FTO gene, vector and application of FTO gene in cultivation of cordyceps militaris

Abstract

The invention discloses an FTO gene, a vector and application of the FTO gene in cultivation of cordyceps militaris, and relates to the technical field of genetic engineering. The nucleic acid molecule disclosed by the invention is as shown in SEQ ID NO.1, the nucleic acid molecule encodes alpha-ketoglutaric acid dependent dioxygenase, and the alpha-ketoglutaric acid dependent dioxygenase is introduced into cordyceps militaris bacteria, so that the germination rate of cordyceps militaris spores can be increased, the growth of mycelia can be promoted, and the yield of cordyceps militaris sporocarps can be increased through overexpression of the alpha-ketoglutaric acid dependent dioxygenase.

Description

Technical Field

[0001] The present invention relates to the technical field of Cordyceps militaris cultivation, and in particular to an FTO gene, a vector and an application thereof in cultivating Cordyceps militaris. Background Art

[0002] Cordyceps militaris is a very precious edible and medicinal fungus. Wild Cordyceps militaris is widely distributed in temperate forests in most parts of the world, especially in Asian countries including Japan, South Korea, Nepal, India and China. Cordyceps militaris has been used as a health food and traditional tonic in China and other Asian countries. The medicinal properties of Cordyceps militaris include hypoglycemic, hypolipidemic, anti-inflammatory, anti-tumor, antioxidant, antibacterial, antifungal, antiviral, antimalarial, immune activity protection and neuroprotection. The main active substances in Cordyceps militaris include cordycepin, adenosine, cordyceps polysaccharide, pentostatin, etc. Cordycepin is the main component of the active substances in Cordyceps militaris. It is a nucleoside substance and is considered to be the most economically valuable compound produced by this fungus. The main effects of cordycepin are to improve the body's immunity, protect nerves, anti-tumor, anti-cancer, anti-inflammatory, antibacterial properties and immunomodulatory effects. Currently, cordycepin is mainly extracted from the fermentation broth, mycelium and fruiting body of Cordyceps militaris to achieve its safe and sustainable production.

[0003] However, Cordyceps militaris strains frequently degenerate during their preservation and production, which greatly limits the high-quality development of the Cordyceps militaris industry. The spore germination rate, mycelium growth, and fruiting body germination efficiency of degenerated strains are far inferior to those of rejuvenated strains.

[0004] In view of this, the present invention is proposed. Summary of the invention

[0005] The object of the present invention is to provide a FTO gene, a vector and its application in cultivating Cordyceps militaris. The present application discloses for the first time that the introduction of the FTO gene (its nucleic acid sequence is shown in SEQ ID NO.1) into the Cordyceps militaris strain to overexpress it can improve the spore germination rate, mycelial growth and fruiting body yield of Cordyceps militaris.

[0006] The present invention is achieved in that:

[0007] In one aspect, the present invention provides an isolated nucleic acid molecule encoding α-ketoglutarate-dependent dioxygenase (FTO), the nucleotide sequence of which is shown in SEQ ID NO.1.

[0008] The nucleic acid molecule shown in SEQ ID NO.1 is the FTO gene, which is a well-known obesity gene in animals and has no homologous protein in plants. The present invention modifies the wild-type FTO gene to make it more suitable for expression in Cordyceps militaris, and introduces it into the Cordyceps militaris strain for overexpression for the first time. It is unexpectedly found that the exogenous introduction of the FTO gene (SEQ ID NO.1) can significantly increase the germination rate of Cordyceps militaris spores, promote mycelial growth, and facilitate fruiting body germination. The present invention provides a new idea for increasing the yield of Cordyceps militaris.

[0009] In one aspect, the present invention provides a recombinant vector comprising the nucleic acid molecule as described above.

[0010] The term "nucleic acid" used in the present invention can be any polymer containing deoxyribonucleotides or ribonucleotides, including but not limited to modified or unmodified DNA and RNA, and its length is not subject to any particular restrictions. For vectors used to construct recombinant cells, the preferred nucleic acid is DNA, because DNA is more stable and easy to handle than RNA.

