Sorghum anthracnose susceptible gene SbABCA7, recombinant plasmid and application thereof

By cloning the sorghum anthracnose susceptibility gene SbABCA7 and constructing a recombinant plasmid, the identification and functional analysis of the sorghum anthracnose susceptibility gene were achieved, solving the problem of sorghum anthracnose control, providing an efficient breeding method, and improving the disease resistance and yield of sorghum.

CN119464313BActive Publication Date: 2025-11-25GUIZHOU UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411679185.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-11-22
Publication Date
2025-11-25
Estimated Expiration
2044-11-22

AI Technical Summary

Technical Problem

The lack of research on the susceptibility genes for sorghum anthracnose in existing technologies makes the prevention and control of sorghum anthracnose difficult, and there is a lack of effective molecular markers for rapid screening of anthracnose-resistant resources.

Method used

The sorghum anthracnose susceptibility gene SbABCA7 was cloned and a recombinant plasmid was constructed. The plasmid was then introduced into sorghum plants using genetic transformation technology. The gene was significantly overexpressed to identify the susceptibility gene and perform functional analysis.

Benefits of technology

This study provides molecular markers for rapid screening of sorghum resources resistant to anthracnose. Through gene editing technology, susceptible genes may be converted into resistant genes, promoting anthracnose-resistant sorghum breeding and improving sorghum's disease resistance and yield.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119464313B_ABST
    Figure CN119464313B_ABST
Patent Text Reader

Abstract

The application discloses a sorghum anthracnose susceptible gene SbABCA7, a recombinant plasmid and application thereof. The sorghum anthracnose susceptible gene SbABCA7 is a susceptible gene of sorghum, the nucleotide sequence of the susceptible gene SbABCA7 is SEQ ID NO. 01, and the amino acid sequence of the SbABCA7 protein gene is SEQ ID NO. 02. The susceptible gene SbABCA7 of the sorghum anthracnose can be used to obtain positive sorghum plants through amplification, recovery and recombination of the plasmid and homologous genetic transformation; the primer designed according to the susceptible gene SbABCA7 can be directly used as a molecular marker to quickly screen and identify sorghum anthracnose-resistant resources at the seedling stage; the sorghum susceptible gene can be mutated into a disease-resistant gene through a gene site, and the SbABCA7 sorghum susceptible gene can be changed into a disease-resistant gene through a gene editing technology; and the application can provide a convenient method for quickly screening materials, creating new materials and improving sorghum anthracnose-resistant varieties in sorghum anthracnose-resistant breeding research.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and relates to a sorghum anthracnose susceptibility gene SbABCA7, a recombinant plasmid, and their applications. Background Technology

[0002] Sorghum is the fifth most widely cultivated cereal crop globally, used as food, animal feed, and industrial raw material. Anthracnose is one of the most serious diseases affecting sorghum-growing regions worldwide. It can occur at any stage of sorghum's growth, causing yield reductions and even total crop failure. Studying the genetic mechanisms of anthracnose resistance in sorghum and conducting breeding improvements are the most effective ways to increase sorghum yield, reduce costs, improve efficiency, and prevent anthracnose.

[0003] Gene cloning technology provides a powerful tool for studying biological genetics and molecular biology mechanisms. Cloning genes for crop-related traits can be used to improve crop varieties, increase crop yield, and enhance stress resistance. Gene function analysis is an important method for studying gene function in organisms. It can reveal the specific functions of genes and provide crucial information for understanding fundamental life processes such as growth, development, and physiological metabolism. Bioinformatics tools can be used to analyze gene sequences, protein functions, and phylogenetic patterns, thereby uncovering new information and laws.

[0004] Disease-susceptibility genes can be directly used as molecular markers for screening and identifying sorghum resources. There are also numerous reports of gene mutations leading to resistance genes, such as Chen et al.'s discovery of a naturally occurring BSR-D1 rice blast susceptibility gene mutation in rice that transformed into the resistance gene SNP33-G. Eukaryotic translation initiation factor 4E (EIF4E) is a susceptibility factor for many plant species to viral infections. Hoffiee et al. targeted mutagenesis of the EIF4E gene using the Cas9 endonuclease in BaMMV / BaYMV-susceptible winter barley varieties, resulting in a shift in the reading frame and loss of EIF4E function, thus enhancing Bymovirus resistance in winter barley. Overexpression of the ribosomal silencing factor (RsfS) homolog TaRsfS in wheat reduces resistance to powdery mildew and stripe rust, while TaRsfS knockout (TaRsfS-KO) increases resistance to these two diseases without affecting key agronomic traits. The wheat GRAINWIDTH2 (TaGW2) homolog negatively regulates grain weight and mediates TaSGT1 ubiquitination to negatively regulate wheat leaf rust resistance. CRISPR / Cas9 editing of TaGW2 achieved a simultaneous increase in both grain weight and leaf rust resistance. This study also revealed that the sorghum anthracnose susceptibility gene SbABCA7 may be transformed into a resistance gene through gene editing and other technologies, offering potential applications for sorghum disease resistance breeding research. Further research will continue to explore its functions.

