Application of ZmRIN4 protein in regulating corn stalk strength

Abstract

The application discloses application of ZmRIN4 protein in regulating corn stalk strength, and belongs to the technical field of biological breeding. The technical problem to be solved by the application is how to regulate the stalk strength of plants, for example, how to regulate the stalk strength of corn. To solve the technical problem, the application provides a method for increasing the stalk strength and / or stalk diameter of plants, which can increase or improve the stalk strength and / or stalk diameter of a receptor plant by knocking out ZmRIN4 protein in the receptor plant; the receptor plant is a plant containing a coding gene of the ZmRIN4 protein, and the ZmRIN4 protein is a protein with an amino acid sequence shown in SEQ ID No. 1. The application first discloses the role of ZmRIN4 in regulating the stalk strength of corn; the application can be applied to corn breeding to realize directional and accurate improvement of the molecular design breeding of corn lodging resistance and high-density planting, and has wide market prospects.

Description

Technical Field

[0001] This application belongs to the field of biological breeding technology, specifically involving the application of ZmRIN4 protein in regulating maize stalk strength. Background Technology

[0002] Corn is one of my country's major food crops, with the largest planting area among all food crops. Planting density is a crucial factor affecting corn yield, and reasonable close planting is a key technical measure for high yield and efficiency. Increasing planting density has become an important way to achieve high yields per plant population. With increasing planting density, the weight of individual ears of grain decreases, corn stalks become thinner, stalk strength decreases, and the lodging rate increases. Related traits of the plant stem, such as the length of internodes near the ground, stem diameter, and stem epidermal puncture strength, all affect the plant's resistance to lodging. Resistance to lodging increases with thicker stems and greater stem epidermal puncture strength. The higher the population density, the more significant the correlation between population lodging resistance and stalk strength. The mechanical properties of the stalk can serve as an important indicator for judging whether mechanical grain harvesting has been achieved; stalk strength is closely related to the level of mechanical grain harvesting.

[0003] The key to breeding maize for lodging resistance lies in the basic materials. Maize varieties possessing all the desirable traits—short stalks, thick stems, well-developed root systems, high mechanical strength, and tolerance to dense planting—are relatively rare. Generally, maize varieties with short plants, well-developed root systems, and strong, thick stems exhibit stronger lodging resistance. Current research on maize lodging mainly focuses on a few traits such as plant height and ear height. Zhu et al. performed QTL mapping on six lodging-related traits under different planting densities, detecting a total of 27 lodging-related QTLs at two different densities, including two related to stem thickness. Flint-Garcia et al. performed QTL mapping on stem puncture intensity in four F2:3 populations under six different environments, identifying 36 QTL loci, some of which contained genes involved in lignin synthesis and phenylpropane-like pathways. Zhang et al. used 257 inbred line populations to conduct multilocus genome-wide association analysis on lodging resistance-related traits in maize stalks. Genotyping was performed using 48,193 high-quality single nucleotide polymorphism (SNP) markers, identifying 423 quantitative trait nucleotides (QTNs) significantly associated with lodging resistance. Among these QTNs, 29, 34, and 48 were associated with stalk diameter, stalk bending strength, and stalk epidermal puncture strength, respectively. Currently, few genes related to maize stalk strength have been cloned. Zhang et al. precisely located a gene, stiffl, on chromosome 6 that regulates maize stalk strength. This gene encodes an F-box domain protein. A 27.2 kb transposon insertion in the promoter of this gene inhibits transcription, increasing lignin and cellulose content in the cell wall, thereby enhancing maize stalk strength. Appenzeller et al. constructed a cDNA library by sampling maize internodes and screened genes related to cellulose synthase based on the library information. Their research suggests that ZmCesl.9 is mainly involved in the synthesis of the primary cell wall in maize.

[0004] Although some QTLs related to lodging resistance in maize have been identified, stem stalks are complex quantitative traits regulated by multiple genes. Existing studies have only been able to detect a limited number of genetic loci in their respective research populations. Therefore, genetic analysis of maize stem-related traits such as stem diameter, strength, and cellulose content is still needed to deepen our understanding of the molecular mechanisms of variation in maize stem traits. Summary of the Invention

[0005] The technical problem to be solved by this application is how to regulate the stem strength and / or stem diameter of plants, such as how to regulate the stem strength and / or stem diameter of corn.

[0006] To address this technical problem, this application provides a method for increasing or improving the stem strength and / or stem diameter of a plant. The method includes step M1, where M1 can be achieved by downregulating, reducing, or inhibiting the expression of the ZmRIN4 protein-coding gene in the recipient plant, or by downregulating, reducing, or inhibiting the activity or content of the ZmRIN4 protein in the recipient plant, thereby increasing or improving the stem strength and / or stem diameter of the recipient plant. The recipient plant can be a plant containing the ZmRIN4 protein-coding gene.

[0007] The ZmRIN4 protein may be any of the following proteins:

[0008] a1) The amino acid sequence is that of the protein shown in SEQ ID No. 1;

[0009] a2) A protein obtained by substituting and / or deleting and / or adding amino acid residues of the amino acid sequence shown in a1) that has more than 80% identity with the amino acid sequence shown in a1).

[0010] a3) is a fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of a1) or a2).