[0011] Optionally, in some embodiments of the present invention, the recombinant vector is a Pxbture vector.

[0012] For those skilled in the art, they can select a suitable vector backbone to load the above-mentioned nucleic acid molecules according to actual needs. No matter which vector backbone is selected, it can be an expression vector or a cloning vector, as long as it is loaded with the nucleic acid molecules of the present invention, it falls within the protection scope of the present invention.

[0013] Optionally, in some embodiments of the present invention, the recombinant vector further contains a promoter sequence, and the promoter sequence is located upstream of the nucleic acid molecule.

[0014] Optionally, the promoter sequence is shown in SEQ ID NO.2

[0015] It should be noted that the promoter used in the present application allows expression in a variety of cell and tissue types; or it can be a non-cell-specific promoter, or it can be a "cell-specific", "cell type-specific", "cell lineage-specific" or "tissue-specific" promoter, which allows expression in restricted types of cells and tissue types, respectively.

[0016] In one aspect, the present invention provides a recombinant cell comprising the recombinant vector described above.

[0017] For those skilled in the art, they can select suitable host cells to load the above-mentioned nucleic acid molecules or vectors according to actual needs. The host cells can be prokaryotic cells (such as Escherichia coli or Agrobacterium), or eukaryotic cells or yeast, etc. No matter which host cell is selected, as long as it contains the nucleic acid molecules of the present invention or the above-mentioned recombinant vectors, it falls within the protection scope of the present invention.

[0018] Alternatively, in some embodiments of the present invention, the recombinant cell is Agrobacterium.

[0019] In one aspect, the present invention provides use of the nucleic acid molecule, the recombinant vector, or the recombinant cell as described above in cultivating Cordyceps militaris spores.

[0020] In one aspect, the present invention provides a method for increasing the spore production of Cordyceps militaris, comprising: introducing the above-mentioned nucleic acid molecule or the above-mentioned recombinant vector into a target Cordyceps militaris fungus to overexpress the nucleic acid molecule in the target Cordyceps militaris fungus.

[0021] For those skilled in the art, it is conceivable that the above nucleic acid molecules are introduced into Cordyceps militaris to make it overexpressed by using conventional techniques in the art, so as to increase the spore yield of mycelium.

[0022] Optionally, in some embodiments of the present invention, the target Cordyceps militaris fungus is a degenerated Cordyceps militaris strain.

[0023] The present invention unexpectedly found that the spore yield and fruiting body yield of the degenerated Cordyceps militaris strain can be increased by introducing the above gene into the degenerated Cordyceps militaris strain.

[0024] Optionally, in some embodiments of the present invention, the target Cordyceps militaris as described above is a ura5-deficient strain of the Cordyceps militaris strain.

[0025] It should be noted that the target Cordyceps militaris strain of the present invention can be any type of Cordyceps militaris in the art, and is not limited to ura5-deficient strains, and can also be Cm01 strains.

[0026] In one aspect, the present invention provides a method for cultivating Cordyceps militaris fruiting bodies, comprising: inoculating Cordyceps militaris fungi that overexpress the nucleic acid molecule as described above into a culture medium.

[0027] Optionally, in some embodiments of the present invention, the method further comprises: culturing the inoculated culture medium at 24-26° C.; the culture medium contains wheat, silkworm pupa powder and soybean meal powder.

[0028] Optionally, in some embodiments of the present invention, the target Cordyceps militaris fungus is a degenerated Cordyceps militaris strain.

[0029] It should be noted that the culture medium used in the present invention can be any applicable culture medium in the art, as long as it can be used for the cultivation of Cordyceps militaris.

[0030] Optionally, in some embodiments of the present invention, the Cordyceps militaris strain is a ura5-deficient strain of the Cordyceps militaris strain.

[0031] On the one hand, the present invention provides a method for detecting a nucleic acid molecule as described above, comprising: using the primer pair shown in SEQ ID NO.3-4 to amplify a nucleic acid template extracted from the Cordyceps militaris to be detected.