[0005] There are numerous reports on heterologous cloning of sorghum genes. For example, the nitrogen deficiency-specific inducible gene SbMYB-like in sorghum was cloned, an overexpression vector was constructed, and it was transformed into Arabidopsis thaliana to obtain overexpression lines, verifying that this gene plays an important role in promoting root elongation and flowering. The deep-root gene SbDRO1 in sorghum was cloned, and overexpression of SbDRO1 in Arabidopsis thaliana significantly improved the survival rate of Arabidopsis thaliana under drought conditions, and the root system of transgenic Arabidopsis thaliana was significantly more developed than that of wild type. The sorghum shattering gene Sh-B140 was cloned and transformed into the Sudan grass variety Hiro-1. Field phenotype observation of the T1 generation transgenic plants showed that although the shattering intensity of T1 plants was higher than that of Hiro-1, it was significantly lower than that of the parental B140. However, there are few reports on homologous cloning in sorghum, and no homologous clones and functional analyses of genes related to sorghum anthracnose have been found. This invention identifies the sorghum anthracnose susceptibility gene SbABCA7 using a combination of genome-wide association analysis (GWAS) and transcriptome analysis. Homologous cloning and vector construction were then performed to obtain genetically transformed sorghum plants with SbABCA7. Bioinformatics analysis of this gene was conducted to lay the foundation for research on the biological function of this sorghum anthracnose resistance-related gene.

[0006] Susceptibility genes in plants are key genes in the development of diseases. Upon direct contact with effector proteins of pathogenic bacteria, they are overexpressed, subsequently activating the entire susceptibility pathway and ultimately leading to disease. Previous studies in reports of anthracnose infection in sorghum had not identified any susceptibility genes. Obtaining sorghum anthracnose susceptibility genes would allow for a systematic analysis of the molecular response mechanisms of anthracnose occurrence, as well as the identification of anthracnose in sorghum. Furthermore, cloning and transforming these genes could elucidate the genetic mechanisms of anthracnose resistance in sorghum, laying the foundation for research on anthracnose resistance genes and genetic improvement of anthracnose resistance in sorghum. Summary of the Invention

[0007] The purpose of this invention is to provide a sorghum anthracnose susceptibility gene SbABCA7, a recombinant plasmid, and their applications. This invention obtains a recombinant plasmid by transforming the sorghum anthracnose susceptibility gene SbABCA7 into a recombinant plasmid. This recombinant plasmid can be applied to sorghum plants to identify their resistance to anthracnose.

[0008] The technical solution of the present invention: a sorghum anthracnose susceptibility gene SbABCA7, wherein the nucleotide sequence of the susceptibility gene SbABCA7 is SEQ ID NO. 01, and the susceptibility gene SbABCA7 is a gene encoding a protein composed of the amino acid sequence shown in SEQ ID NO: 2.

[0009] A recombinant plasmid comprising the SbABCA7 gene sequence of claim 1.

[0010] The aforementioned method for constructing recombinant plasmids is performed according to the following steps:

[0011] (1) After PCR amplification of the disease-susceptibility gene SbABCA7, the 2874bp electrophoretic fragment was cut out and recovered. The target fragment was recovered using the agarose gel DNA recovery kit DP209-03 from Tiangen Biotech Co., Ltd.

[0012] (2) Perform an enzyme digestion-ligation reaction on the target fragment to obtain the ligation product;

[0013] (3) The ligation product was mixed with competent Escherichia coli cells, cultured in LLB liquid medium to restore the cells to normal growth state, and then the recombinant plasmid was transformed into plasmid colonies on LB solid medium plates.

[0014] (4) Use primers JJ-F and NOS-R to amplify the plasmid colonies obtained in step (3) by PCR and perform PCR detection; pick out the positive colonies, separate and purify them, and then extract the plasmid.

[0015] In step (1) above, the PCR amplification reaction system consists of 25 μL of 2xPCR buffer, 10 μL of 2mMdNTPs, 1 μL of primer F, 1 μL of primer R, 1 μL of KOD-FX, and 1 μL of BTx623 sorghum DNA template, plus ddH2O to prepare a 50 μL PCR amplification reaction system; the PCR amplification reaction conditions are: first, 98℃ for 3 min pre-denaturation, then 98℃ for 10 sec to 68℃ for 3 min, for 32 cycles, and finally 68℃ for 6 min; the nucleotide sequence of primer F is SEQ ID NO. 03, and the nucleotide sequence of primer R is SEQ ID NO. 04.