[0011] Furthermore, in the method described, the ZmRIN4 protein may be derived from corn.

[0012] SEQ ID No.1 consists of 80 amino acid residues.

[0013] The proteins mentioned above can be synthesized artificially, or their encoding genes can be synthesized first and then expressed biologically.

[0014] The protein tag refers to a polypeptide or protein fused with a target protein using in vitro DNA recombination technology for expression, detection, tracing, and / or purification of the target protein. The protein tag may be a Flag protein tag, His protein tag, MBP protein tag, HA protein tag, myc protein tag, GST protein tag, and / or SUMO protein tag, etc.

[0015] Furthermore, in the method, M1 includes introducing a gRNA gene targeting the ZmRIN4 gene and a gene encoding the Cas protein into the recipient maize.

[0016] Furthermore, in the method, the Cas protein may be the Cas9 protein.

[0017] Furthermore, in the method, the target nucleotide sequence of the gRNA gene may be positions 2759-2778 of SEQ ID No. 3 (5'-GGCCGTCCCTTGCCAAAGTT-3').

[0018] Furthermore, in the method described, the plant is selected from monocotyledonous plants.

[0019] Furthermore, in the method, the monocotyledonous plant is selected from grasses.

[0020] Furthermore, in the method, the grass plant is selected from plants of the genus *Zea*.

[0021] Furthermore, in the method, the maize plant is selected from Zea mays L.

[0022] Furthermore, in the method, the plant is corn, and M1) can be any of the following:

[0023] M1-1) The nucleotide AA at positions 2773-2774 of the DNA molecule in the genome of the recipient maize, which has the nucleotide sequence of SEQ ID No.3, is deleted;

[0024] M1-2), the nucleotide sequence of the recipient maize genome is the deletion of nucleotides 2776-2796 of the DNA molecule with the nucleotide sequence of SEQ ID No. 3;

[0025] M1-3), the nucleotide A at position 2773 of the DNA molecule in the genome of the recipient maize is deleted, which has the nucleotide sequence of SEQ ID No. 3;

[0026] M1-4), the nucleotide sequence of the recipient maize genome is the deletion of nucleotides AAA at positions 2772-2774 of the DNA molecule with the nucleotide sequence of SEQ ID No. 3;

[0027] M1-5) Replace nucleotides AAA at positions 2773-2775 of the DNA molecule with SEQ ID No. 3 in the genome of the recipient maize with AAAA.

[0028] Furthermore, in the method, the coding sequence of the ZmRIN4 protein-coding gene is the DNA molecule shown in SEQ ID No. 2. The genomic nucleotide sequence of the ZmRIN4 protein-coding gene is SEQ ID No. 3.

[0029] This application also provides a method for reducing plant stem strength and / or stem diameter, the method comprising step M2, wherein M2 may be used to reduce the stem strength and / or stem diameter of the recipient plant by upregulating or increasing or promoting the expression of the ZmRIN4 protein encoding gene in the recipient plant or by upregulating or increasing or promoting the activity or content of the ZmRIN4 protein in the recipient plant.

[0030] Furthermore, in the method, M2 includes introducing the gene encoding the ZmRIN4 protein into the recipient plant.

[0031] Furthermore, in the method, the encoding gene can be any one of the following (g1)-g3):

[0032] g1) The coding sequence of the coding strand is the DNA molecule of SEQ ID No. 2;

[0033] g2) The nucleotide sequence of the coding strand is the DNA molecule of SEQ ID No. 3;

[0034] g3) is a DNA molecule that has more than 80% identity with the DNA molecule described in g1) or g2) and regulates plant stress resistance.

[0035] Furthermore, in the method described above, the gene encoding the ZmRIN4 protein is introduced into the recipient plant in the form of a recombinant expression vector.

[0036] In some embodiments of this application, the recombinant expression vector is pCAMBIA3301-ZmRIN4, and its physical spectrum is as follows: Figure 1 As shown. The gene encoding the ZmRIN4 protein is transcribed and expressed by the Ubi promoter.

[0037] This application also provides a method for preparing maize with improved stalk strength and / or stalk diameter, the method comprising obtaining target maize with higher stalk strength and / or stalk diameter than the recipient maize by downregulating or reducing or inhibiting the expression of the ZmRIN4 protein encoding gene or the activity or content of the ZmRIN4 protein in the recipient maize, wherein the recipient maize is maize containing the ZmRIN4 protein encoding gene.

[0038] Furthermore, in the method, downregulating or reducing or inhibiting the expression of the ZmRIN4 protein-encoding gene or the activity or content of the ZmRIN4 protein in the recipient maize includes introducing a gRNA gene targeting the ZmRIN4 gene and a gene encoding the Cas protein into the recipient maize to downregulate or reduce or inhibit the expression of the ZmRIN4 protein-encoding gene or the activity or content of the ZmRIN4 protein in the recipient plant.

[0039] Furthermore, in the method described, the plant is selected from monocotyledonous plants.

[0040] Furthermore, in the method, the monocotyledonous plant is selected from grasses.

[0041] Furthermore, in the method, the grass plant is selected from plants of the genus *Zea*.

[0042] Furthermore, in the method, the maize plant is selected from Zea mays L.

[0043] Furthermore, in the method, the target nucleotide sequence of the gRNA gene can be positions 2759-2778 of SEQ ID No. 3 (5'-GGCCGTCCCTTGCCAAAGTT-3').