[0032] It should be noted that, based on the nucleotide sequence shown in SEQ ID NO.1 disclosed in the present invention, those skilled in the art can easily conceive of using other primer pair sequences to perform qualitative or quantitative detection on the nucleic acid molecule. No matter which primer pair is selected to detect the nucleic acid molecule shown in the above-mentioned SEQ ID NO.1, it falls within the protection scope of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments are briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without creative work.

[0034] Figure 1 This is the electrophoresis diagram of the amplified target gene FTO sequence in Example 1 of the present application;

[0035] Figure 2 This is the electrophoresis diagram of the promoter Tef1 sequence amplified in Example 1 of the present application;

[0036] Figure 3 This is the electrophoresis diagram of the transformant verification of Example 4 of the present application;

[0037] Figure 4 This is a graph showing changes in the transcription level of the FTO gene in the CmFTO overexpression strain;

[0038] Figure 5 is the graph of spore germination rate of overexpression strain and wild-type strain;

[0039] Figure 6 Diagram of hyphae diameter of overexpression strain and wild-type strain;

[0040] Figure 7 The graphs are for the spore production of the overexpression strain and the wild-type strain;

[0041] Figure 8This is a diagram of the fruiting body growth status of the overexpression strain and the wild-type strain. DETAILED DESCRIPTION

[0042] In order to make the purpose, technical scheme and advantages of the embodiments of the present invention clearer, the technical scheme in the embodiments of the present invention will be described clearly and completely below. If the specific conditions are not specified in the embodiments, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased commercially.

[0043] The features and performance of the present invention are further described in detail below in conjunction with the embodiments.

[0044] Example 1

[0045] Preparation of Cordyceps militaris overexpression gene FTO

[0046] The preparation of the full-length sequence of the Cordyceps militaris overexpression gene FTO in this example adopts the following steps:

[0047] Step 1), using the synthesized FTO gene as a template, using CmFTO-F and CmFTO-R as primers, amplifying the target sequence (SEQ ID NO.1); the amplification primers are shown in Table 1, and the PCR amplification system is shown in Table 2; the PCR amplification conditions are: 98°C pre-denaturation for 30s, 98°C denaturation for 10s, 60°C annealing for 5s, 72°C extension for 10s, a total of 35 cycles, and finally 72°C extension for 1min;

[0048] Step 2) The amplified product obtained in step 1) was detected by 1% agarose gel and the target fragment was recovered. The electrophoresis detection result was as follows: Figure 1 shown.

[0049] Preparation of FTO vector promoter Tef1 for overexpression of Cordyceps militaris gene

[0050] The preparation of the promoter Tef1 of the Cordyceps militaris overexpression gene FTO vector in this example adopts the following steps:

[0051] Step 1), using Pxbthg E. coli plasmid as template (the plasmid contains Tef1 promoter), Tef1-F and Tef1-R as primers, amplifying the promoter target sequence (SEQ ID NO.2); the amplification primers are shown in Table 1, and the PCR amplification system is shown in Table 2; the PCR amplification conditions are: 98°C pre-denaturation for 30s, 98°C denaturation for 10s, 60°C annealing for 5s, 72°C extension for 10s, a total of 35 cycles, and finally 72°C extension for 1min;

[0052] Step 2) The amplified product obtained in step 1) was detected by 1% agarose gel and the target fragment was recovered. The electrophoresis detection result was as follows: Figure 2 shown.

[0053] SEQ ID NO:1

[0054] atgaagcgtacaccaacagcagaagaacgcgaacgagaagctaagaagctccgtcttctcgaagagctggaggatacttg

[0055] gctcccatacctcaccaaaggacgacgagttctaccagcagtggcaactcaagtacccaaagctcatcctccgagaggcctcctcc

[0056] gtttccgaagaactccacaaggaagtccaggaggccttcctcacactccacaagcacggttgcctttttcgcgacctcgtccgtattcag

[0057] ggcaaggatcttcttaccccagtctctcgtattctcattggcaacccaggttgcacctacaagtacctcaacacacgcctctttacagttcct