[0016] In step (2) above, the enzyme digestion-ligation reaction system is: 1.5 μL of 10×CutSmartBuffer, 1.5 μL of 10 mM ATP, 100 ng of empty vector plasmid, 100 ng of target fragment, 10 U of BsaI-HF and 35 U of 4 DNA ligase, and H2O is added to prepare 15 μL; the enzyme digestion-ligation reaction parameters are 37℃ for 5 min first, and then 20℃ for 5 min.

[0017] In step (4) above, the colony PCR amplification system is as follows: 10 μL of 2XTaqMIX, 0.5 μL of JJ-F primer and 0.5 μL of NOS-R primer are taken, colonies are picked and added, and ddH2O is added to 20 μL. The colony PCR amplification reaction parameters are: 95℃ for 5 min pre-denaturation, 95℃ for 530 sec denaturation, 55℃ for 30 sec annealing, 72℃ for 1 min extension, and 72℃ for 2 min final extension. The nucleotide sequence of primer JJ-F is SEQ ID NO. 05, and the nucleotide sequence of primer NOS-R is SEQ ID NO. 06.

[0018] The aforementioned sorghum anthracnose susceptibility gene SbABCA7 and the aforementioned recombinant plasmids were used in homologous genetic transformation of sorghum.

[0019] The aforementioned application is characterized in that: after treatment with sorghum anthracnose spore solution, the sorghum positive plants genetically transformed with the sorghum anthracnose susceptibility gene SbABCA7 showed significant overexpression of the gene, and the lesions on the sorghum positive plants were significantly more numerous than those on wild control sorghum plants; indicating that the sorghum anthracnose susceptibility gene SbABCA7 is indeed a sorghum anthracnose susceptibility gene.

[0020] In the aforementioned application, after treating anthracnose-resistant and anthracnose-susceptible sorghum with anthracnose spore solution, the sorghum anthracnose susceptibility gene SbABCA7 was significantly overexpressed in the susceptible sorghum, which can be used for rapid identification of anthracnose-susceptible sorghum resources.

[0021] The nucleotide sequences of the specific primers for detecting the overexpression of the sorghum anthracnose susceptibility gene SbABCA7 are SEQ ID NO. 07 and SEQ ID NO. 08.

[0022] Compared with the prior art, the present invention has the following beneficial effects:

[0023] 1. This invention discloses a sorghum anthracnose susceptibility gene SbABCA7, a recombinant plasmid, and their applications. SbABCA7 is a susceptibility gene for sorghum anthracnose. Primers designed based on this susceptibility gene can be directly used as molecular markers to rapidly screen and identify sorghum anthracnose-resistant resources at the seedling stage, providing a convenient method for rapid screening of materials and improvement of sorghum anthracnose-resistant varieties in sorghum anthracnose-resistant breeding research.

[0024] 2. There are currently no reports of sorghum anthracnose susceptibility genes. Sorghum susceptibility genes can be transformed into resistance genes through gene locus mutation. The SbABCA7 sorghum susceptibility gene in this invention may be transformed into a resistance gene through gene editing and other technologies. It has certain potential applications for sorghum disease resistance breeding research and can provide theoretical methods and new strategies for the creation of sorghum germplasm resistant to anthracnose. The next step will be to continue to explore its functions.

[0025] 3. The susceptibility gene SbABCA7 for sorghum anthracnose was discovered for the first time. It was constructed into a recombinant plasmid and genetically transformed into sorghum plants. Further functional analysis of the susceptibility gene SbABCA7 can be performed, which has profound significance for academic research on sorghum anthracnose and the improvement of anthracnose-resistant sorghum varieties. Attached Figure Description

[0026] Figure 1 SbABCA7 gene structure diagram (white box - UTR, red box - exons, lines - introns);

[0027] Figure 2 : Plasmid vector map of the SbABCA7 gene;

[0028] Figure 3 T0 generation overexpression transformation seedlings of SSbABCA7 and positive identification (A: T0 seedlings of SbABCA7, B: Electrophoresis diagram of positive overexpression strains of SbABCA7).