[0044] In some embodiments of this application, the gene encoding the Cas protein may be a DNA molecule whose nucleotide sequence is the nucleotide sequence of the CRISPR-ZmRIN4 vector at positions 435-4535.

[0045] In some embodiments of this application, the gRNA gene may be a DNA molecule at positions 7180-7282 of the nucleotide sequence of the CRISPR-ZmRIN4 vector, wherein positions 7180-7199 are the gRNA target sequence and positions 7200-7282 are the structural sequence of the sgRNA gene (gRNA scaffold).

[0046] Further, in the method, the plant is maize, and the downregulation, reduction, or inhibition of the expression of the ZmRIN4 protein-encoding gene or the activity or content of the ZmRIN4 protein in the receptor maize may include any of the following:

[0047] M1-1) The nucleotide AA at positions 2773-2774 of the DNA molecule in the genome of the recipient maize, which has the nucleotide sequence of SEQ ID No.3, is deleted;

[0048] M1-2), the nucleotide sequence of the recipient maize genome is the deletion of nucleotides 2776-2796 of the DNA molecule with the nucleotide sequence of SEQ ID No. 3;

[0049] M1-3), the nucleotide A at position 2773 of the DNA molecule in the genome of the recipient maize is deleted, which has the nucleotide sequence of SEQ ID No. 3;

[0050] M1-4), the nucleotide sequence of the recipient maize genome is the deletion of nucleotides AAA at positions 2772-2774 of the DNA molecule with the nucleotide sequence of SEQ ID No. 3;

[0051] M1-5) Replace nucleotides AAA at positions 2773-2775 of the DNA molecule with SEQ ID No. 3 in the genome of the recipient maize with AAAA.

[0052] This application also provides the use of a protein or a substance that regulates gene expression or a substance that regulates the activity or content of said protein in any of the following, wherein said gene encodes said protein, said protein being the ZmRIN4 protein described above.

[0053] A1) Application in regulating plant stem strength;

[0054] A2) Application in the preparation of products that regulate the strength of plant stems;

[0055] A3) Application in regulating plant stem diameter;

[0056] A4) Application in the preparation of products that regulate the diameter of plant stems;

[0057] A5) Applications in plant breeding or plant-assisted breeding.

[0058] Furthermore, in the aforementioned applications, the purpose of plant breeding includes cultivating plants with improved stem strength.

[0059] Furthermore, in the aforementioned applications, the purpose of plant breeding also includes cultivating plants with increased stem diameter.

[0060] Furthermore, in the aforementioned applications, the evaluation indicators for plant breeding include the stem strength of the plant.

[0061] Furthermore, in the aforementioned application, the evaluation indicators for plant breeding include the stem diameter of the plant.

[0062] In this application, the stem strength test index includes the tensile strength of the plant stem.

[0063] In this application, the increased stem strength is manifested as an increase in the tensile strength of the plant stem.

[0064] In this application, the stalk tension is the tension of the first node below the corn ear.

[0065] In some embodiments of this application, the stem strength is measured as follows: on the day of silking, a digital push-pull force gauge is used to measure the pulling force when the first stem node below the ear is tilted at 45°, and the unit is recorded as N.

[0066] In this application, the stalk diameter is the diameter of the first node below the ear of corn.

[0067] In some embodiments of this application, the method for determining the stem diameter is as follows: on the day of silking, the entire plant is dug up, the leaves and leaf sheaths are removed, and a photograph is taken. The diameter of the stem below the ear position is measured using ImageJ, and the unit is recorded as cm.

[0068] Furthermore, in the aforementioned applications, the substance regulating gene expression or the substance regulating the activity or content of the protein can be a biological material, wherein the biological material is any one of the following:

[0069] B1) Nucleic acid molecules that inhibit or reduce the expression of the gene encoding the ZmRIN4 protein or inhibit or reduce the activity of the ZmRIN4 protein;

[0070] B2), an expression cassette containing the nucleic acid molecule described in B1);

[0071] B3), a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2);

[0072] B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3);

[0073] B5) A transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2), or a transgenic plant cell line containing the recombinant vector described in B3);

[0074] B6) Transgenic plant tissue containing the nucleic acid molecules described in B1), or transgenic plant tissue containing the expression cassette described in B2), or transgenic plant tissue containing the recombinant vector described in B3);

[0075] B7) Transgenic plant organs containing the nucleic acid molecules described in B1), or transgenic plant organs containing the expression cassette described in B2), or transgenic plant organs containing the recombinant vector described in B3);

[0076] B8), nucleic acid molecules encoding the ZmRIN4 protein;

[0077] B9) Expression cassettes, recombinant vectors, recombinant microorganisms or transgenic plant cell lines containing the nucleic acid molecules described in B8).

[0078] Furthermore, in the above applications, B1) nucleic acid molecules can be gRNAs (gRNA genes) that target the gene.

[0079] Furthermore, in the above applications, the target nucleotide sequence of the gRNA gene can be positions 2759-2778 of SEQ ID No. 3 (5'-GGCCGTCCCTTGCCAAAGTT-3').

