA is delivered to a subject. In some embodiments, the engineered inhibitory tRNA is delivered to a cell. In some embodiments, the cell may be located in the subject. In some embodiments, the subject and / or the cell belongs to a eukaryotic organism. In some embodiments, the subject and / or the cell belongs to a mammal. In some embodiments, the subject and / or the cell is human.

[0128] VI. Methods of Inhibiting PTC and Treating Diseases

[0129] The present invention also provides a method for inhibiting PTC using the engineered inhibitory tRNA of the present invention. In certain embodiments, the engineered inhibitory tRNA (or its encoding nucleic acid) is used to treat a disease associated with a premature UGA / TGA stop codon. A method for treating a disease associated with a premature UGA / TGA stop codon in an individual comprises administering to the individual a composition comprising an effective amount, the composition comprising: an engineered inhibitory tRNA, an expression cassette containing a nucleic acid encoding the engineered inhibitory tRNA, and / or a vector containing the expression cassette, and / or a viral particle containing the vector, and a pharmaceutically acceptable carrier. In the context of therapeutic or preventive applications, the determination of the effective amount may depend on a variety of factors, such as the type and severity of the condition being targeted, and the characteristics of the individual subject, such as overall health, age, sex, weight, and / or tolerance to the pharmaceutical composition. In some embodiments, the effective amount is at least the amount required to partially treat a patient with a disease associated with PTC. For some embodiments involving in vitro applications, the determination of the effective amount depends on the size and nature of the specific application, and / or on the nature and / or sensitivity of the in vitro target, as well as the method used. In some embodiments, an effective amount encompasses one or more administrations of the composition.

[0130] In some embodiments, the present invention provides a method for restoring the translation of a coding nucleic acid containing a premature UGA / TGA stop codon in a host cell (or a method for reading through a nucleic acid containing a premature UGA / TGA stop codon). The method comprises introducing an engineered inhibitory tRNA capable of carrying arginine into a host cell, or introducing an expression cassette comprising a nucleic acid encoding the engineered inhibitory tRNA, or introducing a vector comprising the expression cassette, or a viral particle containing the vector, wherein the engineered inhibitory tRNA has an RNA sequence of any one of SEQ ID NOs: 2-8 and 154. The engineered inhibitory tRNA introduced into the cell (or produced by the expression cassette or vector) is capable of recognizing and reading through the premature UGA / TGA stop codon, thereby restoring the translation of the coding nucleic acid containing the premature UGA / TGA stop codon. In some embodiments, the method is performed under in vitro conditions. In other embodiments, the method is performed in vivo.

[0131] In some embodiments, the method of suppressing PTC using the engineered inhibitory tRNA provided by the present invention may include delivering a mixture of multiple types of engineered inhibitory tRNAs, and / or delivering a mixture of multiple types of engineered inhibitory tRNA nucleic acids. This covers the simultaneous or non-simultaneous delivery of 2 or more, 3 or more, 4 or more, or 5 or more different engineered inhibitory tRNAs, and / or the simultaneous or non-simultaneous delivery of 2 or more, 3 or more, 4 or more, or 5 or more different nucleic acids, each of which encodes different engineered inhibitory tRNAs, and / or only delivering 1 nucleic acid encoding multiple different engineered inhibitory tRNAs. In some embodiments, different engineered inhibitory tRNAs suppress the same PTC (e.g., UGA). And in some embodiments, each different engineered inhibitory tRNA suppresses different PTCs. For example, one or more engineered inhibitory tRNAs suppress UGA / TGA PTC, and one or more different engineered inhibitory tRNAs suppress other PTCs. In some embodiments, at least one of the different engineered inhibitory tRNAs is an engineered Arg-UGA tRNA of the present invention. In certain specific embodiments, all of the different engineered inhibitory tRNAs are different engineered Arg-UGA tRNAs described herein.

[0132] Methods for determining whether an engineered inhibitory tRNA causes readthrough are known in the art, including but not limited to Western blot analysis, immunohistochemistry, flow cytometry, mass spectrometry, and cell-based reporter assays, as described in the Examples section. In certain aspects, whether a PTC readthrough agent is effective in increasing the level of full-length protein can be detected by observing the improvement of one or more clinical parameters. It is worth noting that in some cases, even a modest or slight increase in the amount of full-length protein may have a positive effect on alleviating certain disease states. For example, in the case of lysosomal storage disease type I mucopolysaccharidosis-Hurler (MPS IH, caused by nonsense mutations in the IDUA gene, resulting in reduced levels of iduronidase encoded by it), the correction threshold is relatively low, and restoring less than 1% of the wild-type iduronidase function can significantly alleviate clinical manifestations (Ashton et al., Am. J. Hum. Genet. 1992, 50: 787-794, Bunge et al., Biochim. Biophys. Acta. 1998, 1407: 249-256). Therefore, in some aspects, increasing the amount of full-length protein to 1% of the wild-type level is of positive significance for treating some diseases caused by nonsense mutations. In some examples, the amount of full-length protein produced is increased by at least 5%, and the specific increase may be 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or even 100% compared to the wild type (e.g., the expression level of the wild-type protein in the control gene / mRNA that does not contain a nonsense mutation).

[0133] In some embodiments, the host cell is selected as a eukaryotic cell. More preferably, the host cell is a mammalian cell. In the most preferred embodiment, the host cell is selected as a human cell. In addition, there are also embodiments using mouse cells as host cells. In some embodiments, the host cell can be a plant cell or a fungal cell. It is worth noting that in some embodiments, the host cell can be a diseased cell. And, in certain embodiments, the host cell contains one or more mutations, such as nonsense mutations.

[0134] In some embodiments, the host cell selects a specific cell line, such as Neuro-2a, HEK293, HEK293T, Calu6, DMS114, HT29, NCI-60, MCF-7, HL-60, A549, HepG2, RD, SF268, SW13, differentiated LHCN, undifferentiated LHCN, Saos-2, CHO or HeLa cells. In some embodiments, the host cell selects primary cells, such as fibroblasts, epithelial cells or immune cells. In some embodiments, the host cell is specifically designated as a T cell. In addition, in some embodiments, the host cell is selected as a post-mitotic cell. In some embodiments, the host cell is derived from the central nervous system (CNS), such as brain cells, particularly cerebellar cells. It is worth noting that some embodiments also use immortalized cells containing PTC as host cells. In some embodiments, the host cell is a stem cell or IPS (induced pluripotent stem cell) cell containing PTC. Finally, in some specific embodiments, the host cell is derived from cells or organoids differentiated from stem cells or IPS cells containing PTCs.

[0135] In some embodiments, the host cell is selected as a neuron, a photoreceptor cell (e.g., an S cone cell, an L cone cell, an M cone cell, a rod cell), a retinal pigment epithelial cell, or a glial cell (e.g., an astrocyte, an oligodendrocyte, a microglia cell). In other embodiments, the host cell can be a muscle cell, such as a myoblast, a myotube, or a hepatocyte or a lung epithelial cell. In addition, some embodiments specifically point out that the host cell can be a horizontal cell, a ganglion cell, or a bipolar cell.

[0136] In some embodiments, the host cell is present within an individual, such as a human individual, while in other embodiments, the host cell is present as an ex vivo cell population.

[0137] In some embodiments, premature UGA / TGA stop codons (also referred to as "PTCs") in mRNAs are caused by nonsense mutations, which may lead to diseases (such as pathogenic mutations discussed herein). Such diseases may be caused by a variety of factors, including rapid degradation of mRNA (e.g., by NMD), lack or reduction of functional protein due to the production of truncated protein products, insufficient levels of truncated protein products with normal or partial function, or a combination of these factors. In some embodiments, the occurrence of PTCs is due to abnormal or abnormal biosynthesis of mRNA. In other embodiments, PTCs are not caused by mutations, but are caused by the introduction of one or more errors during the transcription of non-mutated DNA.

[0138] In some aspects, mutation-induced PTCs have significant effects on gene expression, especially in the context of disease. Specifically, PTCs terminate the translation of mRNA before the synthesis of the full-length polypeptide chain is completed, resulting in truncated proteins. These truncated proteins are often only partially functional, completely non-functional, unstable, or even have harmful functions. In addition, mRNAs containing PTCs are often unstable because they are easily degraded by the NMD machinery, resulting in a significant reduction in mRNA levels at steady state. In some cases, the series of events triggered by PTCs work together to significantly reduce the production of functional proteins, which may lead to serious disease states.

[0139] The mRNA containing PTC of the present invention can be transcribed from any target gene. In some specific embodiments, such mRNA containing PTC is transcribed from the COL4A5 gene. More examples of nonsense mutations can be found in, for example, the Human Gene Mutation Database (HGMD) and ClinVar (Landrum, MJ, et al. ClinVar: improving access to variant interpretations and supporting evidence. Nucleic Acids Res. January 4, 2018. PubMed PMID: 29165669).

[0140] In some embodiments, the compositions described herein (e.g., compositions comprising engineered inhibitory tRNAs or nucleic acids encoding engineered inhibitory tRNAs, and viral particles) can be administered to prevent diseases or conditions as described herein. Specifically, these compositions (e.g., pharmaceutical compositions) can be administered prophylactically to prevent the occurrence of a disease or condition and to at least partially reduce the appearance, onset, or incidence of one or more symptoms of a disease or condition. In addition, in some specific embodiments, methods of treating diseases associated with premature UGA / TGA stop codons in individuals are provided. The method comprises administering to an individual an effective amount of a composition (e.g., a pharmaceutical composition) comprising an engineered transfer RNA (tRNA) that can carry arginine, or an expression cassette comprising a nucleic acid encoding an engineered inhibitory tRNA, or a vector comprising the expression cassette, or a viral particle comprising the above-mentioned vector, wherein the engineered transfer RNA has an RNA sequence of any one of SEQ ID NOs: 2-8 and 154.

[0141] The present invention also provides the use of the composition (e.g., pharmaceutical composition), specifically for treating a disease associated with premature UGA / TGA stop codons in an individual. In some embodiments, further provided is the use of the composition (e.g., pharmaceutical composition) in the manufacture of a medicament for treating a disease associated with premature UGA / TGA stop codons in an individual.

[0142] In some embodiments, the compositions (e.g., pharmaceutical compositions) described herein can be used to treat diseases or conditions as described herein, such as Alport syndrome. For example, in some cases, these compositions (e.g., pharmaceutical compositions) can be used after the onset of disease or diagnosis, in order to prevent further development or deterioration of the disease or condition, and / or reduce the severity of the symptoms, which is usually achieved by at least partially reducing the appearance, onset or incidence of one or more symptoms of the disease or condition. Compositions (e.g., pharmaceutical compositions) and methods provided by the present invention can be used to treat any disease associated with allele nonsense mutations.

[0143] Any suitable subject can be applied with the composition (e.g., pharmaceutical composition) as described in the present invention or receive the method treatment as described in the present invention. Mammalian subjects cover a wide range, including but not limited to humans, non-human primates (e.g., apes, gibbons, chimpanzees, orangutans, monkeys, macaques, etc.), livestock (e.g., dogs and cats), farm animals (e.g., horses, cattle, goats, sheep, pigs), and experimental animals (e.g., mice, rats, rabbits, guinea pigs). In certain embodiments, it is particularly noted that the subject is human. The subject can be at any age or developmental stage, such as adults, teenagers, children, infants, and even mammals in the womb. Specifically, in human subjects, it may include newborns from about 1 day to about 7 days old, infants from about 1 week to about 5 weeks old, and infants from about 1 month to about 12 months old, and children from about 1 year old to about 10 years old. In addition, it may also include about 6 months to about 15 years old, about 5 years old to about 25 years old, about 20 years old to about 50 years old, about 40 years old to about 80 years old, about 75 years old to about 100 years old, and even about 90 years old to about 130 years old. The mammalian subject can be male or female. In certain embodiments, it is specifically pointed out that the subject is male, while in other embodiments, the subject is female. In particular, in some cases, the subject may be a pregnant female of childbearing age. Regarding the age of the subject, in addition to the above-mentioned wide range, certain age groups may also be specifically pointed out, such as about 20 years old, or young people between 10-30 years old. In certain embodiments, the subject may suffer from or be suspected of suffering from a certain disease or condition. In addition, the subject may carry or be suspected of carrying one or more premature termination codons associated with a certain disease or condition. In particular, in some cases, the disease or condition suffered by the subject may be caused by one or more PTCs. In some other cases, the subject may have one or more PTCs derived from arginine (Arg) codon mutations.

[0144] In some embodiments, the compositions (e.g., pharmaceutical compositions) described herein are administered to pregnant female subjects at one or more stages of pregnancy. In some embodiments, these compositions (e.g., pharmaceutical compositions) are administered to female subjects during the prenatal period. In some embodiments, compositions (e.g., pharmaceutical compositions) as described herein are administered directly to embryos or fetuses in the uterus. Other embodiments contemplate administering these compositions (e.g., pharmaceutical compositions) to embryos in an in vitro environment, such as under laboratory conditions.