[0029] Figure 4 : Expression level of SbABCA7 gene in positive sorghum;

[0030] Figure 5 Images of wild-type (CK) and transformed SbABCA7 sorghum leaves on day 5 after anthracnose treatment (A: image of CK, B: image of SbABCA7);

[0031] Figure 6 Specific expression of the SbABCA7 gene in disease-resistant and disease-susceptible sorghum. Detailed Implementation

[0032] The present invention will be further described below with reference to the accompanying drawings and embodiments, but this should not be construed as limiting the present invention.

[0033] Example 1: Gene Mapping

[0034] First, seedlings of both anthracnose-resistant and anthracnose-susceptible sorghum were treated with a spore solution of 1.5 x 10⁵ spores / ml of *Colletotrichum sublineolum*, which had been isolated and identified by the Department of Plant Pathology, Guizhou University. Transcriptome analysis was then performed on aboveground seedlings at 0 h, 12 h, 24 h, 36 h, and 48 h. Next, broad-target metabolome analysis was performed on aboveground seedlings at 0 h, 24 h, 36 h, and 48 h. Combined analysis of the transcriptome and metabolome revealed KEGG pathway enrichment (p < 0.05). A total of 18 pathways were identified in the metabolome, including variety-specific pathways, shared pathways, and pathways induced at the same time points. In the transcriptome, 36 pathways were identified, mainly flavonoid biosynthesis, ABC transporters, and cyanoamino acid metabolism. Four pathways (starch and sucrose metabolism, flavonoid biosynthesis, ABC transporters, and cyanoamino acid metabolism) were enriched in both the transcriptome and metabolome. Further analysis of the baseline differences between sorghum varieties before anthracnose inoculation revealed that the two previously identified pathways (starch and sucrose metabolism, and flavonoid biosynthesis) were also enriched in the baseline differences between the two varieties. To determine whether the effects of these two pathways after inoculation were entirely due to varietal differences and to screen for potential resistance pathways, the number of genes induced by different varieties at different times was analyzed to determine if there was overlap. After inoculation, a large number of genes in the flavonoid biosynthesis and starch and sucrose metabolism pathways were significantly affected compared to the uninoculated pathway, especially the downregulation of many gene expression. However, due to the excessive impact of anthracnose inoculation on the starch and sucrose metabolism pathways, the difficulty of gene screening was severely limited; therefore, the study mainly focused on the flavonoid biosynthesis pathway. Analysis revealed that the flavonoid biosynthesis pathway, ABC transporter, and cyanoamino acid metabolism pathway were significantly enriched in transcriptomic and metabolomic analyses of sorghum at different infection times, different resistant materials, and in WGCNA, and previous studies have shown that these three pathways are all related to plant disease resistance.

[0035] Based on the discovered pathways of flavonoid biosynthesis, ABC transporters, and cyanoamino acid metabolism, cluster analysis was performed to analyze the correlation between all DEGs and their endogenous genes. Within the ABC transporters pathway, Sobic.007G120000 was screened as a potential disease-related pathway gene.

[0036] Furthermore, expression trend analysis was performed on the FPKM expression level and RT-qPCR relative expression level of candidate Sobic.007G120000. Twelve disease resistance-related genes were screened, showing consistent expression trends in resistant and susceptible sorghum, but with significant expression differences between the two groups. Comparison revealed that the maximum FPKM value and RT-qPCR relative expression level of Sobic.007G120000 in susceptible sorghum were 8.61 times and 11 times higher than in resistant sorghum, respectively. Therefore, Sobic.007G120000 was selected as a candidate gene for anthracnose resistance in sorghum for genetic transformation analysis.

[0037] SBP15 sequences of other species were downloaded from the NCBI database (https: / / ngdc.cncb.ac.cn / sorgsd / browse) using BlastP. After aligning the sequences using the muscle method with MEGA 7.0 software, a rootless phylogenetic tree was constructed using neighbor-joining (NJ) (bootstrap = 1000). Analysis using homology alignment and the neighbor-joining tree showed that the Sobic.007G120000 protein had the highest homology with MfABCA7 (ATP-binding cassette A7) (Per.Ident = 95.93%, E-value = 0). Therefore, the Sobic.007G120000 gene can be considered as the SbABCA7 gene. The nucleotide sequence of the SbABCA7 gene is SEQ ID NO. 01, and the amino acid sequence of the SbABCA7 protein gene is SEQ ID NO. 02.