[0080] Furthermore, in the aforementioned applications, the expression cassette described in B2) refers to DNA capable of expressing sgRNA in host cells. This DNA may include not only a promoter that initiates sgRNA gene transcription but also a terminator that terminates sgRNA gene transcription.

[0081] Among the aforementioned biological materials, the recombinant microorganisms mentioned in B4) can specifically be yeast, bacteria, algae, and fungi.

[0082] Among the aforementioned biological materials, the plant tissues described in B6) may be derived from roots, stems, leaves, flowers, fruits, seeds, pollen, embryos, and anthers.

[0083] Among the aforementioned biological materials, the transgenic plant organs described in B7) can be the roots, stems, leaves, flowers, fruits, and seeds of transgenic plants.

[0084] Among the aforementioned biological materials, the transgenic plant cell lines, transgenic plant tissues, and transgenic plant organs may or may not include propagation material.

[0085] Furthermore, in the above applications, the nucleic acid molecule described in B8) is any one of the following DNA molecules described in g1)-g3):

[0086] g1) The coding sequence of the coding strand is the DNA molecule of SEQ ID No. 2;

[0087] g2) The nucleotide sequence of the coding strand is the DNA molecule of SEQ ID No. 3;

[0088] g3) is a DNA molecule that has more than 80% identity with the DNA molecule described in g1) or g2) and regulates plant stress resistance.

[0089] In the aforementioned biological materials, the expression cassette described in B9) refers to DNA capable of expressing the ZmRIN4 protein in host cells. This DNA may include not only a promoter that initiates transcription of the ZmRIN4 protein-encoding gene, but also a terminator that terminates transcription of the ZmRIN4 protein-encoding gene.

[0090] Furthermore, the expression box described in B9 may also include an enhancer subsequence.

[0091] In the aforementioned biological materials, the recombinant vector described in B9) may contain the DNA molecule shown in SEQ ID No. 2 for encoding the ZmRIN4 protein.

[0092] Furthermore, in the aforementioned application, the plant is selected from monocotyledonous plants.

[0093] Furthermore, in the aforementioned application, the monocotyledonous plant is selected from grasses.

[0094] Furthermore, in the aforementioned application, the grass plant is selected from plants of the genus *Zea*.

[0095] Furthermore, in the aforementioned application, the *Zea* species is selected from *Zea mays* L.

[0096] In this application, the "identity of more than 80%" can be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. The "identity of more than 85%" can be at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. The "identity of more than 90%" can be at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%. The 95% or higher level of identity can be at least 95%, 96%, 97%, 98%, or 99% identity.

[0097] In this application, identity refers to the similarity of amino acid sequences or nucleotide sequences. The identity of amino acid sequences can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, by using blastp as the procedure, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, and setting the Gap existence cost, Per residue gap cost, and Lambdaratio to 11, 1, and 0.85 (default values) respectively, a search can be performed to calculate the identity of amino acid sequences, and then the identity value (%) can be obtained.

[0098] In this application, the substance regulating the activity or content of the protein may be a substance that downregulates, reduces, or knocks out the coding gene of the protein and / or a substance that downregulates or reduces the expression of the coding gene of the protein. The regulation of plant stem strength may be to increase plant stem strength.

[0099] In this application, the substance regulating gene expression can be a substance that performs at least one of the following six types of regulation: 1) regulation at the gene transcription level; 2) post-transcriptional regulation of the gene (i.e., regulation of splicing or processing of the primary transcript of the gene); 3) regulation of RNA transport of the gene (i.e., regulation of mRNA transport of the gene from the nucleus to the cytoplasm); 4) regulation of gene translation; 5) regulation of mRNA degradation of the gene; and 6) post-translational regulation of the gene (i.e., regulation of the activity of the protein translated by the gene).

[0100] In this application, the regulation of gene expression can be achieved by inhibiting or reducing gene expression, which can be achieved by gene knockout or gene silencing.

[0101] Gene knockout refers to the phenomenon of inactivating a specific target gene through homologous recombination. Gene knockout inactivates a specific target gene by altering its DNA sequence.

[0102] Gene silencing refers to the phenomenon of preventing or reducing gene expression without damaging the original DNA. Gene silencing presupposes no change in the DNA sequence, resulting in the absence or reduction of gene expression. Gene silencing can occur at two levels: transcriptional silencing due to DNA methylation, heterochromatinization, and position effects; and post-transcriptional gene silencing, which inactivates the gene at the post-transcriptional level through specific inhibition of target RNA. This includes antisense RNA, co-suppression, gene quelling, RNA interference (RNAi), and microRNA (miRNA)-mediated translational repression.

[0103] In this application, the substance regulating gene expression can be a reagent that inhibits or reduces the expression of the gene. The reagent that inhibits or reduces the expression of the gene can be a gene knockout reagent, such as a reagent that knocks out the gene through homologous recombination or a reagent that knocks out the gene through CRISPR-Cas9. The reagent that inhibits or reduces the expression of the gene can contain a polynucleotide that targets the gene, such as siRNA, shRNA, sgRNA, miRNA, or antisense RNA.

[0104] The beneficial technical effects achieved by this application are as follows:

[0105] 1. This application reveals for the first time the mechanism of ZmRIN4 in regulating maize stalk strength, explores the application prospects of ZmRIN4 in maize bio-breeding, and provides new gene resources for maize breeding; it can be applied to major maize breeding units to realize molecular design breeding for targeted and precise improvement of maize lodging resistance and dense planting, and has broad market prospects.