[0145] In some embodiments, the subject has received a diagnosis of the disease or condition. In other embodiments, the subject has not yet received a definitive diagnosis of the disease or condition. The diagnostic process may include a blood test, a clinical diagnosis based on one or more symptoms, or any combination of these methods. In particular, diagnosis (e.g., a blood test) can be used to confirm whether there is a mutation in the mRNA encoding the polypeptide, such as the UGA / TGA premature termination codon. In certain embodiments, the diagnostic test may involve sequencing a biological sample from the subject, such as using Sanger sequencing, Illumina sequencing, and other technologies. When evaluating mRNA, it is necessary to note the presence of multiple mutations (e.g., about 1 to about 200 mutations). A clinical diagnosis may be based on one or more symptoms including, but not limited to, aphasia, loss of the ability to use hands purposefully, involuntary hand movements, loss of mobility, gait disturbance, loss of muscle tone, seizures, scoliosis, sleep disturbances, slowed growth, difficulty breathing, hearing loss, slurred speech and sounds, difficulty understanding speech, difficulty distinguishing consonants, vision loss, limited visual field, hazy vision, blurred vision, eye discomfort, cough, cough with sputum, greasy stools, infertility, weight loss, salty taste of the skin, or any combination of these symptoms.

[0146] In some embodiments, treatment involves administering one or more compositions (e.g., pharmaceutical compositions) as described herein to a subject. In addition, treatment may also include the use of combination therapy, which may include engineered inhibitory tRNAs with a variety of other treatment methods, such as cancer treatment (covering radiotherapy, chemotherapy, CAR-T therapy, immunotherapy, hormone therapy, cryoablation, etc.), surgery, antibiotics, antiviral drugs, or any combination of these treatment methods. In some embodiments, combination therapy may include the use of mucus thinners, cystic fibrosis transmembrane conductance regulator (CFTR) regulator therapy, lung transplantation, bronchodilators, airway clearance techniques, anti-inflammatory drugs, nebulizer therapy, oral pancreatic enzymes, stool softeners, and specific drug combinations, such as elexacaftor, ivacaftor, tezacaftor, lumacaftor, etc., or any combination of these treatment methods. In addition, the combination therapy may also include physical therapy, hydrotherapy, occupational therapy, speech-language therapy, feeding assistance, anti-epileptic drugs, anti-reflux drugs, L-carnitine, steroid therapy, non-steroidal anti-inflammatory drugs (NSAIDs), visual aids (such as glasses and / or corrective eye surgery), hearing therapy (such as hearing aids), etc., or any combination of these treatment methods. In some cases, the combination therapy may also include RNA or DNA editing technology. The goal of treatment may be to completely cure the disease or condition, or to substantially reduce one or more symptoms of the disease or condition.

[0147] In some embodiments, administration of an engineered inhibitory tRNA can alleviate at least one symptom associated with a genetic disease. The amount and form of the tRNA or its encoding nucleic acid administered will vary depending on a variety of factors, including but not limited to the selected composition (e.g., pharmaceutical composition), the specific disease type, weight, physical condition, and age of the subject, and whether the purpose of administration is prevention or treatment. In some embodiments, even if the translation recovery of the mRNA containing the premature stop codon is low, such as less than about 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or even less than about 100%, at least one symptom can be observed to be alleviated. In some embodiments, when the translation recovery of the mRNA containing the PTC is less than about 10%, at least one symptom can be alleviated. The degree of translation recovery is assessed by measuring the amount or function of the full-length protein produced in a sample containing the mRNA with the PTC, and compared with a control sample containing the corresponding mRNA expressing the same protein but not containing the PTC.

[0148] In some embodiments, the compositions disclosed herein are in the form of a single dosage form. In some embodiments, these compositions are in the form of multiple dosage forms. The term "single dosage form" as used herein refers to a physically separate unit suitable for administration to a human or non-human subject (e.g., an animal). In certain embodiments, the single dosage form is packaged separately. In addition, a single dosage form may contain a mixture of multiple types of engineered inhibitory tRNAs. For example, a single dosage form may contain 2 or more, 3 or more, 4 or more, or even 5 or more different engineered inhibitory tRNA mixtures. In some embodiments, different engineered inhibitory tRNAs may inhibit the same premature stop codon, such as UGA. In other embodiments, each different engineered inhibitory tRNA may inhibit a different premature stop codon, for example, one or more engineered inhibitory tRNAs inhibit UGA / TGA premature stop codons, while another one or more different engineered inhibitory tRNAs inhibit other premature stop codons. In some embodiments, at least one of the different engineered inhibitory tRNAs is an engineered Arg-UGA tRNA described herein. In some embodiments, all of the different engineered inhibitory tRNAs are different engineered Arg-UGA tRNAs described herein.

[0149] Each single dosage form may contain a predetermined amount of one or more active ingredients sufficient to produce the desired therapeutic effect when combined with a pharmaceutical carrier, diluent, excipient or any combination thereof. Examples of single dosage forms include ampoules, syringes, and individually packaged tablets and capsules.

[0150] In some embodiments, a single dosage form is packaged in a disposable syringe for ease of use. In addition, sometimes only a small portion of a single dosage form is administered, or multiple single dosage forms are administered together to meet specific therapeutic needs. A multi-dose form may refer to a plurality of identical single dosage forms packaged in a single container, which can be separated and administered in a single dosage form. Examples of multi-dose forms include vials, bottled tablets or capsules, and pint or gallon bottles. In some embodiments, a multi-dose form may contain multiple doses of the same pharmaceutically active agent for continuous or repeated treatment. In other embodiments, a multi-dose form may contain multiple doses of different pharmaceutically active agents, which may be directed to different symptoms or diseases, or different drug combinations may be required during treatment.

[0151] In some embodiments, the composition (e.g., pharmaceutical composition) described in the present invention is used to effectively deliver engineered inhibitory tRNA or a vector encoding engineered inhibitory tRNA to a desired biological site of action. In order to achieve this goal, the mode of administration can be varied, including but not limited to oral administration, topical administration, intravenous administration, inhalation administration, or any combination thereof. Further, the delivery method can also be flexibly selected to adapt to different treatment needs and biological sites of action. For example, injection, catheterization, gastrostomy tube administration, intraosseous administration, eye administration, intraventricular administration, ear administration, transdermal administration, oral administration, rectal administration, nasal administration, intravaginal administration, intracavernous administration, transurethral administration, sublingual administration, etc. can be used. For specific brain treatment, intracranial injection can also be selected, including intracranial injection into the substance, intracerebellomedullary cisterna (ICM) injection, and intraventricular (ICV) injection, or a combination of these methods to ensure that the drug can accurately reach the target area.

[0152] In some embodiments, the delivery method involves direct application to the affected tissue or area of ​​the body to ensure that the drug can accurately act on the lesion. For local application, this may include various forms of preparations, such as lotions, solutions, emulsions, creams, ointments, oils, pastes, rod-shaped preparations, aerosols, foams, jelly, masks, pads, powders, solids, tinctures, butter-shaped preparations, patches, gels, sprays, drops, liquid preparations and ointments, etc., applied to the outer surface of the body surface (such as skin). In addition, the delivery method may also include injection, and the specific form can be diverse, such as parenchymal injection, intracisternal injection, intraarterial injection, intramuscular injection, intraparenchymal injection, intraperitoneal injection, intraspinal injection, intrathecal injection, intravenous injection, intraventricular injection, stereotactic injection, subcutaneous injection and epidural injection, or any combination of these injection methods. In some embodiments, delivery is achieved by parenteral administration, which may include intravenous administration, intraarterial administration, intrathecal administration, intraocular administration, ear administration, intraventricular administration or intraperitoneal administration. These parenteral administration routes ensure that the drug bypasses the gastrointestinal tract and directly enters the blood circulation or target tissues, thereby improving therapeutic efficacy and reducing potential gastrointestinal side effects.

[0153] In some embodiments, the delivery process is achieved by means of special devices such as pumps, infusion pumps or combinations thereof. In addition, the delivery method may also include enema, eye drops, nasal sprays or any combination thereof to adapt to different treatment needs and target sites. Regarding the application of the composition (e.g., pharmaceutical composition), there are also multiple possibilities. In some embodiments, the subject can apply the composition (e.g., pharmaceutical composition) by himself without the supervision of a medical professional. In some embodiments, it is necessary to apply under the supervision of a medical professional, or directly apply the composition (e.g., pharmaceutical composition) by a medical professional to ensure the accuracy and safety of the application. For the oral administration method, a variety of specific forms are also covered. For example, the subject can take medicine by taking tea, elixir, food, wine, beverage, syrup, liquid, gel, capsule, tablet, oil, tincture or any combination thereof. Among them, capsules or tablets are common oral preparation forms. In some cases, the constituent materials of the capsule may include hydroxymethylcellulose, gelatin, hydroxypropyl methylcellulose, pullulan or any combination thereof, and may include coatings, such as enteric coatings, to adapt to specific treatment needs. In addition, some embodiments use vegetarian / vegan capsules, such as hypromellose capsules. In some embodiments, the delivery method also includes inhalation through an inhaler, diffuser, nebulizer, vaporizer, or a combination thereof, so as to deliver the drug directly to the respiratory tract or lungs.

[0154] In some embodiments, administration is intermittent, i.e., not continuously. Specifically, compositions (e.g., pharmaceutical compositions) of the present invention can be administered at a first time point and a second time point, and there will be a certain interval between these two time points. This administration interval can be variable, such as 1 hour, 2 hours, 4 hours, 8 hours, 12 hours, 16 hours, 20 hours, 1 day, 2 days, 4 days, 7 days, 2 weeks, 4 weeks, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year or longer, depending on the specific conditions of treatment needs and patients.

[0155] The administration or use of the compositions (e.g., pharmaceutical compositions) disclosed herein can be continued for a therapeutic period of at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 consecutive or non-consecutive days.

[0156] For example, in some embodiments using adeno-associated virus (AAV) delivery, treatment may only require one, two, or very few administrations or applications during the life of the subject. However, in other embodiments using carriers (such as lipid nanoparticles (LNPs)) to deliver synthetic tRNA, treatment may need to be carried out by regular administration or application. Treatment regimens for specific diseases will also be different. For example, in embodiments for the treatment of cystic fibrosis, it may be necessary to administer or apply approximately once a week throughout the life of the subject. In treatment regimens involving cancer, the frequency and time intervals of administration or application may vary, such as injections approximately every few days for about one to four months, or injections every one to four months.

[0157] Regarding the duration of treatment, it may vary depending on the embodiment and the type of disease. In some embodiments, the duration of treatment can be about 1 to about 30 days, about 2 to about 30 days, about 3 to about 30 days, about 4 to about 30 days, about 5 to about 30 days, about 6 to about 30 days, about 7 to about 30 days, about 8 to about 30 days, about 9 to about 30 days, about 10 to about 30 days, about 11 to about 30 days, about 12 to about 30 days, about 13 to about 30 days, about 14 to about 30 days, about 15 to about 30 days, about 16 to about 30 days, about 17 to about 30 days, about 18 to about 30 days, about 19 to about 30 days, about 20 to about 30 days, about 21 to about 30 days, about 22 to about 30 days, about 23 to about 30 days, about 24 to about 30 days, about 25 to about 30 days, about 26 to about 30 days, about 27 to about 30 days, about 28 to about 30 days, or about 29 to about 30 days. However, in other cases, treatment may need to be carried out for a long time, and the duration of treatment of the composition disclosed in the present invention may be at least about 1 week, at least about 1 month, at least about 1 year, at least about 2 years, at least about 3 years, at least about 4 years, at least about 5 years, at least about 6 years, at least about 7 years, at least about 8 years, at least about 9 years, at least about 10 years, at least about 15 years, at least about 20 years or longer. In addition, the application can be repeated throughout the life of the subject, such as once a month or once a year. This repeated mode of application can last for many years, such as at least about 1 year, 5 years, 10 years, 15 years, 20 years, 25 years, 30 years or longer to provide a sustained therapeutic effect.

[0158] The frequency of administration or application of the compositions disclosed herein can be adjusted according to the specific treatment regimen and patient needs. Specifically, the administration or application can be performed at least 1, 2, 3, 4, 5, or even more times per day. In some embodiments, this frequency may be increased to at least 1, 2, 3, 4, 5, 6, 7, or more times per week. In some embodiments, the administration or application of the compositions disclosed herein is performed at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or more times per month.

[0159] 30 times or more. The mode of administration may also vary depending on the treatment needs. In some embodiments, administration is performed continuously or substantially continuously over a preselected period of time to ensure the persistence of the therapeutic effect. In some embodiments, administration may be local, focusing on a specific area or tissue. In some embodiments, administration may be systemic, intended to affect the entire body.