[0058] tggccagttaagggctccaacattaagcacaccgaagcagaaattgccgcagcttgcgaaacattcctcaagctcaacgactacctcc

[0059] agatcgaaaccattcaggctctcgaagaacttgccgctaaggaaaaggctaacgaagacgcagtcccactttgcatgtcagcagatttc

[0060] ccacgagttggcatgggttcttcttacaacggccaggacgaagtcgatattaagtcccgcgccgcctacaacgtcacactcctcaacttt

[0061] atggacccacagaagatgccctacctcaaggaagagccatacttcggcatgggtaagatggcagtttcttggcaccacgacgaaaac

[0062] cttgtcgatcgttctgccgttgcagtctactcttactcttgcgaaggcccagaagaagagtcagaagacgattctcacctcgaaggtcga

[0063] gatccagatatttggcacgtcggcttcaagatttcctgggacatcgaaaccccaggtcttgctattccacttcaccaaggcgattgctactt

[0064] catgctcgacgatctcaacgctacccaccaacattgcgttcttgcaggctctcaaccacgcttttcttctacacaccgagttgccgagtgct

[0065] ctacaggtacactcgactacattctccaacgttgccaactcgctctccaaaacgtttgcgacgacgttgataacgacgacgtctctctcaa

[0066] gtccttcgaaccagccgttcttaagcagggcgaagaaattcacaacgaggtcgaatttgagtggttgcgtcagttttggtttcagggcaa

[0067] ccgttaccgtaagtgcacagattggtggtgccaaccaatggctcaactcgaagccctttggaagaagatggaaggcgttacaaacgcc

[0068] gttcttcacgaagtcaagcgagaaggtcttccagttgaacagcgcaacgaaattctcaccgctattctcgcttctctcacagctcgtcaaa

[0069] accttcgtcgagagtggcacgctcgttgccaatctcgtattgctcgtacactcccagcagatcaaaaaccagagtgccgtccatattggg

[0070] aaaaagacgacgcttctatgccactcccatttgacctcacagatattgtctccgaactccgaggccaacttctggaagctaagccataa

[0071] SEQ ID NO:2

[0072] tcaaggtggccacgacaacctaattattgccgctacacaaactttgaacatgtggacacgctttttcatcatgcccaaaacagtc

[0073] acagctcgagtttgcagtctagcctgacctgcacccaagtctgcagagctggtcgtggtgacacaccgaggatctctgtctgtagatgc

[0074] ccaacctgatagggattgggctcgatcgccaaatccccaaatcgccatcctcttaacgaataatatgactgaatttttgtcacattgacga

[0075] gccacatccatcttgtacacagcttttagatacgagccttgcgttcctgtggccactccctgtcacctacctatgtatctgaggctatctcttg

[0076] gctacagtgtggctgatacacgaatttttctagtgcgtaggaaggtagccacacagttacccagcgagggagatgtgcagcctgtagtt

[0077] aatactaactacctagttggaacgagtaccttttagtatctcccagggcacccgctttcagtggcttggagggaggggaaccagacaag

[0078] acaagaggccaaagatctcagcgctcgtcgcaacccaaccagcccctctcaattggttcgaatgtattgatgcgcagaagcgcgcacc

[0079] ccgtccaacagcgggtattaataaatggtaatggatattactgctgcgcgactgggagagctggcggctctgatgtacaatgtaccctac

[0080] ttgcctgcctgcccatgagacgtaatggtggcctgtgcagcccgtgaaatctctgcgccacagcaagatacgtaaggaggggcatgg

[0081] aggggtaaggcagcagaagcagcacagtttgggggtatctacagccacgcagactctgaaaacagccaagaaacgagcaaaaaat

[0082] cattcaccggttgactcaatccgccatcgtcttattcacttcactttgatgatccgcttggtgccttgctgccctgcgatgggcccaaacctc

[0083] cgaggagcagcctcctaattggtgagcccctctaaaaataagtggaaatgctgcgagtgaaggaaaagtgagaagcagaatttttttgt