[0038] The SbABCA7 gene was retrieved and screened using the SorGSD genome browser (https: / / ngdc.cncb.ac.cn / sorgsd / browse) and its gene characteristics were analyzed. The results showed that the SbABCA7 gene possesses a complete gene structure and multiple introns, containing 1154 SNPs and 124 Indel mutations. No high-consequence SNPs were found; the coding region contained 17 medium-consequence SNPs (missense variants) and 23 low-consequence SNPs (synonymous variants and protein alteration variants); among the modification types, upstream and downstream genes had the most mutations, followed by 3'UTR and intron mutations, with the fewest in the 5'UTR region, but no coding region mutations. For Indel mutations, only modification types were present, with upstream and downstream genes having the most mutations, followed by intron mutations and a few in the 3'UTR region, but no 5'UTR or coding region mutations (Table 1). Figure 1 ).

[0039] Table 1. Statistics on the variation of SbABCA7 coding.

[0040]

[0041]

[0042] Example 2: Construction of a vector for the disease susceptibility gene

[0043] 1. Vector primer design, as shown in Table 2.

[0044] Table 2 Primer sequences for constructing the vector

[0045]

[0046] 2. Amplification and recovery of the target fragment

[0047] During fragment recovery, 2874 bp electrophoretic fragments were excised from the Sobic.007G120000 and SbABCA7 genes, respectively, and the target fragments were recovered using the agarose gel DNA recovery kit (DP209-03) from Tiangen Biotech Co., Ltd.; the operation was performed according to the kit instructions.

[0048] The PCR reaction system was as follows: 25 μL of 2xPCR buffer, 10 μL of 2mMdNTPs, 1 μL of F, 1 μL of R, 1 μL of KOD-FX, 1 μL of BTx623 sorghum DNA template, and ddH2O was added to 50 μL to obtain the PCR reaction.

[0049] PCR reaction conditions:

[0050]

[0051] 3. Enzyme digestion-ligation reaction

[0052] Follow the enzyme digestion reaction system in Table 3, and then set the reaction parameters according to Table 4 for the enzyme digestion-ligation reaction.

[0053] Table 3 Enzyme digestion reaction system

[0054]

[0055] Table 4 Enzyme digestion-ligation reaction parameters

[0056]

[0057] 4. Transformation of recombinant plasmids

[0058] (1) Take a tube of 100 μL LDH5a competent E. coli cells and mix with 2-5 μL of ligation product, and incubate on ice for 30 min;

[0059] (2) Quickly place it in a 42℃ constant temperature water bath, heat shock for 90s, then ice bath for 2min;

[0060] (3) Add 500 μL LLB liquid culture medium and mix well;

[0061] (4) Incubate at 37℃ and 200rpm for 45min to allow the cells to return to normal growth.

[0062] (5) Spread the bacterial culture evenly on Kana-resistant LB solid medium plates;

[0063] (6) After 30 minutes, place in a 37°C constant temperature incubator and incubate overnight.

[0064] 5. Bacterial test

[0065] Colony PCR was performed using the JJ-F / NOS-R primer pair according to the following colony PCR amplification system and the parameters in Table 4; positive colonies were picked and shaken.

[0066] Colony PCR amplification system: 10 μL 2XTaqMIX, 0.5 μL JJ-F primers, 0.5 μL NOS-R primers, pick a small number of colonies, add ddH2O to 20 μL to obtain the final product.

[0067] Table 5 Colony PCR reaction parameters

[0068]

[0069]

[0070] 6. Plasmid Extraction

[0071] (1) Pick single clones from LB solid medium plates and inoculate them into LB liquid medium with a final concentration of 50 μg / mL for kanamycin resistance, and incubate overnight at 37°C;

[0072] (2) Take 4 mL of activated bacterial solution, centrifuge at 10,000 rpm for 2 min at room temperature, and completely discard the supernatant;

[0073] (3) Take 250 μL of Solution I reagent containing ribonuclease A and thoroughly resuspend the bacterial block;

[0074] (4) Take 250 μL of Solution II reagent to lyse the bacterial block, and gently invert it several times until the bacterial cells are transparent;

[0075] (5) Take 350 μL of Solution III reagent, invert it several times until a white, firm flocculent substance is formed;

[0076] (6) Centrifuge at 12,000 rpm for 10 min at room temperature and collect the supernatant;

[0077] (7) Remove the nucleic acid purification column from the kit and place it on the collection tube;

[0078] (8) Take the clear supernatant from step 6 above into a nucleic acid purification column, centrifuge at 12,000 rpm for 1 min at room temperature, and discard the filtrate;

[0079] (9) Add 500 μL of BufferW1 to the nucleic acid purification column, centrifuge at 12000 rpm for 30 s at room temperature, and discard the filtrate;

[0080] (10) Add 700 μL of BufferW2 to the nucleic acid purification column, centrifuge at 12000 rpm for 30 s at room temperature, and discard the filtrate; (11) Repeat the above operation step 10;

[0081] (12) Place the nucleic acid purification column on the collection tube and centrifuge at 12,000 rpm for 2 min at room temperature to remove as much residual liquid as possible;

[0082] (13) Discard the collection tube, take the nucleic acid purification column and place it in a 1.5 mL EP tube, and add 50 μL of elution buffer to elute the DNA attached to the nucleic acid purification column membrane (the elution buffer can be preheated in a 65℃ constant temperature water bath to help elute the DNA), and let it stand at room temperature for 2 min.