[0160] In addition, in some specific embodiments, genetic material transfer methods such as transfection or transduction may be used to introduce exogenous genetic material (e.g., genetic material encoding one or more engineered inhibitory tRNAs) into cells in vivo to provide genetically modified cells. These exemplary transfection techniques include, but are not limited to, calcium phosphate DNA coprecipitation, DEAE-dextran-mediated transfection, electroporation, cationic liposome-mediated transfection, tungsten particle-promoted microparticle bombardment, and strontium phosphate DNA coprecipitation, etc.

[0161] VII. Kit

[0162] In some embodiments, the engineered inhibitory tRNA of the present invention is packaged in a kit for easy storage and use. These kits may contain only the engineered inhibitory tRNA itself, or contain the composition of the present invention and a specially designed container. Specifically, the composition in the kit may contain an engineered inhibitory tRNA, a polynucleotide encoding the tRNA (such as a vector), or a viral particle containing the above polynucleotide, or a combination of the two. In addition, the kit may also contain a prepared pharmaceutical composition, such as a mixture of an engineered inhibitory tRNA and a pharmaceutically acceptable excipient, carrier or diluent, which can be presented in a single dosage form for direct use. The packaging and container of the kit are also important components, and they may be made of plastic, glass, metal or any combination thereof to ensure the safety and stability of the product. In addition, the kit may also be accompanied by detailed instructions for use to guide the subject on how to properly apply it.

[0163] In some embodiments, the packaged products containing the compositions of the present invention are all labeled for identification and tracking. At the same time, the pharmaceutical compositions of the present invention are strictly produced in accordance with current good manufacturing practices (cGMP) and applicable labeling regulations to ensure their quality and safety. In addition, in order to meet specific medical needs, the pharmaceutical compositions and / or kits disclosed in the present invention can also be sterile.

[0164] Some embodiments also relate to methods for preparing the kit. These methods may include the steps of contacting and assembling the composition with the packaging or container. Through these methods, we can ensure the integrity of the kit and the effectiveness of the product.

[0165] Finally, it should be emphasized that the scope of the present disclosure is not limited to the specific disclosed embodiments. These specific embodiments are provided to show the various aspects and possibilities of the present disclosure. Based on the description and teaching herein, the reader can clearly understand that it is entirely possible to make various modifications to the compositions and methods. These modifications should all be considered to be within the original scope of the present disclosure as long as they do not deviate from the true scope and spirit of the present disclosure.

[0166] Example

[0167] Example 1

[0168] The following example describes in detail the screening process of the first generation of engineered inhibitory tRNAs carrying arginine and recognizing UGA / TGA stop codons, and verifies the characteristics of some of the engineered inhibitory tRNAs. At the same time, this example also describes in depth the specific application of these engineered inhibitory tRNAs on plasmids and viral vectors (lentivirus and adeno-associated virus).

[0169] Materials and methods

[0170] Cloning of engineered suppressor tRNA plasmids

[0171] The expression cassette encoding the engineered inhibitory tRNA is mainly composed of three parts: U6 promoter, engineered inhibitory tRNA and poly T tail. Among them, the engineered inhibitory tRNA is derived from a variety of human arginine tRNAs, which do not contain introns or have their introns removed, including tRNA-Arg-ACG-1-1 (TRR-ACG1-1, HGNC: 34964), tRNA-Arg-ACG-2-1 (TRR-ACG2-1, HGNC: 34664), tRNA-Arg-CCG-1-1 (TRR-CCG1-1, HGNC: 34933), tRNA-Arg-CCG-2-1 (TRR-CCG2-1, HGNC: 12346), tRNA-Arg-TCG-1- 1(TRR-TCG1-1, HGNC:34827), tRNA-Arg-TCG-2-1 (TRR-TCG2-1, HGNC:34979), tRNA-Arg-TCG-3-1 (TRR-TCG3-1, HGNC:34939), tRNA-Arg -TCG-4-1 (TRR-TCG4-1, HGNC:12345), tRNA-Arg-TCG-5-1 (TRR-TCG5-1, HGNC:34593), tRNA-Arg-TCG-6-1 (TRR-TCG6-1, HGNC:34584), t RNA-Arg-CCT-1-1 (TRR-CCT1-1, HGNC:34638), tRNA-Arg-CCT-2-1 (TRR-CCT2-1, HGNC:34744), tRNA-Arg-CCT-3-1 (TRR-CCT3-1, HGNC:3 4730), tRNA-Arg-CCT-4-1 (TRR-CCT4-1, HGNC:34975), tRNA-Arg-CCT-5-1 (TRR-CCT5-1, HGNC:34833), tRNA-Arg-TCT-1-1 (TRR-TCT1-1 , HGNC:34695), tRNA-Arg-TCT-2-1 (TRR-TCT2-1, HGNC:12343), tRNA-Arg-TCT-3-1 (TRR-TCT3-1, HGNC:34670), tRNA-Arg-TCT-4-1 (TRR-TCT4-1, HGNC:34728), tRNA-Arg-TCT-5-1 (TRR-TCT5-1, HGNC:34571), the anticodon of the above arginine tRNA has been replaced by the trinucleotide UCA, this change enables it to base pair with the premature stop codon UGA.The sequence information of the engineered inhibitory tRNA is shown in SEQ ID NO: 1 to SEQ ID NO: 27 and SEQ ID NO: 154. At the same time, the sequence information of the original human arginine tRNA sequence, whether it does not contain introns or the introns have been spliced, is shown in SEQ ID NO: 28 to SEQ ID NO: 47. The names of the engineered inhibitory tRNA and its corresponding human arginine tRNA are listed in Table 1.

[0172] Table 1: Information about engineered inhibitory tRNAs

[0173]

[0174]

[0175] After confirming the sequence by Sanger sequencing (performed by GenScript Biotech Corporation), we accurately assembled the above tRNA expression cassette into the parental plasmid pSpCas9(BB)-2A-GFP (i.e., PX458) by replacing the gRNA cassette. To construct the target plasmid, we further removed the Cas9 cassette and AAV2 ITR sequence. The DNA sequence of the parental plasmid pSpCas9(BB)-2A-GFP (PX458) is provided as SEQ ID NO:48. At the same time, the DNA sequence of the engineered inhibitory tRNA plasmid ptRNA-GFP constructed by us is provided as SEQ ID NO:49. In order to generate the engineered inhibitory tRNA expression plasmid, we replaced the region indicated by the dashed line in the plasmid ptRNA-GFP (SEQ ID NO:49) with each of the engineered inhibitory tRNA sequences listed in SEQ ID NO:1 to SEQ ID NO:27 and SEQ ID NO:154. As a specific example, the constructed plasmid ptRNA-GFP-R3-147 with engineered inhibitory tRNA R3-147 (derived from human tRNA-Arg-TCT-1-1) has a sequence as shown in SEQ ID NO: 50. In addition, the EGFP expression cassette in the plasmid is used as a loading control to monitor the expression of the plasmid after cell transfection.

[0176] To construct a negative control, we substituted the engineered inhibitory tRNA R3-147 in plasmid ptRNA-GFP-R3-147 with the scrambled sequence Scr1-4 derived from the inhibitory tRNA R3-147. The RNA sequence of Scr1-4 is provided as SEQ ID NO: 51.

[0177] Transfection of engineered suppressor tRNA plasmid

[0178] The screening of engineered inhibitory tRNAs was performed in two HEK293 cell lines, Luc_V2_R3 and Luc_V3_R3. Both cell lines stably express modified NanoLuc luciferase, but the modification methods are different. Specifically, in Luc_V2_R3 and Luc_V3_R3 cells, the premature termination codon UGA / TGA sequence was inserted after 195bp or 474bp of the NanoLuc luciferase gene, respectively, making it unable to express the full-length protein and lose luciferin activity, such as Figure 1A In addition, these modified NanoLuc luciferases containing UGA / TGA are also fused with 3xMyc and 3x FLAG tags at their N-terminus and C-terminus, respectively. The DNA sequences encoding these two modified NanoLuc luciferases (Luc_V2_R3 and Luc_V3_R3) are provided as SEQ ID NO: 52 and SEQ ID NO: 53, respectively.

[0179] HEK293 cell lines stably expressing another type of modified NanoLuc luciferase were used as corresponding positive controls. In this type of modification, the original premature stop codon UGA / TGA was replaced by the encoding codon GGA for glycine. These two cell lines were named Luc_V2_R4 (i.e., V2_R4) and Luc_V3_R4 (i.e., V3_R4), respectively. The DNA sequences encoding these two modified NanoLuc luciferases (Luc_V2_R4 and Luc_V3_R4) are provided as SEQ ID NO: 54 and SEQ ID NO: 55, respectively.

[0180] To more deeply evaluate the read-through efficiency of the engineered inhibitory tRNA, we performed Western blot and RT-qPCR experiments in DMS114 cells and Calu6 cells. These two cell types were chosen because they contain premature UGA stop codons in their p53 mRNA. Specifically, DMS114 cells carry a homozygous nonsense mutation that results in the conversion of an arginine codon to a UGA stop codon, which in turn produces a truncated p53 protein of 212 amino acids in length. Similarly, in Calu6 cells, an arginine codon was also mutated to a UGA stop codon, resulting in a truncated p53 protein of 195 amino acids in length. To provide comparison, we also used A549 cells expressing wild-type p53 protein as a positive control.

[0181] The cells were cultured at 1×10 4Cells were seeded at a density of 100 cells / well in a 96-well plate, and 100 μL of DMEM medium containing high glucose, supplemented with 10% FBS and 2 mM L-glutamine, was added to each well. When the cell confluence reached 80%, the cells were cultured using the HD transfection reagent (Promega) was used to transfect the engineered inhibitory tRNA plasmid into the cells. HD transfection reagent and DNA were mixed in a 3:1 ratio and incubated at room temperature for 10 minutes, and then 5 μL of the mixture was added to the cells in a 96-well plate, each well containing 100 μL of culture medium. A plasmid with a scrambled sequence Scr1-4 was used as a negative control, and cells cultured in medium supplemented with 500 μg / mL or 5 mg / mL G418 were used as positive controls. For each sample, three replicates were performed on the same plate, making sure they were adjacent to each other. After 48 hours of culture, we quantified the extent of PTC readthrough of the engineered inhibitory tRNA by the following methods: NanoLuc luciferase assay, qPCR, and western blot. The cells used for screening and evaluation of engineered inhibitory tRNAs are listed in Table 2.

[0182] Table 2: Related information of cells used

[0183] Cell Name experiment Targeting Protein PTC Type usage Luc_V2_R3 NanoLuc Luciferase Assay NanoLuc Luciferase UGA / TGA Reporter cells Luc_V3_R3 NanoLuc Luciferase Assay NanoLuc Luciferase UGA / TGA Reporter cells Luc_V2_R4 NanoLuc Luciferase Assay NanoLuc Luciferase - Positive Control Luc_V3_R4 NanoLuc Luciferase Assay NanoLuc Luciferase - Positive Control DMS114 WB, RT-qPCR p53 UGA / TGA Reporter cells Calu6 WB, RT-qPCR p53 UGA / TGA Reporter cells A549 WB, RT-qPCR, IF p53,COL4A5 - Positive Control A549R1563* RT-qPCR COL4A5 UGA / TGA Model cells A549R373* RT-qPCR, IF COL4A5 UGA / TGA Model cells

[0184] NanoLuc Luciferase Assay

[0185] According to the manufacturer's instructions, the NanoLuc luciferase assay was performed using the luciferase assay system (Promega). Luciferase assay substrate with 50 volumes of Luciferase Assay Buffer Mix, prepared fresh Next, we equilibrated the cell culture plate at room temperature for 10 minutes and added 100 μL of Luciferase assay reagent. We continued shaking at room temperature for 5 minutes under dark conditions, and then further transferred the mixture into a white solid plate (Greiner). Finally, we performed the detection by SpectaMax i3x plate reader (Molecular Devices), using endpoint mode and an overall time of 200ms to measure the luminescence intensity.

[0186] Western blotting

[0187] First, the cells were washed twice with PBS, then scraped in the presence of ice-cold RIPA lysis buffer (Sangon Biotech) and lysed on ice for 10 minutes. Next, the supernatant was collected by centrifugation at 21,000g for 10 minutes at 4°C, and the protein concentration was determined on a SpectaMax i3x plate reader (Molecular Devices) using a modified BCA protein assay kit (Sangon Biotech). After adjusting the protein concentration, 5x SDS loading buffer was added to the sample and further denatured at 98°C for 10 minutes. Subsequently, the samples were quickly frozen in liquid nitrogen and stored at -80°C. To separate the protein samples, 20 μg of protein was loaded onto 4%-20% SurePAGE. TM The samples were loaded onto a Bis-Tris (Genscript) gel and run at 150 V for 1 hour in MES buffer (Genscript) using the BIO-RAD system. TM The protein bands were transferred to a 0.22 μm PVDF membrane using a 2Gel Transfer Device (Invitrogen) at 20 V for 7 minutes. The membrane was blocked with 1x TBST containing 3% BSA (Beyotime) for 1 hour at room temperature and incubated with the primary antibody (Table 3) for 1 hour at 4°C. After three 10-minute 1x TBST washes, the membrane was incubated with the secondary antibody (Table 3) at room temperature for 1 hour. After three 10-minute 1x TBST washes, we used the high-sensitivity Plus ECL luminescent reagent (Sangon Biotech) to detect the target protein and used the ChemiDoc MP imaging system (BioRad) for imaging.