[0106] 2. The future development trend of maize is towards high-density planting, high yield, and suitability for mechanized harvesting. Lodging resistance is one of the important factors restricting mechanized harvesting. Maize lodging resistance is related to a series of factors such as near-ground stalk strength, diameter, and stalk cellulose content, and lodging traits exhibit complex quantitative trait inheritance characteristics controlled by multiple genes. Planting lodging-resistant maize varieties is the most effective way to prevent lodging and ensure high and stable maize yields. The ZmRIN4 gene regulates maize stalk diameter and strength, providing a new approach for improving high-density planting and high-yield maize varieties, and also providing key gene resources for high-density planting and high-yield maize bio-varieties. Attached Figure Description

[0107] Figure 1 The relative expression levels of the target gene in the overexpressing maize line and the control KN5585 are shown.

[0108] Figure 2 This refers to the mutant genotype of the gene knockout line.

[0109] Figure 3 The results show the statistical results of maize stalk diameter in experimental fields in Hainan in 2022. A represents the stalk diameter of maize lines overexpressing ZmRIN4; B and C represent the stalk diameters of ZmRIN4 overexpressing lines OE-4 and OE-3 compared to the control KN5585; D represents the stalk diameter of ZmRIN4 knockout lines; and E and F represent the stalk diameters of ZmRIN4 knockout lines KO-2 and KO-21 compared to the wild-type C01.

[0110] Figure 4 The results show the statistical results of maize stalk diameter in experimental fields in Hainan in 2023. A represents the stalk diameter of maize lines overexpressing ZmRIN4; B and C represent the stalk diameters of ZmRIN4 overexpressing lines OE-4 and OE-3 compared to the control KN5585; D represents the stalk diameter of ZmRIN4 knockout lines; and E and F represent the stalk diameters of ZmRIN4 knockout lines KO-2 and KO-21 compared to the wild-type C01.

[0111] Figure 5The results show the stalk strength of maize in the control area (normal irrigation group) of the experimental field in Xinjiang in 2023. In the figure, A is the comparison of stalk strength between the ZmRIN4 overexpressing line OE-9 and the control KN5585; B is the comparison of stalk strength between the ZmRIN4 overexpressing lines OE-3 and others and the control KN5585; C is the statistical result of stalk strength between the ZmRIN4 knockout line KO-21 and the wild type C01; and D is the statistical result of stalk strength between the ZmRIN4 knockout line maize and the wild type C01.

[0112] Figure 6 The results show the stalk strength of maize in the drought-stricken area (drought stress group) of Xinjiang in 2023. A is a comparison of the stalk strength of the ZmRIN4 overexpressing line OE-9 and the control KN5585; B is a comparison of the stalk strength of the ZmRIN4 overexpressing lines OE-3 and others and the control KN5585; C is a statistical result of the stalk strength of the ZmRIN4 knockout line KO-21 and the wild-type C01; D is a statistical result of the stalk strength of the ZmRIN4 knockout maize line and the wild-type C01.

[0113] Figure 7 The spectrum of the recombinant vector pCAMBIA3301-ZmRIN4. Detailed Implementation

[0114] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0115] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0116] The CRISPR / Cas9 gene editing vector CPB used in the following examples was kindly provided by the research group of Professor Xie Chuanxiao at the Institute of Crop Science, Chinese Academy of Agricultural Sciences, and is disclosed in the literature "Qi X, et al., Genome Editing Enables Next-Generation Hybrid Seed Production Technology. Molecular Plant, 2020, 13(9):1262-1269." The public can obtain the above-mentioned biological material from the applicant. The above-mentioned biological material is only used to repeat the experiments of this application and cannot be used for other purposes.

[0117] The P-Easy-blunt vector used in the following examples is a product of Beijing TransGen Biotech Co., Ltd., catalog number CB101-01;

[0118] The Escherichia coli DH5α / EC DH5α in the following examples is a product of Beijing Qingke Biotechnology Co., Ltd., catalog number TSC01;

[0119] The Agrobacterium GV3101 (pSoup) competent cells used in the following examples are products of Beijing Bomaide Gene Technology Co., Ltd., catalog number C314-01;

[0120] In the following embodiments FastPfu PCR SuperMix is ​​a product of Beijing TransGen Biotech Co., Ltd., with catalog number AS221-11.

[0121] The pCAMBIA3301 vector in the following examples was preserved by the applicant and disclosed in the literature "Zhang X, et al., Overexpression of a maize BR transcription factor ZmBZR1 in Arabidopsis enlarges organ and seed size of the transgenic plants. Plant Science, 2020, 292, 110378." The public can obtain the above-mentioned biological material from the applicant. The obtained biological material is only used to repeat the experiments of this application and cannot be used for other purposes.

[0122] The digital push-pull force gauge in the following embodiments is a product of Yueqing Yilaike Electric Co., Ltd., model YLK-500.

[0123] The present application will now be described in further detail with reference to specific embodiments. The embodiments given are merely illustrative of the present application and are not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the present application in any way.