[0083] (14) Centrifuge at 12,000 rpm for 2 min at room temperature to wash off the DNA attached to the nucleic acid purification column membrane, and store at -40℃ for later use.

[0084] (15) Take a small amount of the recovered product and use 1% agarose gel electrophoresis to detect the plasmid extraction quality.

[0085] 7) Sequencing

[0086] The plasmid extracted from the above positive bacterial plaques was subjected to Sanger sequencing using the eGFP-cx sequencing primer. If the sequencing result matched the target fragment sequence, the overexpression vector was successfully constructed. The vector map is shown below. Figure 2 .

[0087] Example 3: Genetic transformation of sorghum

[0088] Agrobacterium containing a plasmid vector was transferred into sorghum strain P8980182. Stable genetic transformation of sorghum was accomplished with the assistance of the Institute of Crop Science, Chinese Academy of Agricultural Sciences. This process included sorghum callus induction, Agrobacterium infection of callus tissue, selection of resistant callus, and culture of regenerated plants.

[0089] 1. Cultivation and gene overexpression detection of genetically transformed sorghum

[0090] T0 generation sorghum plants overexpressed and transformed were planted at the teaching and experimental farm of Guizhou University and managed using standard methods. When the T0 generation sorghum reached the jointing stage, leaves from eight plants were taken for identification as positive plants. Bright bands were observed in all eight plants, and the size of the amplified product was consistent with expectations. Figure 3 Leaves from wild-type (CK) and SbABCA7 positive plants (L1276-1, L1276-3, L1276-3) were taken from sorghum plants during the heading stage for expression testing.

[0091] The testing method was RT-qPCR, using Ambion by Life Technologies. Total RNA was extracted using Reagent (Lot. No. 338111) and reverse transcribed into cDNA using Beyotime's BeyoRT™ III CDNA Reverse Transcription Kit (Beyotime, with gDNA EZeraser, Lot. No. D7185M). SbUBQ10 was used as an internal control gene, and homologous cloning gene primers were used for qRT-PCR amplification using Biosharp's Universal SYBR Qpcr Master Mix (Lot. No. BL697A); all reagent usage methods were performed according to the manufacturer's instructions. Gene expression levels were quantified using a BIO-RAD CFX96 Real-Time cycler (c100 Touch Thermal cycler). The expression levels were determined according to the methods described by Schmittgen. -ΔΔCT The method is used to determine the relative fold change in the expression of a target gene.

[0092] Table 6 Primers for disease resistance-related genes in homologous clones.

[0093] Serial Number name sequence SEQID NO. 07 Forward primer (5'-3') TCTACCTATAACAACAACACCGCATAC SEQID NO. 08 Reverse primer (5'-3') CAACATTTCCACTCCACTTCCTCTG

[0094] Leaves of successfully transformed positive sorghum plants were selected for anthracnose resistance phenotype identification.

[0095] Example 4: Overexpression of SbABCA7 in positive strains

[0096] The results of overexpression assays for the SbABCA7 gene in three overexpression lines are as follows: Figure 4 As shown, compared with the wild-type CK, the L1276-1, L1276-3, and L1276-3 expression levels of SbABCA7 were 564.65, 714.08, and 241.05 times higher than those of the CK, respectively. This indicates that the constructed overexpression vectors acted on SbABCA7 in sorghum, ultimately leading to the effect by altering its expression levels. These materials can be further studied to investigate the impact of mutational effects on the agronomic traits and disease resistance of the materials.

[0097] Example 5: Lesion changes in sorghum overexpressed with the gene

[0098] Lesions were counted every 12 hours. At 72 hours, lesions began to appear on the veins of both positive and control SbABCA7 plants, but the number of lesions on the veins of positive plants was greater than that on the veins of control plants. At 96 hours, lesions began to appear on the leaves of both positive and control SbABCA7 plants, but the number of lesions on the leaves of positive plants was greater than that on the leaves of control plants. At 120 hours, the number of lesions on the leaves of positive SbABCA7 plants was significantly greater than that on the leaves of control plants. Figure 5 This indicates that overexpression of SbABCA7 in sorghum leads to an increase in sorghum lesions.