[0188] Table 3: Antibody information

[0189]

[0190]

[0191] RNA Isolation

[0192] After two washes with PBS, 1 mL of TRIzol TMReagent (Thermofisher Scientific, 15596026) was used to scrape the cells and incubate at room temperature for 5 minutes. Subsequently, the cells were centrifuged at 12,000g for 5 minutes at 4°C to remove cell debris, and the resulting supernatant was transferred to a new tube containing 0.2mL chloroform and mixed thoroughly by shaking. After the mixture was incubated at room temperature for 5 minutes, it was centrifuged at 12,000g for 15 minutes at 4°C, at which point the mixture was separated into three phases. Next, the upper aqueous phase was transferred to a new tube containing 0.5mL isopropanol and mixed evenly by vortexing. After incubation at 4°C for 10 minutes, the RNA was precipitated at 12,000g for 10 minutes at 4°C to precipitate the RNA. The RNA precipitate was further washed with 1mL of 75% ethanol, then air-dried and resuspended in 50μL of RNase-free water. To remove potential DNA contamination, RNA was further treated with DNase I (New England Biolabs, M0303S) and finally stored at -80°C.

[0193] RT-qPCR

[0194] The concentration of RNA was determined using a nanodrop instrument, and equal amounts of RNA were reverse transcribed using the PrimeScript RT kit (TAKARA, RR037A) according to the manufacturer's instructions. For the detection of p53 mRNA levels, TB Green Premix Ex Taq II (TAKARA, RR82WR) was used to quantify gene expression of the extracted cDNA. The specific primer sequences used are shown in Table 4. qPCR experiments were performed on a 480 system (Roche) with the following program: pre-denaturation at 95°C for 30 seconds, followed by 40 amplification cycles, each cycle consisting of denaturation at 95°C for 5 seconds and annealing and extension at 60°C for 30 seconds.

[0195] Table 4: Primer information used in qPCR for p53 expression detection

[0196] Primer name sequence SEQ ID NO P53_Forward CAGTCACAGCACATGACGGA 61 P53_Reverse CGCCCATGCAGGAACTGTTA 62 GAPDH_Forward AGAAGGCTGGGGCTCATTTG 63 GAPDH_Reverse AGGGGCCATCCACAGTCTTC 64

[0197] Small RNA isolation, library preparation and data processing

[0198] According to industry standards, small RNA isolation, small RNA sequencing library preparation, and RNA sequencing using an Illumina sequencer were performed. After rigorous quality control (using the fastqc software package) and cleaning (using the trimmomatic software package), the sequencing results were compared with a tRNA reference sequence containing all human tRNA sequences (https: / / gtrnadb.ucsc.edu / index.html, Homo sapiens (GRCh38 / hg38)) and with CCA attached to the end of the sequence (using the Bowtie2 software package), so that all mature tRNAs inside the cell can be comprehensively analyzed. The sum of each endogenous tRNA reading obtained is used as a standardized parameter for normalization of different samples. At the same time, according to the characteristics of tRNA, it is further classified into isodecoders (tRNAs with the same anticodon) and isoacceptors (tRNAs carrying the same amino acid) for statistical analysis.

[0199] Co-immunoprecipitation

[0200] After washing twice with PBS, the cells were scraped in the presence of ice-bath RIPA lysis buffer (Sangon Biotech) supplemented with a protease inhibitor cocktail (Roche) and benzalkonium chloride (Sigma), and then lysed on ice for 10 minutes. After centrifugation at 12,000g for 10 minutes at 4°C, the supernatant (whole cell extract, WCE) was collected. Anti-FLAG magnetic beads (Thermo Scientific) were equilibrated at room temperature and then washed three times with lysis buffer. The whole cell extract was mixed with anti-FLAG magnetic beads and incubated at room temperature for 30 minutes. The supernatant (flow-through sample, FT) was collected, and the magnetic beads were washed twice with PBS and once with water. Subsequently, the proteins bound to the magnetic beads were eluted with 50 μL of 2x SDS-PAGE sample buffer and spin denatured at 95°C at 1000 rpm for 10 minutes. The supernatant (immunoprecipitation sample, IP) was collected, quickly frozen in liquid nitrogen, and stored at -80°C.

[0201] Mass spectrometry and data analysis

[0202] The remaining IP samples were then transferred to a service company (Applied Protein Technology) for mass spectrometry analysis. Mass spectrometry (MS) analysis was performed using a high performance liquid chromatography (HPLC) system (Easy-nLC 1000, Thermo Fisher Scientific) coupled to a mass spectrometer (Q Exactive, Thermo Fisher Scientific). For data processing, the raw data was analyzed using MaxQuant 1.6.14 software and a library containing a modified NanoLuc protein with 20 different amino acids inserted after amino acid position 65 (nucleotide position 195). The amino acid sequence of the full-length modified NanoLuc protein is shown in SEQ ID NO: 56. The proteins that may be produced after the PTC read-through are created by replacing the region indicated by the dotted line in the modified NanoLuc protein (highlighted in gray in SEQ ID NO: 56) with one of the 20 different amino acids. For example, an exemplary amino acid sequence of a full-length modified NanoLuc protein (containing the amino acid arginine) is shown in SEQ ID NO: 57. Parameters included a maximum of 2 missed cleavages, a 20 PPM peptide mass tolerance, a 0.1 Da fragment mass tolerance, and a tryptic digest, with Carbamidomethyl (C) specified as a fixed modification and Oxidation (M) as a variable modification. The resulting dataset was further analyzed at the peptide level, considering only peptides with an Andromeda score greater than 40. The proportion of the amino acid carried by the engineered inhibitory tRNA was determined by comparing the abundance of peptides with a specific amino acid insertion to the total abundance of all peptides containing the inserted amino acid.

[0203] Lentiviral transduction

[0204] The Luc_V2_R3 cell line was digested with 0.25% trypsin and then seeded into a 24-well plate at a density of 10,000 cells per well, and lentiviral transduction was performed 24 hours later. According to the viral infection titer provided, the required amount of lentivirus LV_R3-5, LV_R3-8, and LV_R3-147 was calculated to achieve an infection multiplicity (MOI) of 2 and 20. These viruses were diluted in 0.5 mL of DMEM medium containing 2% FBS, and polybrene was added to a final concentration of 8 μg / mL. The original culture medium was discarded, the virus-containing culture medium was added separately, and the cells were cultured in a cell culture incubator at 37°C and 5% CO2. Fresh normal culture medium was replaced after 24 hours, and NanoLuc luciferase detection was performed after 48 hours of culture.

[0205] Adeno-associated virus (AAV) transduction

[0206] NanoLuc reporter cell line Luc-V2-R3 was digested with 0.25% trypsin and seeded at a density of 10,000 cells per well in 24-well plates. Adeno-associated virus (AAV) transduction was performed 24 hours later. Based on the physical titer of the virus provided, the required amount of AAV was calculated to achieve a series of multiplicity of infection (MOI) gradients, ranging from 5.00E+04 to 1.25E+04 vg / cell for scAAV2 / 9. The virus was diluted in 0.2 mL of DMEM medium containing 2% FBS. The original medium was discarded and the medium containing the virus was added to each well. The cells were incubated in a cell culture incubator at 37°C and 5% CO2 for 1 hour, and then 0.3 mL of DMEM medium containing 20% ​​FBS was added to each well. After that, the culture plate was placed in a cell culture incubator at 37°C and 5% CO2 for another 72 hours before NanoLuc luciferase assay.

[0207] Flow cytometry (FCM) analysis

[0208] GFP expression levels were analyzed using flow cytometry. For each sample, 10,000 cells were selected as the research object. The fluorescence signal of GFP was collected through a 488nm bandpass filter, and the average value of GFP-A (i.e., green fluorescence signal) of these 10,000 cells was defined as the fluorescence intensity of GFP. In order to analyze the data more accurately, we identified two regions, P1 and P2, to clearly distinguish between low fluorescence clusters (P1) and high fluorescence clusters (P2). Among them, the P1 cell cluster is defined as GFP non-expressing cells, while the P2 cell cluster represents GFP expressing cells. The percentage of the P2 cell cluster directly reflects the transduction efficiency of the lentivirus (LV).

[0209] result

[0210] First-generation engineered inhibitory tRNAs derived from natural arginine tRNA exhibit variable PTC inhibition efficacy

[0211] Arginine tRNAs that naturally do not contain introns or whose introns are spliced: tRNA-Arg-ACG-1-1, tRNA-Arg-ACG-2-1, tRNA-Arg-CCG-1-1, tRNA-Arg-CCG-2-1, tRNA-Arg-CCT-1-1, tRNA-Arg-CCT-2-1, tRNA-Arg-CCT-3-1, tRNA-Arg-CCT-4-1, tRNA-Arg-CCT-5-1, tRNA-Arg-TCG-1-1, tRNA-Arg-TCG-2-1, tRNA-Arg-TCG-3-1, tRNA-Arg-TCG-4-1, tRNA-Arg-TCG-5-1, tRNA-Arg-TCG-6-1, tRNA-Arg-TCT-1-1 ( Figure 2A ), the anticodons of tRNA-Arg-TCT-2-1, tRNA-Arg-TCT-3-1, tRNA-Arg-TCT-4-1 and tRNA-Arg-TCT-5-1 were replaced by the trinucleotide UCA that can base pair with the stop codon UGA, and then engineered and synthesized. The resulting engineered inhibitory tRNAs R3-1, R3-2, R3-3, R3-4, R3-5, R3-6, R3-7, R3-8, R3-9, R3-10, R3-11, R3-12, R3-13, R3-14, R3-15, R3-147, R3-148, R3-149, R3-150, and R3-151 were cloned one by one into the engineered inhibitory tRNA plasmid ptRNA-GFP (SEQ ID NO: 49) by replacing the dashed line shown in SEQ ID NO: 49, and then transfected into the NanoLuc reporter cell lines Luc_V2_R3 and Luc_V3_R3 for NanoLuc luciferase assays, as shown in FIG. Figure 1A Depicted. The engineered tRNA is able to read through the PTC on the NanoLuc gene in the NanoLuc reporter cell line, thereby producing a full-length and functional NanoLuc protein. This protein can react with the substrate in the reagent to emit fluorescence. Different engineered inhibitory tRNAs have different read-through abilities, resulting in different yields of full-length and functional NanoLuc protein, which is further reflected in the variation of fluorescence intensity. Based on the data obtained from the NanoLuc luciferase assay, we observed heterogeneity in the read-through ability of the PTC ( Figure 1B to Figure 1CThis indicates that in addition to the anticodon, other sequences of tRNA will also affect the function of engineered inhibitory tRNA. Among all the engineered inhibitory tRNAs screened, R3-8 derived from human tRNA-Arg-CCT-4-1 and R3-147 derived from tRNA-Arg-TCT-1-1 showed extremely high luciferase activity in both NanoLuc reporter cell lines ( Figure 1B to Figure 1C In contrast, the negative control transfected with Scr1-4 showed only weak luciferase activity.

[0212] We selected six engineered inhibitory tRNAs, namely R3-7, R3-8, R3-13, R3-147, R3-148 and R3-149, and conducted further testing by western blot and RT-qPCR. Two different p53-UGA cell lines, Calu6 and DMS114, were used for testing, both of which were transfected with the candidate engineered inhibitory tRNAs. Since the engineered inhibitory tRNAs have the ability to recognize and read through the PTC, in cells transfected with active engineered inhibitory tRNAs, p53 mRNA containing the PTC can be read through and protected from degradation by the NMD pathway, and the amount of p53 protein will increase accordingly. At the same time, we also used an aminoglycoside, G418, which exhibits PTC read-through ability and was used as another positive control. The results showed that in both cell lines, R3-147 rescued the most full-length p53 protein, and its level even reached a level comparable to that of the positive control cell line A549 ( Figure 1D to Figure 1E We did not detect full-length p53 protein in negative controls, including samples from untreated DMS114 cells and cell lines transfected with Scr1-4 ( Figure 1D to Figure 1E In addition, the amount of full-length p53 protein product was very small or absent in the cell lines treated with different concentrations of G418 ( Figure 1D to Figure 1E RT-qPCR results showed that the levels of p53 mRNA containing the UGA premature termination codon in both R3-147-transfected cell lines were significantly higher than the wild-type p53 mRNA levels in the A549 positive control cell line, which were more than 4.5 times higher ( Figure 1F as shown) or 1.5 times or more ( Figure 1G ). This indicates that the p53 mRNA containing the PTC successfully escapes from the NMD pathway. The above results all indicate that the engineered inhibitory tRNA can effectively read through the PTC to produce a full-length, functional protein and can rescue the degradation of the mRNA containing the PTC to a certain extent.