[0124] Example 1: ZmRIN4 protein and its gene

[0125] This application discloses the use of the ZmRIN4 protein and its encoding gene in regulating maize stalk strength. The amino acid sequence of the ZmRIN4 protein is SEQ ID No. 1, and its encoding gene is the Zm00001eb280910 gene. The nucleotide sequence of the encoding sequence of the Zm00001eb280910 gene is SEQ ID No. 2, and the nucleotide sequence of the genome of the Zm00001eb280910 gene is SEQ ID No. 3.

[0126] Example 2: Preparation of overexpression lines

[0127] 2.1 Construction of overexpression vectors

[0128] (1) Cloning the target gene

[0129] The reverse-transcribed cDNA was used as a template for cloning the Zm00001eb280910 gene, and PCR amplification was performed using RIN4-FW / RIN4-RV primers. The cloning PCR reaction used... Amplification was performed using FastPfu PCR SuperMix.

[0130] The nucleotide sequence of primer RIN4-FW / RIN4-RV is as follows (5'-3'):

[0131] RIN4-FW: ATGGCGGAGGAATCAGGCC;

[0132] RIN4-RV: TCAGGATTGCGTAGGGCTGG.

[0133] The PCR reaction system is as follows: 1 μL Template, 2 μL 2.5 mM dNTPs, 1 μL each of forward and reverse primers (10 μM), 4 μL 5×FastPfu Buffer, 2 μL Fast Pfu DNA polymerase, and ddH2O to a total volume of 20 μL.

[0134] The PCR reaction program was as follows: denaturation at 94℃ for 5 min; denaturation at 94℃ for 30 sec, annealing at 60℃ for 30 sec, extension at 72℃ for 1 min, for a total of 35 cycles; extension at 72℃ for 10 min.

[0135] After the amplified products were detected by agarose gel electrophoresis, the target band was cut off, and the total amount of DNA was estimated according to the brightness of the band in the Mark electrophoresis. An appropriate amount of elution buffer was added to make the final DNA concentration suitable for subsequent experiments, and the target fragment was recovered using the Tiangen DNA Recovery Kit.

[0136] (2) Constructing an intermediate carrier

[0137] The intermediate vector was constructed using a 9zf vector with a UBI promoter and homologous recombination. First, the 9zf vector was linearized by EcoRV digestion. The target fragment for homologous recombination was amplified using primers 9zf-RIN4-FW / 9zf-RIN4-RV (prepared in step (1)). Homologous sequences were added to both sides of the vector insertion site at the 5' end of the primers. The target gene was ligated into the 9zf vector using the principle of homologous recombination to construct the intermediate vector 9zf-ZmRIN4-Tnos. Subsequently, E. coli transformation and identification of positive recombinants were performed. First, 5 μL of the ligation product was added to 50 μL of Trans1-T1 competent E. coli cells thawed on ice, gently mixed, and incubated on ice for 30 min. Then, the cells were heat-shocked in a 42℃ water bath for 42 sec and immediately placed on ice for 2 min. Finally, 500 μL of antibiotic-free liquid LB medium was added, and the cells were cultured at 37℃ with shaking at 200 rpm for 1 h. Centrifuge at 3,000g for 2 min, discard some of the supernatant, and gently pipette the bacterial cells until fully resuspended. Spread the entire bacterial culture onto solid LB agar plates containing ampicillin and incubate overnight at 37°C. Select medium-sized single colonies and incubate in 5 mL of LB liquid medium containing antibiotics at 37°C with shaking at 200 rpm for approximately 10–16 h. Extract plasmids for restriction enzyme digestion, PCR, and sequencing identification. Sequencing results show that the structure of the intermediate vector 9zf-ZmRIN4-Tnos is: replacing the fragment between the two EcoRV restriction enzyme recognition sites of the 9zf vector with the DNA molecule whose nucleotide sequence is SEQ ID No. 2, while keeping the other nucleotide sequences of the 9zf vector unchanged. The correctly sequenced clones were used for subsequent construction of overexpression vectors.

[0138] The nucleotide sequences of primers 9zf-RIN4-FW / 9zf-RIN4-RV are as follows (5'-3'):

[0139] 9zf-RIN4-FW: GTTACTTCTGCAGGAATTCGATATC ATGGCGGAGGAATCAGGC (underlined parts are homologous arms);

[0140] 9zf-RIN4-RV: TAACGAGCTCTAGAAGCTTGATATC TCAGGATTGCGTAGGGCTGG (underscores indicate the homologous arm).

[0141] (3) Construction of overexpression vectors

[0142] The overexpression vector was constructed using pCAMBIA3301 via enzyme ligation. Based on the multiple cloning site on the vector, the pCAMBIA3301 vector and the intermediate vector 9zf-ZmRIN4-Tnos were double-digested with restriction endonucleases BamHI and AflII. The large fragment of pCAMBIA3301 and the small fragment of the intermediate vector 9zf-ZmRIN4-Tnos were recovered, and the two fragments were ligated together using T4 DNA ligase to construct the overexpression vector pCAMBIA3301-ZmRIN4-Tnos.

[0143] Vector linearization enzyme digestion system (20μL system): about 5μg of vector, 0.5μL each of BamHI / AflII, 2μL of 10×CutSmart, and sterile water to make up to 20μL.

[0144] Enzyme digestion conditions: 37℃ water bath digestion (16h).