[0084] gcctcaccttatttgctgccgcagcaggaaaacaaaacagacctcccacttgttagggctagtggaccacctggcctgccgccactctt

[0085] cgttgccccgcgccagcgtgcaccagccaggttttttttctcccactccacccctcccccgccagacctttttaaactcctcctcccacca

[0086] ccagctttgtgaaatttttctctcttttgctccttgtctcgcatacccggttcaagcatccgatctgcgaattcatgtatgtcttcacttacctacgc

[0087] ctcccaagctgttgatagcttcgaatatggctcggacatctcatagaggactgcgttgtttgctaacatgacggccttcagatttccgaaag

[0088] gacctcataaaagaatcactcgcattcaataacaaacaccttcaaactcgcattcaataacaaacaccttcaaaatgatgtacaagaagtt

[0089] cgccgctctcgcag

[0090] Table 1 Primer sequences

[0091]

[0092] Table 2 PCR reaction system

[0093]

[0094] The recovered target sequence fragment was sequenced, and the sequence of the target fragment was consistent with the sequence of the Cordyceps militaris overexpression gene FTO of the present application. The promoter sequence was consistent with the Tef1 sequence in the Pxbthg Escherichia coli plasmid.

[0095] The above-mentioned PCR primers of the present application are other primers designed by the inventor of the present application through Primer5 software or other primer sequence design software according to the sequence of the present application, and can also achieve the purpose of PCR of the present application.

[0096] In addition, the specific PCR system and PCR conditions in the embodiments of the present application can also be adjusted as needed during specific implementation.

[0097] Example 2

[0098] Construction of Cordyceps militaris overexpression plasmid OeFTO

[0099] The Pxbture vector and Pxbthg vector used in this example are preserved by Shanghai Academy of Agricultural Sciences. E. coli Top competent cells and AGL1 competent cells are commercially available. The reagents used are purchased from the above experimental materials. The recombinant vector is designed and customized according to this application.

[0100] The preparation method of the Cordyceps militaris overexpression plasmid OeFTO in this experiment includes the following steps:

[0101] Sa, the Pxbture empty vector obtained in Example 1 was digested with XbaI, and the digestion product was purified by agarose gel to obtain a linearized Pxbture plasmid;

[0102] Sb, using DNA ligase, ligating the linearized Pxbture plasmid obtained in step Sa with the promoter Tef1 (SEQ ID NO: 2) and the target gene FTO (SEQ ID NO: 1);

[0103] Sc. The ligated vector obtained in step Sb is transformed into E. coli TOP10 competent cells, cultured and screened to obtain positive clones to obtain the recombinant plasmid OeFTO.

[0104] The specific steps are as follows:

[0105] 1) Take the frozen E. coli TOP10 competent cells and place them on ice immediately;

[0106] 2) After the competent cells have thawed, slowly add 5 μL of the ligation vector to the competent cells, flick to mix, and place on ice for 25 min to obtain a cell mixture;

[0107] 3) Heat the cell mixture to 42°C for 45 seconds and immediately place on ice to cool for 2 minutes;

[0108] 4) Add 700 μL of LB medium to the heat-shocked cell mixture, mix gently, and incubate on a shaker at 37°C and 200 rpm for 1 h to obtain a cell incubation solution;

[0109] 5) Centrifuge the cell incubation solution at 5000 rpm for 60 seconds, discard 500 μL of the supernatant, and mix the remaining cells to obtain a bacterial solution;

[0110] 6) Take 100 μL of bacterial solution and evenly spread it on LB solid medium containing 1% Kana, and incubate it upside down in a 37°C incubator for 13 h;

[0111] 7) Pick 10 single clones from the cultured bacteria and perform colony PCR verification. Culture the positive clones in a test tube containing 20 mL of LB medium at 37°C for 12 h. Store the bacterial solution in 30% glycerol and store it in a -80°C refrigerator for later use.

[0112] 8) Referring to the instructions of the Vazyne plasmid extraction kit, the plasmid was extracted from the prepared bacterial solution and sent to the company for sequencing. After the sequencing was correct, the prepared bacterial solution was taken, the plasmid was extracted, and the E. coli recombinant plasmid OeFTO was obtained.