[0213] Engineered inhibitory tRNA is present in cells in full-length form

[0214] The plasmid containing the engineered inhibitory tRNA was transfected into the NanoLuc reporter cell line Luc_V2_R3, and then all tRNAs in the cells were isolated and analyzed according to the method described by Hu et al. (Hu, J. et al. (2021). "Quantitative mapping of the cellular small RNA landscape with AQ RNA-seq." Nature biotechnology. 39: 8: 978-988. doi: 10.1038 / s41587-021-00874-y. PMID: 33859402). Fig. 1I As shown in the left figure, the expression of engineered inhibitory tRNA R3-8 was observed in cells transfected with the plasmid containing engineered inhibitory tRNA R3-8, while no R3-8 signal was detected in cells transfected with other plasmids. Similarly, the expression of engineered inhibitory tRNA R3-147 was only observed in cells transfected with the R3-147 plasmid (as shown in Fig. 1I It is noteworthy that all of these engineered inhibitory tRNAs exist in full-length form, and no tRNA fragments derived from them were observed. In addition, endogenous tRNA Arg-CCT-4-1 corresponding to R3-8 and R3-147 was detected in transfected cells (as shown in the right figure). Figure 1K Left figure) and Arg-TCT-1-1 (as Figure 1K The expression levels of 547 cells were comparable to those of cells transfected with Scr1-4 or treated with water (right panel). It should also be noted that the decreases observed at some positions in the line graph are due to nucleotide skipping during reverse transcription at nucleotides with specific chemical modifications in tRNA.

[0215] Expression of engineered inhibitory tRNAs did not alter the homeostasis of the endogenous tRNA group in the cytoplasm

[0216] In addition, cells transfected with plasmids containing engineered inhibitory tRNAs showed significant differences in expression at the single tRNA level (e.g., Figure 1L to Figure 1M As shown in the left figure), the same decoding sub-level (such as Figure 1L to Figure 1M middle figure) and at the same receptor level (as Figure 1L to Figure 1M No significant changes in the abundance of mature endogenous tRNA were found in either of the above-mentioned engineered inhibitory tRNAs (shown in the right figure). These findings strongly suggest that the expression of the above-mentioned engineered inhibitory tRNAs does not disrupt the tRNA group homeostasis in cells.

[0217] The full-length protein produced after PTC read-through has an arginine inserted at the expected position

[0218] Luc-V2-R3 cells were transfected with plasmids containing various engineered inhibitory tRNAs. The NanoLuc gene carried by the cells carries a PTC, which, when read through by the engineered inhibitory tRNA, produces a full-length NanoLuc protein with a FLAG tag fused to the C-terminus (e.g. Figure 1A As shown in the figure above). Subsequently, the cells were subjected to immunoprecipitation experiments, and the immunoprecipitated protein samples were analyzed by Western blot. Figure 1P As shown in Table 5, the content of full-length modified NanoLuc protein in immunoprecipitation (IP) samples was significantly higher than that in whole cell extract (WCE) samples. No signal was observed in the flow-through (FT) samples or negative control Scr1-4, which confirmed the read-through ability of the engineered inhibitory tRNA and the successful enrichment of NanoLuc full-length protein in the immunoprecipitation experiment. At the same time, mass spectrometry detection and subsequent data analysis of the protein bands showed that only full-length proteins with arginine inserted were detected, as shown in Table 5. This result directly indicates that these engineered inhibitory tRNAs only carry arginine.

[0219] Table 5: Amino acid ratios carried by engineered inhibitory tRNA

[0220] Engineered inhibitory tRNA Amino Acids Proportion R3-8 Arginine 1 R3-147 Arginine 1 R3-147-M54 Arginine 1

[0221] Engineered inhibitory tRNA delivered by lentivirus (LV) restores the function of NanoLuc protein containing PTC

[0222] The region marked with a dashed line and highlighted in gray in the DNA sequence of the lentiviral vector (SEQ ID NO: 58) was replaced with the engineered inhibitory tRNA R3-5 ( Figure 3A , whose sequence corresponds to SEQ ID NO: 13), R3-8 ( Figure 3B , whose sequence corresponds to SEQ ID NO: 16) and R3-147 ( Figure 2B , whose sequence corresponds to the sequence of SEQ ID NO: 1) (in its reverse complementary RNA form), is used to construct a lentiviral (LV) vector carrying the engineered inhibitory tRNA. At the same time, the vector contains a green fluorescent protein (GFP) expression cassette as a marker to facilitate monitoring of transduction efficiency. When the Luc-V2-R3 cell line was infected with the lentivirus carrying the engineered inhibitory tRNA, a high proportion of GFP-positive cells (such as Figure 1Q to Figure 1SThis indicates that the vector not only successfully achieved cell transduction, but also successfully integrated itself into the cell genome. At the same time, these samples also showed NanoLuc luciferase activity (as shown in Figure 1Q to Figure 1S As shown in Figure 2, the normal expression of engineered inhibitory tRNA in cells was confirmed, and it was also proved that engineered inhibitory tRNA can play its expected role in lentiviral vectors. In addition, with the decrease of infection multiplicity (MOI), the proportion of GFP-positive cells and NanoLuc luciferase activity showed a gradual downward trend (as shown in Figure 2). Figure 1Q to Figure 1S This phenomenon indicates that the expression level of engineered inhibitory tRNA in cells does change due to the influence of infection multiplicity, which not only indirectly proves that the observed fluorescence signal is indeed produced by the full-length NanoLuc protein produced by read-through, but also further proves that lentiviral vectors can express engineered inhibitory tRNA very stably.

[0223] Engineered inhibitory tRNA delivered by scAAV2 / 9 restores the function of NanoLuc protein containing PTC

[0224] The region marked by a dashed line and highlighted in gray in the self-complementary adeno-associated virus (scAAV) vector DNA sequence (SEQ ID NO: 60) was replaced with the engineered inhibitory tRNA R3-5 ( Figure 3A , whose sequence corresponds to SEQ ID NO: 13), R3-8 ( Figure 3B , whose sequence corresponds to SEQ ID NO: 16) and R3-147 ( Figure 2B , whose sequence corresponds to the sequence of SEQ ID NO: 1) (in DNA form), and a scAAV vector carrying an engineered inhibitory tRNA was constructed (e.g. Figure 1CC When the Luc-V2-R3 cell line was infected with the adeno-associated virus scAAV2 / 9 carrying the engineered inhibitory tRNA, the cells exhibited NanoLuc luciferase activity (as shown in Figure 2A). Fig. 1DD This indicates that the scAAV vector not only successfully achieved cell transduction, but also verified the normal expression of the engineered inhibitory tRNA in the cell, and proved that the engineered inhibitory tRNA can play its expected role in the scAAV vector. In addition, as the multiplicity of infection (MOI) decreases, the NanoLuc luciferase activity also shows a gradual downward trend (as shown in Figure 2). Fig. 1DDThis phenomenon indicates that the expression level of engineered inhibitory tRNA in cells does change due to the influence of infection multiplicity, which not only indirectly proves that the observed fluorescence signal is indeed produced by the full-length NanoLuc protein produced by read-through, but also further proves that the scAAV vector can express engineered inhibitory tRNA very stably.

[0225] Example 2

[0226] The following examples describe in detail the PTC readthrough of modified engineered inhibitory tRNAs in different cells, and verify the characteristics of some of the engineered inhibitory tRNAs.

[0227] Materials and methods

[0228] Cloning of engineered suppressor tRNA plasmids

[0229] For specific materials and methods, please refer to Example 1 for a detailed description of the method.

[0230] Transfection of engineered inhibitory tRNA plasmid

[0231] For specific materials and methods, please refer to Example 1 for a detailed description of the method.

[0232] NanoLuc Luciferase Assay

[0233] For specific materials and methods, please refer to Example 1 for a detailed description of the method.

[0234] Western blotting

[0235] For specific materials and methods, please refer to Example 1 for a detailed description of the method.

[0236] RNA Isolation

[0237] For specific materials and methods, please refer to Example 1 for a detailed description of the method.

[0238] RT-qPCR

[0239] For specific materials and methods, please refer to Example 1 for a detailed description of the method.

[0240] Small RNA isolation, library preparation and data processing

[0241] For specific materials and methods, please refer to Example 1 for a detailed description of the method.

[0242] result

[0243] Modification of inhibitory tRNA enhances PTC readthrough

[0244] Based on R3-147, multiple modifications were introduced into the tRNA anticodon arms and tails, generating FIG. 2C to FIG. 2I The engineered inhibitory tRNAs shown. The ability of these tRNAs to inhibit PTC is determined by Figure 1A Specifically, the engineered inhibitory tRNA "M2" (see Figure 2C R3-147-M2) contains a C at the 4th nucleotide position after the 3' end of the anticodon (i.e., Sprinz1 position 40), while R3-147 contains a U at the same position (Sprinz1 position 40) (see Figure 2B ). Engineered inhibitory tRNA "M3" (see Figure 2D , i.e. R3-147-M3) is to add a codable 3'CCA tail at the DNA level. The engineered inhibitory tRNA "M4" (see Figure 2E , i.e. R3-147-M4) contains a G at the first nucleotide position after the 3' end of the anticodon (i.e. Sprinz1 position 7), while R3-147 contains an A at this position (Sprinz1 position 37) (see Figure 2B In addition, the engineered inhibitory tRNA "M5" (see Figure 2F , i.e., R3-147-M5) combines modifications of M2 and M3; the engineered inhibitory tRNA "M6" (see Figure 2G , i.e., R3-147-M6) combines modifications of M2 and M4; the engineered inhibitory tRNA "M7" (see Figure 2H , i.e., R3-147-M7) combines modifications of M3 and M4; while the engineered inhibitory tRNA "M8" (see Fig.2I , i.e. R3-147-M8) combines modifications of M2, M3 and M4 at the same time.

[0245] like Figure 1H As shown in the figure, each modified engineered inhibitory tRNA, namely M2, M3, M4, M5, M6, M7 and M8, exhibited a certain degree of PTC read-through effect. Among them, M2, M3, M4, M5 and M7 showed an enhanced PTC read-through effect of nearly 2 times or more, which proves that modification of these specific sites can significantly enhance the inhibitory effect of engineered inhibitory tRNA on PTC. In contrast, the enhancement of M6 and M8 on PTC read-through is relatively weak, which may be due to the fact that the simultaneous change of the first and fourth nucleotides after the 3' end of the anticodon will weaken the enhancement effect brought by the single modification.

[0246] Engineered tRNAs M2, M3, M4, M5, M6, M7, and M8 were also tested in depth by western blotting and RT-qPCR. The two different p53-UGA cell lines mentioned above, Calu6 and DMS114, were tested, while the A549 cell line and the Calu6 and DMS114 cell lines transfected with R3-147 were used as positive controls. In both cell lines, cells transfected with the modified engineered inhibitory tRNA performed well, showing full-length p53 protein levels comparable to or higher than the positive control cell line A549 (e.g. Figure 1T In particular, both cell lines transfected with partially engineered inhibitory tRNAs, such as M7, displayed higher levels of full-length p53 protein than cells transfected with R3-147 (e.g. Figure 1T We did not detect full-length p53 protein in negative controls, including blank (H2O) and Scr1-4 transfected cell lines (as shown). Figure 1T Similarly, the Calu6 cell line treated with G418 also showed no detection of full-length p53 protein product (as shown in Figure 1T left).

[0247] The results of RT-qPCR showed that after using engineered tRNA M2, M3, M4, M5, M6, M7 and M8, p53 mRNA containing premature UGA termination codon showed different degrees of accumulation (e.g. Figure 1U In particular, in the DMS114 cell line, cells transfected with M4 and M7 accumulated 10 times more p53 mRNA than the A549 positive control cell line (as shown in Figure 1U In the Calu6 cell line, cells transfected with M7 also accumulated about 4.5 times more p53 mRNA than the A549 positive control cell line (as shown in the right figure). Figure 1U These results consistently show that these modified engineered inhibitory tRNAs exhibit stronger PTC readthrough effects than the first-generation engineered inhibitory tRNAs. At the same time, after being transfected into different cells through plasmids, they can perform PTC readthrough on different target genes, a finding that confirms the broad spectrum of their effects.