[0145] The enzyme digestion products were detected by 1% agarose gel electrophoresis, and the linearized vector was recovered according to the instructions of the Tiangen DNA Recovery Kit. The recombinant reaction system was designed based on the Seamless Assembly Cloning Kit from Sino-American Taihe Biotechnology Co., Ltd., using 20-60 ng of linearized vector and DNA fragments at a molar ratio of 3:1 to the vector.

[0146] The recombination reaction system is as follows (10 μL): 0.5-5 μL of target fragment, 0.5-5 μL of linearized vector, 5 μL of 2×SeamlessMaster Mix, and ddH2O to make up to a total volume of 10 μL.

[0147] Conditions for the recombination reaction: 50℃ for 15 min.

[0148] Subsequently, *E. coli* transformation and identification of positive recombinants were performed. 5 μL of the ligation product was added to 50 μL of *Trans1-T1* competent *E. coli* cells thawed on ice, gently mixed, and incubated on ice for 30 min. The cells were then heat-shocked at 42°C for 42 sec, immediately placed on ice for 2 min, and then added to 500 μL of antibiotic-free liquid LB medium. The cells were incubated at 37°C with shaking at 200 rpm for 1 h. After centrifugation at 3,000 g for 2 min, some supernatant was discarded, and the cells were gently resuspended by pipetting. All bacterial culture was spread onto solid LB agar plates containing kanamycin (hereinafter referred to as antibiotics) and incubated overnight at 37°C. Medium-sized single colonies were picked and incubated in 5 mL of antibiotic-containing LB liquid medium at 37°C with shaking at 200 rpm for approximately 10–16 h. Plasmids were extracted for enzyme digestion, PCR, and sequencing identification. Clones with correct sequencing were used for subsequent genetic transformation. The overexpression vector pCAMBIA3301-ZmRIN4 has a size of 10.749 kb. The spectrum of the recombinant vector pCAMBIA3301-ZmRIN4 is as follows: Figure 7 As shown.

[0149] 2.2 Construction of overexpression plants

[0150] The genetic transformation of maize was carried out by the Life Science and Technology Center (Wuhan) of China Seed Group Co., Ltd., with the maize inbred line KN5585 serving as the overexpression recipient. Transgenic T0 seedlings were screened for herbicide resistance and identified as positive transgenic plants by PCR. After continuous self-pollination and genotyping, homozygous transgenic T3 seedlings (OE-3, OE-4, OE-6, and OE-9) were obtained for phenotypic determination.

[0151] The preparation method of T0 transgenic maize is as follows:

[0152] (1) Callus preparation

[0153] Select embryogenic callus tissue that grows rapidly, has a soft, loose, and brittle texture, and a bright color. This type of callus tissue can be subcultured for a long time and can maintain its embryogenic capacity for an extended period.

[0154] (2) Preparation of Agrobacterium

[0155] 1) Two days before infection, streak Agrobacterium on LB medium and incubate in the dark at 28°C, or pick single clones and shake them in liquid LB medium.

[0156] 2) Collect the bacterial cells and transfer them to a 50mL centrifuge tube. Resuspend the bacterial cells in the infection medium to obtain the infection solution, so that the concentration of the infection solution is between OD=0.8-1.5.

[0157] 3) The prepared infection solution was shaken at 200 rpm for 2 hours at 28°C on a shaker to activate Agrobacterium and obtain the infection solution for infection.

[0158] (3) Infection

[0159] 1) Select pretreated callus tissue and transfer it to an infection culture medium;

[0160] 2) Soak the callus tissue in the inoculation solution for 10-30 minutes, break up the callus clumps, and shake well to ensure that the callus tissue is fully in contact with Agrobacterium.

[0161] 3) Aspirate the remaining bacterial solution and transfer the infected callus tissue into a co-culture medium. Incubate in the dark at 19°C for 3 days.

[0162] (4) Restore culture

[0163] Rinse the callus surface 3-5 times with sterile water containing antibiotics. Once the water is no longer cloudy, discard the liquid and transfer the callus to a Petri dish lined with filter paper. Dry the callus surface in a laminar flow hood. Transfer to recovery medium and incubate in the dark at 28°C for 7-10 days. Then transfer to selection medium.

[0164] (5) Filtering

[0165] 1) After recovery culture, the transformed callus tissue was transferred into selection medium supplemented with antibiotics and cultured in the dark at 28°C for 20-30 days;

[0166] 2) Transfer the callus tissue into a sterile petri dish, break it up, and then press it thin.

[0167] 3) Pick out the brighter callus particles on the UV operating table, clump 3-5 particles together, and transfer them into a new selection medium;

[0168] 4) Incubate in the dark at 28℃ for 20 days, then transfer to a new screening medium for subculture and propagation;

[0169] 5) After two more cycles (40 days), the callus tissue is picked again (without breaking it up).

[0170] (6) Differentiation

[0171] 1) After heat shock, the callus tissue was transferred to predifferentiation medium and cultured in the dark at 28°C for 10 days, then transferred to light at 28°C for 10 days.

[0172] 2) Transfer to differentiation medium, and when the regenerated shoots grow to 3-5cm, transfer to rooting medium;

[0173] 3) After a large number of strong roots have grown, harden off the seedlings and transplant them.