[0113] Example 3

[0114] E.coli OeFTO infects Agrobacterium

[0115] The freeze-thaw method is used, and the specific steps are as follows:

[0116] 1) Take the frozen Agrobacterium AGL1 competent cells and place them on ice immediately;

[0117] 2) After the competent cells have thawed, slowly add 5 μL of E. coli plasmid to the competent cells, flick to mix, and place in liquid nitrogen for 5 minutes to freeze them instantly;

[0118] 3) Take out and place in a 37°C warm bath for 5 min to allow the competent cells to dissolve;

[0119] 4) Place the dissolved competent cells on ice for 5 minutes;

[0120] Add 400 μL of LB medium to the cell mixture, mix gently, and incubate on a shaker at 28°C and 200 rpm for 4 h to obtain a cell incubation solution;

[0121] 5) Take 100 μL of the cell incubation solution and evenly spread it on the LB solid medium containing 1% Kana + 1% rifampicin, and incubate it upside down in a 28°C incubator for 2 days;

[0122] 7) Ten single clones were selected from the cultured bacteria and verified by colony PCR. The positive clones were cultured in a test tube containing 20 mL of LB + 1% Kana + 1% rifampicin medium at 28°C for 2 days. The bacterial solution was preserved in 30% glycerol and stored in a -80°C refrigerator for later use.

[0123] Example 4

[0124] Construction of Cordyceps militaris CmFTO overexpression strain

[0125] In this example, the ura5-deficient strain of Cordyceps militaris Cmura5 was selected - as the basic strain.

[0126] The method for constructing the overexpression strain of Cordyceps militaris CmFTO of this embodiment comprises the following steps:

[0127] Step (1) Preparation of Cmura5 - Spore fluid

[0128] The specific steps are as follows:

[0129] 1) Take a PDA plate and culture Cmura5 - The strains were cultured in an incubator at 25°C for 7 days;

[0130] 2) On the clean bench, take 6 pieces of Cmura5 - The bacterial block was placed in SDB+1% uridine+1% uracil liquid medium and cultured at 25°C, 200 rpm for 6 days;

[0131] 3) Then filter with non-woven fabric to remove the bacteria and obtain spore liquid.

[0132] The applicant repeated the experiment for more than 10 times and successfully obtained spore liquid.

[0133] Step (2) Agrobacterium infection of Cmura5 - spore.

[0134] The specific steps are as follows:

[0135] 1) Pick a single colony of Agrobacterium tumefaciens AGL-1 that has been verified to contain the target plasmid from the LB plate, inoculate it into 5 mL of LB liquid medium containing 50 μg / mL kanamycin and carboxybenzyl, and culture it at 220 rpm and 28°C overnight.

[0136] 2) Centrifuge at 5000 rpm for 2 min to collect the cells, resuspend them in an equal volume of liquid induction medium (IM liquid culture medium), and transfer an appropriate amount of the resuspension to 5 mL of IM liquid induction medium to make OD600 = 0.2-0.3.

[0137] 3) Incubate at 28°C, 220 rpm with shaking for 4-6 h until the bacterial concentration reaches OD600 = 0.5-0.8.

[0138] 4) Take the above Agrobacterium culture solution and dilute it to 1×10 6 100 μL of spore solution with a concentration of 100 μL / mL was mixed thoroughly and spread on IM plates and cultured at 28°C for 2 days.

[0139] 5) Add 2 mL of 0.05% Tween 20 solution to the above co-culture plate, and gently scrape and mix the co-culture with a spreader. Spread 200 μL of the washed mixture on M-100 medium containing 300 μg / mL cephalosporin per plate, and culture at 25°C for 5-6 days until transformants appear.

[0140] 6) Select transformants and place them on the same screening medium. When the colony grows to a diameter of about 2 cm, extract a small amount of the transformant genome for PCR verification.