[0248] The modified engineered inhibitory tRNA is present in the cell in its full-length form

[0249] Using the method described in Example 1, tRNA sequencing was performed on the Luc_V2_R3 cell line transfected with the modified engineered inhibitory tRNA via plasmid. Figure 1VAs shown in the left figure, in cells transfected with engineered inhibitory tRNA R3-147 and M3, we observed the expression of engineered inhibitory tRNA R3-147. This phenomenon is attributed to the fact that R3-147 and M3 have the same sequence after transcription and maturation in the cell. It is worth noting that the tRNAR3-147 signal detected in cells transfected with M3 was significantly higher than that in cells transfected with R3-147, indicating that adding the CCA sequence at the DNA level can effectively increase the content of exogenous tRNA in the cell. This increase is not due to an increase in transcription levels (because the same U6 promoter is used), but may be due to the avoidance of the tailing step during the tRNA maturation process, thereby avoiding tRNA degradation caused by tailing errors, or enhancing the stability of tRNA. Similarly, as Figure 1V As shown in the right figure, the expression of engineered inhibitory tRNA M2 was observed only in cells transfected with the M2 plasmid, and its expression level was comparable to the level of mature tRNA R3-147 expressed in cells transfected with R3-147. Figure 1W As shown in the left figure, we only observed the expression of engineered inhibitory tRNA M4 in cells transfected with M4 plasmid, and its expression level was slightly lower than that of mature tRNA R3-147 expressed in cells transfected with R3-147. Importantly, all of these engineered inhibitory tRNAs were present in full-length form. In addition, when sequencing cells transfected with Scr1-4, it was found that the expression level of Scr1-4 was extremely low (e.g. Figure 1W As shown in the right figure, the readings were only slightly above the detection limit. In cells transfected with engineered inhibitory tRNA, although some Scr1-4 sequence signals were detected, these readings were extremely low and below the detection limit, so they were treated as background signals. Figure 1X As shown in the figure, in the transfected cells, we detected the endogenous tRNA Arg-TCT-1-1 corresponding to the above-mentioned engineered inhibitory tRNA, and its expression level was comparable to that of the negative control cells transfected with Scr1-4. This result further confirms that the modification of tRNA does not lead to changes in the expression level of its endogenous related tRNA. Finally, it should be noted that the broken line at the 5' end of tRNA in the online graph gradually decreases. This is because the 3' end is used as the starting site during the reverse transcription of tRNA, and reverse transcription termination occurs when encountering specific chemically modified nucleotides.

[0250] Expression of engineered inhibitory tRNAs did not alter the homeostasis of the endogenous tRNA group in the cytoplasm

[0251] In addition, cells transfected with the modified engineered inhibitory tRNA showed significant differences in the expression of inhibitory tRNAs at the single tRNA level (e.g., Figure 1Y to Figure 1BB As shown in the left figure), the same decoding sub-level (such as Figure 1Y to Figure 1BB middle figure) and at the same receptor level (as Figure 1Y to Figure 1BB No significant changes in the abundance of mature endogenous tRNAs were found in either of the two experiments (shown in the right figure). These findings strongly suggest that the expression of modified engineered inhibitory tRNAs does not disrupt the tRNA homeostasis in cells.

[0252] Example 3

[0253] The following example describes in detail the significant improvement of the optimized engineered inhibitory tRNA M54 in PTC read-through ability and comprehensively verifies its characteristics. In addition, this example also describes in depth the specific application of M54 in plasmids and viral vectors (including lentivirus and adeno-associated virus), as well as its specific application in disease model cells and animal experiments.

[0254] Materials and methods

[0255] Cloning of engineered suppressor tRNA plasmids

[0256] For specific materials and methods, please refer to Example 1 for a detailed description of the method.

[0257] Transfection of engineered inhibitory tRNA plasmid

[0258] For specific materials and methods, please refer to Example 1 for a detailed description of the method.

[0259] NanoLuc Luciferase Assay

[0260] For specific materials and methods, please refer to Example 1 for a detailed description of the method.

[0261] Western blotting

[0262] For specific materials and methods, please refer to Example 1 for a detailed description of the method.

[0263] RNA Isolation

[0264] For specific materials and methods, please refer to Example 1 for a detailed description of the method.

[0265] RT-qPCR

[0266] The RNA concentration was determined using a nanodrop instrument, and equal amounts of RNA were reverse transcribed using a High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific, 4368814) according to the manufacturer's instructions. For the detection of COL4A5 mRNA levels, TaqMan TM Fast Advanced Master Mix (Thermofisher Scientific, 4444556) was used to quantify the gene expression of the corresponding cDNA. The specific primer sequences used are shown in Table 6. qPCR experiments were performed on a 480 system (Roche) with the following program: pre-denaturation at 95°C for 30 seconds, followed by 40 amplification cycles, each cycle consisting of denaturation at 95°C for 5 seconds and annealing and extension at 60°C for 30 seconds.

[0267] Table 6: Primer information used in qPCR for COL4A5 expression detection

[0268]

[0269] Small RNA isolation, library preparation and data processing

[0270] For specific materials and methods, please refer to Example 1 for a detailed description of the method.

[0271] Co-immunoprecipitation

[0272] For specific materials and methods, please refer to Example 1 for a detailed description of the method.

[0273] Mass spectrometry and data analysis

[0274] For specific materials and methods, please refer to Example 1 for a detailed description of the method.

[0275] Lentiviral transduction and cell screening

[0276] A549 cell lines containing COL4A5 PTC and wild type were digested with 0.25% trypsin and then seeded into 24-well plates at a density of 30,000 cells per well, and lentiviral transduction was performed 24 hours later. According to the virus infection titer provided, the required amount of lentivirus LV_R3-147 and LV_R3-147-M54 was calculated to achieve an infection multiplicity (MOI) of 20. These viruses were diluted in 0.5mL of DMEM medium containing 2% FBS, and polybrene was added to a final concentration of 8μg / mL. The original culture medium was discarded, the virus-containing culture medium was added separately, and the cells were cultured in a cell culture incubator at 37°C and 5% CO2. After 24 hours of lentiviral transduction, the virus-containing culture medium was replaced and the cells were transferred to a 6-well plate. Puromycin was added to the culture medium to a final concentration of 1μg / mL to screen out cells that have integrated the lentivirus. After the cell growth stabilized, it was cultured in normal culture medium for subsequent experiments.

[0277] Adeno-associated virus (AAV) transduction

[0278] NanoLuc reporter cell line Luc-V2-R3 was digested with 0.25% trypsin and seeded in 24-well plates at a density of 10,000 cells per well. Adeno-associated virus (AAV) transduction was performed 24 hours later. Based on the physical titer of the virus provided, the required amount of AAV was calculated to achieve a series of multiplicity of infection (MOI) gradients, ranging from 2.00E+05 to 2.5E+04 vg / cell for ssAAV2 / 9. The virus was diluted in 0.2 mL of DMEM medium containing 2% FBS. The original medium was discarded and the medium containing the virus was added to each well. The cells were incubated in a cell culture incubator at 37°C and 5% CO2 for 1 hour, and then 0.3 mL of DMEM medium containing 20% ​​FBS was added to each well. After that, the culture plate was placed in a cell culture incubator at 37°C and 5% CO2 for another 72 hours before NanoLuc luciferase assay.

[0279] Flow cytometry (FCM) analysis

[0280] For analysis of GFP expression levels, please see Example 1 for a detailed description of the method.

[0281] The expression level of mCherry was analyzed using flow cytometry. For each sample, 10,000 cells were selected as the research object. The fluorescence signal of mCherry was collected through a 587nm bandpass filter, and the average value of mCherry-A (i.e., red fluorescence signal) of these 10,000 cells was defined as the fluorescence intensity of mCherry. In order to analyze the data more accurately, we identified two regions, P1 and P2, to clearly distinguish between low fluorescence clusters (P1) and high fluorescence clusters (P2). Among them, the P1 cell cluster is defined as mCherry non-expressing cells, while the P2 cell cluster represents mCherry expressing cells. The percentage of the P2 cell cluster directly reflects the transduction efficiency of the adeno-associated virus (AAV).

[0282] Immunofluorescence staining and data analysis

[0283] A549 cell lines containing COL4A5 PTC and wild type were digested with 0.25% trypsin, and then the cells were seeded at a density of 50,000 per well in a 24-well plate and cultured in a 37°C, 5% CO2 cell culture incubator for 24 hours. Subsequently, the cells were fixed with 500 μL of 4% paraformaldehyde (dissolved in PBS, pH 7.4) for 10 minutes, and then washed three times with 500 μL of ice-cold PBS for 10 minutes each. After that, the cells were permeabilized with 500 μL of PBS containing 0.1% Triton-X 100 for 10 minutes, and then washed three times with 500 μL of PBS for 10 minutes each. To block nonspecific antibody binding, the cells were treated with 500 μL of PBS containing 10% goat serum for 1 hour. Subsequently, the cells were washed three times with 500 μL PBS for 5 minutes each time, and then the cells were incubated with the primary antibody Anti-COL4A5 H53 (Table 3) at 4°C overnight, and the primary antibody was diluted in PBS containing 10% goat serum at a ratio of 1:500. After washing three times with PBST (PBS + 0.1% Tween 20) for 10 minutes each time, the cells were incubated with the secondary antibody Goat anti-RatAF647 (Table 3) at room temperature in the dark for 1 hour, and the secondary antibody was diluted in PBS at a ratio of 1:1000. Subsequently, the cells were washed three times with PBST for 10 minutes each time, and then the cell nuclei were stained with Hoechst 33342 diluted in PBST at a ratio of 1:200 for 5 minutes. After washing three times with PBST for 10 minutes each time, the cells were stored in 500 μL PBS solution and placed at 4°C. Immunofluorescence signals were observed using a confocal microscope (Nikon). ImageJ software was used to analyze the signal density of COL4A5, and the cells were counted according to the Hoechst 33342 signal.

[0284] result

[0285] Modification of inhibitory tRNA enhances PTC readthrough

[0286] Based on M2, more modifications were introduced on the anticodon arm and acceptor arm of tRNA, thus successfully constructing Figure 2J The engineered inhibitory tRNA M54 shown in Figure 1 was used. Through NanoLuc luciferase assay, it was found that M54 exhibited a read-through effect of about 11 times that of R3-147 ( Figure 4A In contrast, M2 only showed a read-through effect about twice that of R3-147 in the same assay (as shown in Figure 1H This suggests that these additional modifications can significantly enhance the inhibitory effect of the engineered inhibitory tRNA on PTC.

[0287] M54 is expressed in high amounts in cells in its full-length form and does not alter the homeostasis of the endogenous tRNA group in the cytoplasm

[0288] Using the method described in Example 1, tRNA sequencing was performed on the Luc_V2_R3 cell line transfected with M54 by plasmid. The results are as follows Figure 1J As shown in Figure 2, the expression of the engineered inhibitory tRNA M54 was observed only in cells transfected with M54, and it existed in full-length form, and no tRNA fragments derived from it were observed. In addition, the corresponding endogenous tRNA Arg-TCT-1-1 (such as Figure 1K The expression level of R3-147 was comparable to that of Scr1-4 transfected cells or water-treated negative control cells. Fig. 1I The expression level of M54 increased by about 6 times compared with that of its corresponding endogenous tRNA Arg-TCT-1-1 (as shown in the right figure). Figure 1K In addition, despite the high expression level of M54, cells transfected with a plasmid containing M54 showed a decrease in expression at the single tRNA level (as shown in the right figure) compared to cells transfected with the negative control Scr1-4. Figure 1N As shown in the left figure), the same decoding sub-level (such as Figure 1N middle figure) and at the same receptor level (as Figure 1N No significant changes in the abundance of mature endogenous tRNA were found in either of the two groups (shown in the right figure). These findings strongly suggest that the expression of engineered inhibitory tRNAs did not disrupt the homeostasis of the tRNA group in cells. Fig.1O No significant difference was found between the cells transfected with negative control Scr1-4 and the cells transfected with negative control Scr1-4.

[0289] The full-length protein produced after PTC read-through has an arginine inserted at the expected position

[0290] Using the method described in Example 1, mass spectrometry analysis was performed on the Luc_V2_R3 cell line transfected with M54 by plasmid. Figure 1P As shown in Table 5, the content of full-length modified NanoLuc protein in immunoprecipitation (IP) samples was significantly higher than that in whole cell extract (WCE) samples. No signal was observed in the flow-through (FT) samples or negative control Scr1-4, which confirmed the read-through ability of the engineered inhibitory tRNA M54 and the successful enrichment of NanoLuc full-length protein in the immunoprecipitation experiment. At the same time, mass spectrometry detection and subsequent data analysis of the protein bands showed that only the full-length protein with arginine inserted was detected, as shown in Table 5. This result directly indicates that the engineered inhibitory tRNA M54 only carries arginine.