[0099] Example 6: Identification of anthracnose resistance in sorghum using SbABCA7

[0100] Based on the nucleotide sequence of the susceptibility gene SbABCA7 (SEQ ID NO. 01), a specific primer sequence (SEQ ID NO. 07) was designed for this gene. Then, 1.5 x 10⁻⁶ *Sorghum anthracnose* was used. 5 Seedlings of anthracnose-resistant sorghum (DR) and anthracnose-susceptible sorghum (S) were sprayed with a spore solution of spores per ml. Aboveground parts of the plants were collected at 0 h before inoculation and at 12, 24, 36, and 48 h after inoculation. RNA was extracted, and the specific expression of the SbABCA7 gene in resistant and susceptible sorghum was analyzed by real-time quantitative qPCR using SEQ ID NO. 07 as primers. Figure 6 As shown, the relative expression level of the SbABCA7 gene in susceptible sorghum was significantly higher than that in resistant sorghum from 12 to 48 hours. Based on the significant difference in the relative expression level of the SbABCA7 gene in anthracnose-resistant and anthracnose-susceptible sorghum, it is possible to identify whether sorghum is resistant or susceptible to anthracnose, and to quickly identify anthracnose-resistant sorghum resources.

[0101]

[0102]

[0103]

[0104] The amino acid sequence of the SbABCA7 protein gene

[0105] SEQ ID NO. 02:

[0106] Met Asp Ala Pro Ala Pro Thr Arg Gly Pro Ala Ser Phe Leu Thr Gln AlaAsn Ala Leu Leu Arg

[0107] Lys Asn Leu Cys Phe Gln Lys Arg Asn Leu Lys Thr Asn Ile Gly Ile ThrLeu Phe Pro Val Leu Leu

[0108] Cys Val Ile Leu Val Val Leu Gln Gly Val Ile Asp Asn Glu Leu Asp LysPro Lys Tyr Arg Cys Gly

[0109] Cys Ala Cys Val Asp Pro Gly Pro Asp Ala Val Gly Asp Ala Cys Arg ArgThr Glu Cys Gly Val

[0110] Gln His Ser Thr Leu Asp Gln Val Gly Ser Cys Pro Ile Pro Asn Pro ThrPro Trp Pro Ala Leu Val

[0111] Gln Val Pro Arg Pro Glu Ser Arg Ala Val Arg Ile Ala Gly Gln Pro PheAsp Gly Leu Pro Asp Pro

[0112] Ser Cys Arg Asp Thr Gly Ser Cys Pro Ala Ala Val Leu Val Thr Gly AsnAsn Arg Ser Leu Ala

[0113] Gln Asn Leu Ser Gly Gly Leu Phe Pro Ala Ser Thr Ser Ser Leu Asn LeuThr Asp Tyr Leu Asp

[0114] Glu Leu Ser Arg Ile Val Ala Gly Ser Asp Thr Trp Pro Trp Thr Thr GluLeu Ile Glu Ser Ala Phe

[0115] Ile Pro Gly Asn Asn Leu Tyr Arg Leu Gln Ser Arg Cys Leu Ser Asn LeuThr Gln Thr Val Ser Phe

[0116] Asn Ala Gly Val Ile Pro Leu Gln Leu Asn Ile Asp Cys Val Gln Gly LeuPro Leu Trp Arg Glu Ser

[0117] Ala Ser Phe Val Asn Asp Glu Leu Phe Lys Gly Tyr Arg Gln Asn Gly GlyGly Ser Gly Gly Gly

[0118] Lys Thr Asn Glu Phe Val Ala Gly Tyr Asp Phe Leu Asn Thr Asn Met AsnGly Leu Glu Met Asn

[0119] Ile Trp Tyr Asn Ser Thr Tyr Asn Asn Asn Thr Ala Tyr Val Ser Ile SerLeu Leu Arg Val Pro Arg

[0120] Leu Val Asn Ala Ala Ser Asn Glu Tyr Ile Lys Phe Leu Arg Gly Ser GlyVal Glu Met Leu Leu Gln

[0121] Tyr Val Lys Glu Met Pro Lys Val Gly Thr Lys Leu Lys Phe Asp Leu SerSer Leu Leu Gly Ala

[0122] Leu Phe Phe Thr Trp Ile Ile Glu Leu Leu Phe Pro Val Ile Leu Thr TyrLeu Val Tyr Glu Lys Gln

[0123] Gln Lys Leu Lys Ile Met Met Lys Met His Gly Leu Lys Asp Gly Pro TyrTrp Leu Ile Ser Tyr Phe

[0124] Tyr Phe Phe Ala Leu Ser Ala Ile Tyr Met Ile Leu Phe Val Ile Phe GlySer Leu Ile Gly Leu Asp