[0141] Using YF and YR as primers (see Table 1) and the genome solution as the template solution, PCR amplification was performed. The PCR reaction system is shown in Table 3. The PCR amplification conditions were: 98°C pre-denaturation for 30s, 98°C denaturation for 10s, 60°C annealing for 5s, 72°C extension for 10s, a total of 28 cycles, and finally 72°C extension for 1min. The product was detected with 1% agarose gel to observe whether there was a band of the overexpressed target gene of the present application.

[0142] Table 3 PCR reaction system

[0143]

[0144] Screening of transformed strains with target gene bands, all of which are OeFTO-Cmura5 - Among the strains, the strain successfully transformed with the OeFTO overexpression plasmid was detected by electrophoresis. Figure 3 shown.

[0145] The strains successfully transformed with the Cordyceps militaris OeFTO overexpression plasmid were screened by qRT-PCR. The specific operation is as follows:

[0146] Take wild-type Cmura5 - Fresh mycelia of strains and strains successfully transformed with OeFTO overexpression plasmid were collected according to Plant Total RNA Isolation Kit (Polysaccharides & Polyphenolics-rich) instructions, extract total RNA, and determine the purity and concentration;

[0147] Take 1 μg of total RNA and III RT SuperMix for qPCR (+gDNA wiper) usage method for cDNA synthesis;

[0148] Using cDNA as template, qRT-PCR analysis of FTO transcription level was performed using specific primers in 96-well plates according to AceQ qPCR SYBR Green Master Mix (Without ROX); TUB in Cordyceps militaris was used as the internal reference gene, and 2 -ΔΔ The relative expression level of each gene was calculated by CT method; the specific primer set sequences are shown in Table 4, and the qRT-PCR reaction system is shown in Table 5; the PCR amplification conditions were: 98°C pre-denaturation for 5 min, 95°C denaturation for 10 s, 60°C annealing for 30 s, for a total of 40 cycles;

[0149] Table 4 Specific primer set sequences

[0150] Primer name Sequence (5'-3') SEQ ID NO. FTO-qF CGACCTCGTCCGTATTCAGG 9 FTO-qR GTGGGACTGCGTCTTCGTTA 10 TUB-F TTCTGAGCCATCCTAC 11 TUB-R CAGTCAAGGGAGCAAAGC 12

[0151] Table 5 qRT-PCR reaction system

[0152]

[0153] The strains with significantly high transcription levels of the overexpressed gene FTO in the present application were selected through rescreening to obtain overexpression strains.

[0154] In this example, the strain with the highest transcription level of overexpressed gene FTO was selected, and the results obtained by detection and analysis were as follows: Figure 4 shown.

[0155] Depend on Figure 4 It can be seen that the OeFTO overexpression strain (PTF1-4) finally screened in this example is similar to the wild-type Cmura5 - Compared with the strains of - There is no FTO gene in the genome, so it cannot be detected.

[0156] The strain (PTF2) with the highest transcription level obtained in this example was preserved as the Cordyceps militaris overexpression strain (CmFTO) of the present application.

[0157] The strain sent for preservation was used as the basic strain for subculture, and the bacterial cells obtained from the subculture were taken and subjected to qRT-PCR detection again, using the same operating steps as the qRT-PCR re-screening in this embodiment.

[0158] After testing, the expression level of CmFTO in the bacteria obtained by subculture was not significantly different from that of the basic strain. Therefore, it can be seen that the Cordyceps militaris CmFTO overexpression strain of the present application can be stably subcultured.

[0159] Example 5

[0160] Determination of Cordyceps militaris spore germination rate

[0161] The specific steps are as follows:

[0162] 1) The CmFTO overexpression strain was activated, and after 5 days, the activated bacteria were obtained;

[0163] 2) The activated bacteria were inoculated into SDB liquid culture medium, wherein the liquid culture medium contained 40 g / L glucose, 10 g / L peptone and 10 g / L yeast extract powder, and fermented at 25°C and 150 rpm for 6 days, and then filtered with non-woven fabric to remove the bacteria and obtain spore liquid.