[0291] Engineered inhibitory tRNA delivered by lentivirus (LV) restores mRNA levels of COL4A5 gene containing PTC Nonsense mutations in COL4A5 gene cause PTC, a major cause of Alport syndrome. Therefore, at the cellular level, it is of great significance to explore the read-through effect of engineered inhibitory tRNA on COL4A5 gene carrying PTC. The region marked by dotted lines and highlighted in gray in the lentiviral vector DNA sequence (SEQ ID NO:58) was replaced with engineered inhibitory tRNA M54 (as shown in Figure 5A). Figure 2J As shown in FIG. 154, the sequence of which corresponds to the reverse complementary RNA sequence of SEQ ID NO: 154), a lentiviral (LV) vector carrying the engineered inhibitory tRNA was constructed. In addition, the vector also contains a green fluorescent protein (GFP) expression cassette as a marker for monitoring transduction efficiency, and a puromycin resistance gene (PuroR) as a cell selection marker. The lentivirus encapsulated with the vector was then used in experiments. The experimental results show that, as Figure 4BAs shown in the left figure, compared with untreated PTC cells, the mRNA level in the COL4A5 R1563* cell line that was lentivirally transduced with engineered inhibitory tRNA was increased. Among them, the COL4A5 mRNA level of cells transduced with LV_R3-147 increased by about 1 times, reaching about a quarter of the normal mRNA level in the wild-type A549 cell line; and the COL4A5 mRNA level of cells transduced with LV_R3-147-M54 increased by about 3 times, reaching about 60% of the normal mRNA level in the wild-type A549 cell line. Consistent with the results of the NanoLuc luciferase assay, M54 has a much higher read-through ability for PTC than R3-147. At the same time, in another cell line containing COL4A5 PTC, COL4A5R373* (as shown in Figure 2A), the mRNA level of COL4A5 in cells transduced with LV_R3-147-M54 increased by about 3 times, reaching about 60% of the normal mRNA level in the wild-type A549 cell line. Figure 4B As shown in the right figure), cells transduced with engineered inhibitory tRNA M54 also performed well, with mRNA levels increased by about 3 times compared to untreated PTC cells, reaching about 45% of the normal mRNA level in the wild-type A549 cell line. This set of experimental results shows that the above-mentioned engineered inhibitory tRNA can be effectively transduced into different cells by lentiviral vectors for expression and exert its effect, and that engineered inhibitory tRNA M54 can effectively restore the mRNA levels of PTCs at different locations.

[0292] Engineered inhibitory tRNA delivered by lentivirus (LV) restored protein levels of the COL4A5 gene containing the PTC

[0293] Given the ability of the engineered inhibitory tRNA to read through the PTC and produce the full-length protein, we further measured the restoration of COL4A5 protein levels in the PTC cell line after observing that it was able to restore COL4A5 mRNA levels containing the PTC. The quantification results obtained by immunofluorescence analysis of the full-length COL4A5 protein are shown in Figure 2. Figure 4C As shown. Compared with the untreated PTC cell line, the expression of the full-length COL4A5 protein in the PTC cell line COL4A5 R373* increased 3-fold after LV_R3-147-M54 transduction, which is equivalent to the mRNA recovery level. These results show that the engineered inhibitory tRNA M54 not only restores the mRNA level containing PTC, but also restores the expression of the full-length protein in the same proportion, fully verifying the high efficiency and reliability of this molecule.

[0294] Engineered inhibitory tRNA delivered by ssAAV2 / 9 restores the function of the PTC-containing NanoLuc protein

[0295] The region marked by a dashed line and highlighted in gray in the single-stranded adeno-associated virus (ssAAV) vector DNA sequence (SEQ ID NO: 59) was replaced with the engineered inhibitory tRNA R3-147 ( Figure 2B As shown, its sequence corresponds to SEQ ID NO: 1) and R3-147-M54 (as Figure 2J As shown, its sequence corresponds to SEQ ID NO: 154) DNA sequence, thereby constructing a ssAAV vector carrying an engineered inhibitory tRNA (such as Figure 4D ). At the same time, the vector also contains a red fluorescent protein (mCherry) expression cassette as a marker to facilitate monitoring of transduction efficiency. When the Luc-V2-R3 cell line was infected with ssAAV2 / 9 carrying the engineered inhibitory tRNA, we observed mCherry-positive cells (as shown in FIG. 4E to FIG. 4F This indicates that the vector not only successfully achieved cell transduction, but also successfully expressed the gene integrated into it. At the same time, these samples also showed NanoLuc luciferase activity (as shown in FIG. 4E to FIG. 4F This confirms the normal expression of the engineered inhibitory tRNA in the cell and proves that the engineered inhibitory tRNA can play its expected role in the ssAAV viral vector. In addition, as the multiplicity of infection (MOI) decreases, the proportion of mCherry-positive cells and NanoLuc luciferase activity both show a gradual downward trend (as shown in Figure 2). FIG. 4E to FIG. 4F This phenomenon indicates that the expression level of engineered inhibitory tRNA in cells does change due to the influence of infection multiplicity. This not only indirectly proves that the observed fluorescence signal is indeed produced by the full-length NanoLuc protein produced by read-through, but also further proves that ssAAV viral vectors can express engineered inhibitory tRNA very stably. At the same time, in contrast to the transduction of engineered inhibitory tRNA R3-147 (as shown in Figure 4E as shown) and M54 (as Figure 4F When comparing the experimental results of M54 and R3-147, we found that at similar transduction efficiencies, the NanoLuc luciferase activity test results of M54 were much higher than those of R3-147. This result once again proves that the modified engineered inhibitory tRNA described in the present invention exhibits extremely high PTC readthrough ability.

[0296] Engineered inhibitory tRNA delivered by ssAAV2 / 9 also exerts its PTC readthrough ability in mice

[0297] At the cellular level, the PTC read-through ability of the engineered inhibitory tRNA described in the present invention has been verified on different genes, cell types and vector systems. Therefore, its performance in vivo is also worthy of further exploration. To this end, we selected mice with Alport syndrome (Alport syndrome, also known as eye-ear-kidney syndrome) as experimental subjects. This is a hereditary nephritis that mainly affects multiple systems such as the kidneys, eyes and ears. Patients may experience symptoms such as hematuria and proteinuria. Increased urine albumin levels or increased urine albumin to creatinine ratio are important indicators for evaluating Alport syndrome, so we chose to detect this ratio to evaluate symptom relief. In the experiment, 4-week-old male PTC mice (COL4A5-R471* / Y) were injected through the tail vein with ssAAV-2xU6 vector ( Figure 4D , SEQ ID NO:59). The virus contains a nucleotide sequence encoding an engineered inhibitory tRNA R3-147 or M54 (corresponding to SEQ ID NO:1 or SEQ ID NO:154, respectively). Afterwards, we regularly monitored the urine albumin and creatinine levels of these mice to assess the relief of symptoms. At the same time, mice with a wild-type genetic background served as positive controls.

[0298] The experimental results showed that compared with wild-type mice, the ratio of urine albumin to creatinine in PTC mice injected with saline and PTC mice injected with 5E11 v.g. or 1.5E12 vg of ssAAV2 / 9_R3-147 did not show significant recovery ( Figure 4G ). This suggests that at this dose, the engineered inhibitory tRNA R3-147 has limited efficacy in treating Alport syndrome. However, when M54 was used as the drug molecule, the therapeutic effect was significantly improved. Compared with PTC mice injected with a low dose (1.5E11 vg) of ssAAV2 / 9_R3-147-M54 or saline, PTC mice injected with medium doses (5E11 v.g.) and high doses (1.5E12 vg) of ssAAV2 / 9_R3-147-M54 had a significant step-wise decrease in the ratio of urinary albumin to creatinine ( Figure 4H ). This shows that the modified inhibitory tRNA R3-147-M54 shows a significant effect in treating Alport syndrome, and the therapeutic effect of high doses is more significant than that of medium and low doses. This result also formally verifies that the engineered inhibitory tRNA described in the present invention can also play its expected role in vivo.

[0299] SEQ ID NO: 1-27,154: Arginine tRNA derived from human intron-free and intron-spliced ​​tRNA, engineered inhibitory tRNA obtained by changing the anticodon

[0300] SEQ ID NO: 1 = Nucleotide (RNA) sequence of engineered inhibitory tRNAR3-147 derived from human tRNA-Arg-TCT-1-1 with intron spliced, from 5' to 3'; anticodon is in bold:

[0301] SEQ ID NO: 2-8 are modified engineered inhibitory tRNAs M2-M8, respectively

[0302] SEQ ID NO:2 = Nucleotide (RNA) sequence of engineered suppressor tRNA R3-147-M2 (ie, M2) based on modifications of engineered suppressor tRNA R3-147, with U replaced by C at position 40, from 5' to 3'; anticodon in bold; modifications in bold and highlighted:

[0303]

[0304] SEQ ID NO:3 = Nucleotide (RNA) sequence of engineered suppressor tRNA R3-147-M3 (ie, M3) based on modifications of engineered suppressor tRNA R3-147 with a CCA tail added at the 3' end, from 5' to 3'; anticodon in bold; modifications in bold and highlighted:

[0305]

[0306] SEQ ID NO:4 = Nucleotide (RNA) sequence of engineered suppressor tRNA R3-147-M4 (ie, M4) based on modifications of engineered suppressor tRNA R3-147, with A replaced by G at position 37, from 5' to 3'; anticodon in bold; modifications in bold and highlighted:

[0307]

[0308] SEQ ID NO:5 = Nucleotide (RNA) sequence of engineered suppressor tRNA R3-147-M5 (i.e., M5) based on modifications of engineered suppressor tRNA R3-147, with U replaced by C at position 40 and a CCA tail added to the 3' end, from 5' to 3'; anticodon in bold; modifications in bold and highlighted:

[0309]

[0310] SEQ ID NO:6 = Nucleotide (RNA) sequence of engineered suppressor tRNA R3-147-M6 (i.e., M6) based on modifications of engineered suppressor tRNA R3-147, with U replaced by C at position 40 and A replaced by G at position 37, from 5' to 3'; anticodon in bold; modifications in bold and highlighted:

[0311]

[0312] SEQ ID NO:7 = Nucleotide (RNA) sequence of engineered suppressor tRNA R3-147-M7 (i.e., M7) based on modifications of engineered suppressor tRNA R3-147, with A replaced by G at position 37 and a CCA tail added to the 3' end, from 5' to 3'; anticodon in bold; modifications in bold and highlighted:

[0313]

[0314] SEQ ID NO:8 = Nucleotide (RNA) sequence of engineered suppressor tRNA R3-147-M8 (i.e., M8) modified based on engineered suppressor tRNA R3-147, with replacement of U with C at position 40 and A with G at position 37, and addition of CCA tail at 3' end, from 5' to 3'; anticodon in bold; modifications in bold and highlighted:

[0315]

[0316] SEQ ID NO:9 = Nucleotide (RNA) sequence of engineered inhibitory tRNA R3-1 derived from human tRNA-Arg-ACG-1-1, from 5' to 3'; anticodon is in bold:

[0317]

[0318] SEQ ID NO: 10 = Nucleotide (RNA) sequence of engineered inhibitory tRNA R3-2 derived from human tRNA-Arg-ACG-2-1, from 5' to 3'; anticodon is in bold:

[0319]

[0320] SEQ ID NO: 11 = Nucleotide (RNA) sequence of engineered inhibitory tRNA R3-3 derived from human tRNA-Arg-CCG-1-1, from 5' to 3'; anticodon is in bold:

[0321]

[0322] SEQ ID NO: 12 = Nucleotide (RNA) sequence of engineered inhibitory tRNA R3-4 derived from human tRNA-Arg-CCG-2-1, from 5' to 3'; anticodon is in bold:

[0323]

[0324] SEQ ID NO: 13 = Nucleotide (RNA) sequence of engineered inhibitory tRNA R3-5 derived from human tRNA-Arg-CCT-1-1, from 5' to 3'; anticodon is in bold:

[0325]

[0326] SEQ ID NO: 14 = Nucleotide (RNA) sequence of engineered inhibitory tRNA R3-6 derived from human tRNA-Arg-CCT-2-1, from 5' to 3'; anticodon is in bold:

[0327]

[0328] SEQ ID NO: 15 = Nucleotide (RNA) sequence of engineered inhibitory tRNA R3-7 derived from human tRNA-Arg-CCT-3-1, from 5' to 3'; anticodon is in bold:

[0329]

[0330] SEQ ID NO: 16 = Nucleotide (RNA) sequence of engineered inhibitory tRNA R3-8 derived from human tRNA-Arg-CCT-4-1, from 5' to 3'; anticodon is in bold:

[0331]

[0332] SEQ ID NO: 17 = Nucleotide (RNA) sequence of engineered inhibitory tRNA R3-9 derived from human tRNA-Arg-CCT-5-1, from 5' to 3'; anticodon is in bold:

[0333]

[0334] SEQ ID NO: 18 = Nucleotide (RNA) sequence of engineered inhibitory tRNA R3-10 derived from human tRNA-Arg-TCG-1-1, from 5' to 3'; anticodon is in bold:

[0335]

[0336] SEQ ID NO: 19 = Nucleotide (RNA) sequence of engineered inhibitory tRNA R3-11 derived from human tRNA-Arg-TCG-2-1, from 5' to 3'; anticodon is in bold:

[0337]

[0338] SEQ ID NO:20 = Nucleotide (RNA) sequence of engineered inhibitory tRNA R3-12 derived from human tRNA-Arg-TCG-3-1, from 5' to 3'; anticodon is in bold:

[0339]

[0340] SEQ ID NO:21 = Nucleotide (RNA) sequence of engineered inhibitory tRNA R3-13 derived from human tRNA-Arg-TCG-4-1, from 5' to 3'; anticodon is in bold:

[0341]

[0342] SEQ ID NO:22 = Nucleotide (RNA) sequence of engineered inhibitory tRNA R3-14 derived from human tRNA-Arg-TCG-5-1, from 5' to 3'; anticodon is in bold:

[0343]

[0344] SEQ ID NO:23 = Nucleotide (RNA) sequence of engineered inhibitory tRNA R3-15 derived from human tRNA-Arg-TCG-6-1, from 5' to 3'; anticodon is in bold:

[0345]

[0346] SEQ ID NO:24 = Nucleotide (RNA) sequence of engineered inhibitory tRNA R3-148 derived from human intron-spliced ​​tRNA-Arg-TCT-2-1, from 5' to 3'; anticodon is in bold:

[0347] SEQ ID NO:25 = Nucleotide (RNA) sequence of engineered inhibitory tRNA R3-149 derived from human intron-spliced ​​tRNA-Arg-TCT-3-1, from 5' to 3'; anticodon is in bold: SEQ ID NO:26 = Nucleotide (RNA) sequence of engineered inhibitory tRNA R3-150 derived from human tRNA-Arg-TCT-4-1, from 5' to 3'; anticodon is in bold:

[0348]

[0349] SEQ ID NO:27 = Nucleotide (RNA) sequence of engineered inhibitory tRNA R3-151 derived from human intron-spliced ​​tRNA-Arg-TCT-5-1, from 5' to 3'; anticodon is in bold:

[0350] SEQ ID NO: 154 = Nucleotide (RNA) sequence of engineered suppressor tRNA R3-147-M54 (i.e., M54) based on modifications of engineered suppressor tRNA R3-147, substitution of U with C at position 40 and nucleotide substitutions at other positions, from 5' to 3'; anticodon in bold; modification at position 40 in bold and highlighted:

[0351]

[0352] SEQ ID NOs:28-47 are natural endogenous human tRNAs with introns removed, and are presented in the same order as the engineered suppressor tRNAs from which they are derived, listed in SEQ ID NOs:9-27 (but with the exception of R3-147).

[0353] SEQ ID NO:28 = Nucleotide (RNA) sequence of human tRNA-Arg-ACG-1-1, from 5' to 3'; anticodon is in bold:

[0354]

[0355] SEQ ID NO:29 = Nucleotide (RNA) sequence of human tRNA-Arg-ACG-2-1, from 5' to 3'; anticodon is in bold:

[0356]

[0357] SEQ ID NO:30 = Nucleotide (RNA) sequence of human tRNA-Arg-CCG-1-1, from 5' to 3'; anticodon is in bold:

[0358]

[0359] SEQ ID NO:31 = Nucleotide (RNA) sequence of human tRNA-Arg-CCG-2-1, from 5' to 3'; anticodon is in bold:

[0360]

[0361] SEQ ID NO:32 = Nucleotide (RNA) sequence of human tRNA-Arg-CCT-1-1, from 5' to 3'; anticodon is in bold:

[0362]

[0363] SEQ ID NO:33 = Nucleotide (RNA) sequence of human tRNA-Arg-CCT-2-1, from 5' to 3'; anticodon is in bold:

[0364]

[0365] SEQ ID NO:34 = Nucleotide (RNA) sequence of human tRNA-Arg-CCT-3-1, from 5' to 3'; anticodon is in bold:

[0366]

[0367] SEQ ID NO:35 = Nucleotide (RNA) sequence of human tRNA-Arg-CCT-4-1, from 5' to 3'; anticodon is in bold:

[0368]

[0369] SEQ ID NO:36 = Nucleotide (RNA) sequence of human tRNA-Arg-CCT-5-1, from 5' to 3'; anticodon is in bold:

[0370]

[0371] SEQ ID NO:37 = Nucleotide (RNA) sequence of human tRNA-Arg-TCG-1-1, from 5' to 3'; anticodon is in bold:

[0372]

[0373] SEQ ID NO:38 = Nucleotide (RNA) sequence of human tRNA-Arg-TCG-2-1, from 5' to 3'; anticodon is in bold:

[0374]

[0375] SEQ ID NO:39 = Nucleotide (RNA) sequence of human tRNA-Arg-TCG-3-1, from 5' to 3'; anticodon is in bold:

[0376]

[0377] SEQ ID NO:40 = Nucleotide (RNA) sequence of human tRNA-Arg-TCG-4-1, from 5' to 3'; anticodon is in bold:

[0378]

[0379] SEQ ID NO:41 = Nucleotide (RNA) sequence of human tRNA-Arg-TCG-5-1, from 5' to 3'; anticodon is in bold:

[0380]

[0381] SEQ ID NO:42 = Nucleotide (RNA) sequence of human tRNA-Arg-TCG-6-1, from 5' to 3'; anticodon is in bold:

[0382]

[0383] SEQ ID NO:43 = Nucleotide (RNA) sequence of human tRNA-Arg-TCT-1-1, from 5' to 3'; anticodon is in bold:

[0384]

[0385] SEQ ID NO:44 = Nucleotide (RNA) sequence of human tRNA-Arg-TCT-2-1, from 5' to 3'; anticodon is in bold:

[0386]

[0387] SEQ ID NO:45 = Nucleotide (RNA) sequence of human tRNA-Arg-TCT-3-1, from 5' to 3'; anticodon is in bold:

[0388]

[0389] SEQ ID NO:46 = Nucleotide (RNA) sequence of human tRNA-Arg-TCT-4-1, from 5' to 3'; anticodon is in bold:

[0390]

[0391] SEQ ID NO:47 = Nucleotide (RNA) sequence of human tRNA-Arg-TCT-5-1, from 5' to 3'; anticodon is in bold:

[0392]

[0393] Other related plasmid or viral vector sequences, as well as modified NanoLuc nucleotide and protein sequences

[0394] SEQ ID NO:48 = Nucleotide (DNA) sequence of the parent plasmid pSpCas9(BB)-2A-GFP (PX458) used to construct an engineered inhibitory tRNA expression vector:

[0395]

[0396]

[0397] SEQ ID NO:49 = Nucleotide (DNA) sequence of plasmid ptRNA-GFP constructed for expression of engineered inhibitory tRNA; the insertion position of the engineered inhibitory tRNA is highlighted by a dotted line and gray:

[0398]

[0399]

[0400] SEQ ID NO:50 = Nucleotide (DNA) sequence of plasmid ptRNA-GFP-R3-147 constructed for expression of engineered inhibitory tRNA R3-147; engineered inhibitory tRNA R3-147 is in bold and highlighted:

[0401]

[0402] SEQ ID NO:51 = Nucleotide (RNA) sequence of the scrambled sequence Scr1-4 derived from inhibitory tRNA R3-147, from 5' to 3':

[0403]

[0404] SEQ ID NO:52 = Nucleotide (DNA) sequence of modified NanoLuc Luc_V2_R3 with premature TGA stop codon after 195 bp of NanoLuc gene; premature TGA stop codon is bold and highlighted; fusion tag is bold:

[0405]

[0406] SEQ ID NO:53 = Nucleotide (DNA) sequence of modified NanoLuc Luc_V3_R3 with premature TGA stop codon after 474 bp of NanoLuc gene; premature TGA stop codon is bold and highlighted; fusion tag is bold:

[0407]

[0408]

[0409] SEQ ID NO:54 = Nucleotide (DNA) sequence of modified NanoLuc Luc_V2_R4 with glycine encoding codon GGA after 195 bp of NanoLuc gene; glycine encoding codon GGA is bold and highlighted; fusion tag is bold:

[0410]

[0411] SEQ ID NO:55 = Nucleotide (DNA) sequence of a modified NanoLuc Luc_V3_R4 with a glycine encoding codon GGA after 474 bp of the NanoLuc gene; the glycine encoding codon GGA is bold and highlighted; the fusion tag is bold:

[0412]

[0413] SEQ ID NO:56 = Amino acid sequence of the full-length modified NanoLuc protein produced in the Luc_V2_R3 cell line after read-through by the engineered inhibitory tRNA. During the read-through process, a specific amino acid was inserted after the 65th amino acid in this sequence. The amino acid site carried and inserted by the engineered inhibitory tRNA is marked with a dotted line and supplemented with gray highlighting:

[0414] SEQ ID NO:57 = Exemplary amino acid sequence of full-length modified NanoLuc protein produced in the Luc_V2_R3 cell line after read-through of the engineered inhibitory tRNA. During the read-through process, an arginine was inserted after the 65th amino acid in this sequence. The inserted arginine is shown in bold and highlighted:

[0415]

[0416] SEQ ID NO:58 = Nucleotide (RNA) sequence of a lentiviral LV for delivery of an engineered inhibitory tRNA expressed under the U6 promoter, wherein the insertion site of the engineered inhibitory tRNA sequence (in reverse complement form) is indicated by a dashed line and highlighted in grey shading:

[0417]

[0418]

[0419] SEQ ID NO:59 = Nucleotide (DNA) sequence of a single-stranded adeno-associated viral vector (ssAAV-2xU6) for delivering two copies of an engineered inhibitory tRNA expressed under the U6 promoter, wherein the insertion site of the engineered inhibitory tRNA sequence (in DNA form) is indicated by a dashed line and highlighted in grey shading:

[0420]

[0421] SEQ ID NO:60 = Nucleotide (DNA) sequence of a self-complementary adeno-associated viral vector (scAAV-1xU6) for delivering a single copy of an engineered inhibitory tRNA expressed under the U6 promoter, wherein the insertion site of the engineered inhibitory tRNA sequence (in DNA form) is indicated by a dashed line and highlighted in gray shading:

[0422]

[0423] SEQ ID NO:61 = qPCR forward primer for detecting p53 mRNA levels, its nucleotide (DNA) sequence from 5' to 3': CAGTCACAGCACATGACGGA

[0424] SEQ ID NO:62 = qPCR reverse primer for detecting p53 mRNA levels, its nucleotide (DNA) sequence from 5' to 3': CGCCCATGCAGGAACTGTTA

[0425] SEQ ID NO:63 = qPCR forward primer for detecting GAPDH mRNA levels, nucleotide (DNA) sequence from 5' to 3': AGAAGGCTGGGGCTCATTTG

[0426] SEQ ID NO:64 = qPCR reverse primer for detecting GAPDH mRNA levels, nucleotide (DNA) sequence from 5' to 3': AGGGGCCATCCACAGTCTTC.

Claims

1. An engineered inhibitory transfer RNA (tRNA) for carrying arginine, whose nucleotide sequence is shown in SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8 or SEQ ID NO:

154.

2. A nucleic acid encoding the engineered inhibitory tRNA of claim 1.

3. A vector comprising the nucleic acid according to claim 2.

4. The vector according to claim 3, wherein the vector is a viral vector or a plasmid.

5. The vector according to claim 4, wherein the viral vector is an adeno-associated virus (AAV) vector or a lentiviral vector.

6. The vector according to claim 5, wherein the adeno-associated virus vector is an AAV 2 / 9 vector.

7. A composition comprising the engineered inhibitory tRNA of claim 1, the nucleic acid of claim 2, or the vector of any one of claims 3-6.

8. The composition according to claim 7, wherein the composition is a pharmaceutical composition and further comprises a pharmaceutically acceptable carrier.

9. The composition according to claim 8, wherein the pharmaceutically acceptable carrier is a liposome or a lipid nanoparticle.

10. A method for restoring translation of a target coding nucleic acid containing a premature UGA / TGA stop codon in a cell, comprising introducing into the cell the engineered inhibitory tRNA described in claim 1, the nucleic acid described in claim 2, or the vector described in any one of claims 3-6, wherein the introduced engineered inhibitory tRNA or the engineered inhibitory tRNA produced by the nucleic acid or the vector recognizes and reads the premature UGA / TGA stop codon, thereby restoring translation of the target coding nucleic acid containing the premature UGA / TGA stop codon.

Images