[0125] Phe Phe Arg Lys Asn Asp Tyr Ser Leu Gln Phe Val Phe Tyr Phe Ile TyrIle Asn Leu Gln Ile Ser

[0126] Leu Ala Phe Leu Val Ala Ser Phe Phe Ser Ala Val Lys Thr Ala Thr ValVal Gly Tyr Ile Tyr Val

[0127] Phe Gly Ser Gly Leu Leu Gly Glu Phe Leu Leu Arg Phe Phe Val Glu AspThr Gly Phe Pro Lys

[0128] Gly Trp Ile Val Val Met Glu Ile Ile Pro Gly Phe Ser Leu Phe Arg GlyLeu Tyr Glu Phe Gly Gln

[0129] Tyr Ala Ser Ala Gly Asn Ser Met Gly Thr Thr Gly Met Lys Trp Ser AsnLeu Asp Asp Ser Leu

[0130] Asn Gly Met Arg Gly Val Leu Ile Ile Met Val Val Glu Trp Ala Ile LeuLeu Pro Leu Ala Phe Tyr

[0131] Val Asp Gln Val Ser Ser Leu Gly Gly Gly Phe Arg Lys Asn Ser Phe PhePhe Leu Ser Cys Phe

[0132] Lys Arg Arg Ala Leu Ser Leu Arg Arg Tyr Ser Phe Arg Arg Gln Glu SerLys Val Val Val Glu

[0133] Met Asp Asn Pro Asp Ala Val Gln Glu Arg Glu Val Val Glu Gln Leu LeuLeu Glu Pro Ile Ala

[0134] Asn Gln Ala Ile Leu Ser Asp Asn Leu Lys Lys Val Tyr His Gly Lys AspGly Asn Pro Asp Lys

[0135] Leu Ala Val Arg Gly Leu Ser Leu Ala Ile Pro Lys Gly Gln Cys Phe GlyMet Leu Gly Pro Asn Gly

[0136] Ala Gly Lys Thr Ser Phe Ile Ser Met Met Ile Gly Leu Ile Pro Pro ThrSer Gly Thr Ala Tyr Val His

[0137] Gly Met Asp Ile Arg Thr Asp Met Asp Glu Ile Tyr Thr Asn Met Gly ValCys Pro Gln His Asp

[0138] Leu Leu Trp Glu Thr Leu Thr Gly Arg Glu His Leu Leu Phe Tyr Gly ArgLeu Lys Asn Leu Lys

[0139] Gly Thr Glu Leu Leu Lys Ala Val Asp Asp Ser Leu Lys Ser Val Asn LeuPhe His Gly Gly Val

[0140] Gly Asp Lys Gln Val Gly Lys Tyr Ser Gly Gly Met Lys Arg Arg Leu SerVal Ala Ile Ser Leu Ile

[0141] Gly Asp Pro Lys Val Val Phe Met Asp Glu Pro Ser Thr Gly Leu Asp ProAla Ser Arg Asn Asn

[0142] Leu Trp Ser Val Val Lys Glu Ala Lys Arg Asn Arg Ala Ile Ile Leu ThrThr His Ser Met Glu Glu

[0143] Ala Glu Val Leu Cys Asp Arg Leu Gly Ile Phe Val Asp Gly Gly Phe GlnCys Leu Gly Asn Pro

[0144] Lys Glu Leu Lys Ala Arg Tyr Gly Gly Thr Tyr Val Leu Thr Met Thr ThrSer Ser Glu Asn Glu

[0145] Lys Glu Val Glu Gln Leu Val His His Leu Ser Pro Asn Ala Ser Arg IleTyr His Ile Ser Gly Thr

[0146] Gln Lys Phe Glu Leu Pro Lys Gln Asp Leu Lys Ile Ala Asp Val Phe HisAla Val Glu Ser Ala Lys

[0147] Cys Arg Phe Asn Ile Tyr Ala Trp Gly Leu Val Asp Thr Thr Leu Glu AspVal Phe Ile Lys Val Ala

[0148] Lys Gly Ala Gln Ala Phe Asn Val Val Thr

Claims

1. A kind SbABCA7 The application of genes in identifying anthracnose-susceptible sorghum is characterized by: Treatment of sorghum seedlings with anthracnose spore solution resulted in the presence of anthracnose spores in the sorghum plants within 12-48 hours after treatment. SbABCA7 The expression level of the gene was significantly higher than before treatment, identifying it as anthracnose-susceptible sorghum; the susceptibility gene... SbABCA7 The nucleotide sequence is SEQ ID NO.1.