[0164] 2) The spore solution concentration was fixed to 5 mL by adding SDB liquid medium, and the spore concentration was diluted to 105 / mL. The spores were fermented in a shaking incubator at 25°C and 150 rpm for 4 h, 8 h, and 12 h, and the spore germination rate was calculated.

[0165] The test results are as follows Figure 5 , it can be seen that the conidia rate of the CmFTO overexpression strain is higher than that of the wild-type Cmura5 - strains.

[0166] Example 6

[0167] Determination of Mycelium Diameter of Cordyceps militaris

[0168] The obtained spore solution was diluted to 10 5 / mL, take 100uL and spot it in the center of the PDA plate, Cmura5 - The control group; the mycelium diameters were compared after 21 days.

[0169] The test results are as follows Figure 6 It can be seen that the mycelial diameter of the CmFTO overexpression strain is larger than that of the wild-type Cmura5 - strains.

[0170] Example 7

[0171] Determination of spore production of Cordyceps militaris

[0172] The specific steps are as follows:

[0173] 1) measuring the diameter of the plate cultured for 21 days in the above example and calculating the mycelial surface area;

[0174] 2) Elute the plate with 0.05% Tween 20 and count the number of spores;

[0175] 3) Spore production = number of spores / hyphae surface area.

[0176] The test results are as follows Figure 7 .

[0177] Example 8

[0178] Cordyceps militaris fruiting body germination

[0179] The obtained spore solution was diluted to 10 5 / mL, take 2mL and spread evenly in the wheat culture medium cultivation bottle. Each bottle of wheat culture medium consists of 25g wheat, 2.5g silkworm pupa powder, 2.5g soybean meal powder, Cmura5 - The control group was used; the growth status of the fruiting bodies was observed after 50 days.

[0180] The test results are as follows Figure 8 .

[0181] In summary, through Figure 5 , Figure 6 , Figure 7 and Figure 8 It can be seen that the introduction of FTO gene can significantly improve the spore germination rate of Cordyceps militaris, promote mycelial growth, and facilitate fruiting body germination. The present invention provides a new idea and method for increasing the yield of Cordyceps militaris.

[0182] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. An isolated nucleic acid molecule encoding an α-ketoglutarate-dependent dioxygenase (FTO), characterized in that Its nucleotide sequence is shown in SEQ ID NO.

1.

2. A recombinant vector, characterized in that: It contains the nucleic acid molecule according to claim 1; Optionally, it further contains a promoter sequence, which is located upstream of the nucleic acid molecule; Optionally, the promoter sequence is shown as SEQ ID NO.

2.

3. A recombinant cell, characterized in that It contains the recombinant vector according to claim 2.

4. Use of the nucleic acid molecule according to claim 1, the recombinant vector according to claim 2, or the recombinant cell according to claim 3 in cultivating Cordyceps militaris spores.

5. A method for increasing the spore production of Cordyceps militaris, characterized in that: The nucleic acid molecule of claim 1 or the recombinant vector of claim 2 is transferred into the target Cordyceps militaris fungus so that the nucleic acid molecule is overexpressed in the target Cordyceps militaris fungus.

6. The method according to claim 5, characterized in that The target Cordyceps militaris fungus is a degenerate Cordyceps militaris strain; Optionally, the target Cordyceps militaris is a ura5-deficient strain.

7. A method for cultivating Cordyceps militaris fruiting bodies, characterized in that: It includes: The Cordyceps militaris fungus overexpressing the nucleic acid molecule of claim 1 is inoculated into the culture medium.

8. The method according to claim 7, characterized in that: The method further comprises: culturing the inoculated culture medium at 24-26° C.; the culture medium contains wheat, silkworm pupa powder and soybean meal powder.

9. The method according to claim 7 or 8, characterized in that: The target Cordyceps militaris fungus is a degenerate Cordyceps militaris strain; Optionally, the target Cordyceps militaris is a ura5-deficient strain.

10. A method for detecting nucleic acid molecules as claimed in claim 1, characterized in that: It includes: The primer pair shown in SEQ ID NO.3-4 is used to amplify the nucleic acid template extracted from the Cordyceps militaris to be tested.

Images