[0174] (7) Hardening off seedlings and transplanting

[0175] 1) After rooting, remove the sealing film from the rooting bottle and harden the seedlings in the culture medium for 2-3 days;

[0176] 2) Wash the roots of the culture medium and transplant them into sterilized nutrient soil. Harden the seedlings indoors for 7 days.

[0177] 3) Transplant T0 generation transformants were obtained by transplanting in greenhouses or open fields. T0 generation transformants were then self-pollinated to obtain T1 generation transformants. T1 generation transformants were then self-pollinated to obtain T2 generation transformants. T2 generation transformants were then self-pollinated to obtain T3 generation transformants. Genotyping revealed homozygous T3 generation transformants, including those with OE-3, OE-4, OE-6, and OE-9 genes.

[0178] 2.3 PCR detection of the target gene ZmRIN4

[0179] (1) Method

[0180] The PCR primers Ubi-Fw / Tnos-Rv were designed based on the gene sequence, with an expected amplification fragment size of 445 bp.

[0181] The nucleotide sequence of primer Ubi-Fw / Tnos-Rv is as follows (5'-3'):

[0182] Ubi-Fw: AGCCCTGCCTTCATACGCTA;

[0183] Tnos-Rv:AATCATCGCAAGACCGGCAA;

[0184] Genomic DNA was extracted and amplified according to the following PCR parameters:

[0185] Reaction system: 30 ng template DNA, 2.0 μL 10× buffer, 1.0 μL 2 mM dNTPs, 1.5 μL 25 mM MgCl2, 0.4 μL 10 μM primers, 1.5 U Taq enzyme, and ddH2O to bring the total volume to 20 μL.

[0186] Reaction program: 94℃ denaturation for 5 min; 94℃ denaturation for 30 sec, 60℃ annealing for 30 sec, 72℃ extension for 45 sec, for a total of 35 cycles; 72℃ extension for 5 min.

[0187] (2) Results

[0188] PCR detection of the transformant plants showed that the size of the target gene amplification fragment in the T1 generation of the transformant was consistent with the size of the amplification fragment in the positive plasmid control PCR, approximately 445 bp, indicating that the ZmRIN4 gene overexpression cassette had been integrated into the maize genome.

[0189] 2.4 Gene overexpression level

[0190] ZmRIN4 gene knockout materials KO-21 and KO-2, wild-type C01, and T3 generation ZmRIN4 overexpression materials OE-3, OE-4, OE-6, and OE-9 were selected, with control KN5585 sown in Changji City, Xinjiang Uygur Autonomous Region for field trials. Three replicates were planted in 6-row plots with 12 plants per row (2023), and normal water and fertilizer management was implemented.

[0191] On the day of silking, female ears of plants with uniform growth in the field were taken from control KN5585 and T3 generation overexpression lines OE-3, OE-4, OE-6 and OE-9, and quickly placed in liquid nitrogen. RNA was extracted and reverse transcribed into cDNA. The relative expression level of ZmRIN4 gene in each line was determined by qPCR.

[0192] ZmActin1-Fw:ACCTCACCGACCACCTAATG;

[0193] ZmActin1-Rv:CTGAACCTTTCTGACCCAAT;

[0194] R4-qPCR-Fw:ATGTCAACGATCCCGGCTTCC;

[0195] R4-qPCR-Rv: AGACTCCACCTCTCCAGTCC;

[0196] The reaction system consisted of: 10 μL of 2×SYBR Mix, 0.5 μL of Forward Primer (10 μM), 0.5 μL of Reverse Primer (10 μM), 7 μL of cDNA, and ddH2O to a final volume of 20 μL.

[0197] Quantitative analysis was performed using an ABI 7500 real-time PCR instrument. The qPCR reaction program was: 95℃, 3 min; (95℃, 5 sec, 60℃, 30 sec) × 40 cycles.

[0198] The results showed that the relative expression levels of the ZmRIN4 gene in OE-3, OE-4, OE-6, and OE-9 were 14.2, 45.6, and 19.5 times higher than those in the control KN5585, respectively. Figure 1 ).

[0199] Example 3: Preparation of knockout lines

[0200] 3.1 Construction of CRISPR-Cas9 vector

[0201] (1) Design of sgRNA

[0202] Using the sgRNA design website: http: / / www.rgenome.net / cas-designer / , we designed sgRNAs targeting the genomic sequence of the ZmRIN4 protein. The final nucleotide sequences of the target sgRNAs obtained through screening are as follows:

[0203] sgRNA: GGCCGTCCCTTGCCAAAGTT TGG (The underlined part is the PAM sequence, and the rest are the target sequences. The target sequences are positions 16-35 of SEQ ID No. 2 and positions 2759-2778 of SEQ ID No. 3).

[0204] (2) Amplification of the U6 promoter

[0205] The U6 promoter was amplified using a plasmid containing the U6 promoter as a template, and the amplification primers were MU61-3F / MU61-1R.

[0206] The PCR reaction system is as follows: 1 μL Template, 2 μL 2.5 mM dNTPs, 0.5 μL Forward Primer (10 uM), 0.5 μL Reverse Primer (10 uM), 4 μL 5×FastPfu Buffer, 2 μL FastPfu DNA polymerase, and ddH2O to a final volume of 20 μL.

[0207] The nucleotide sequences of primers MU61-3F / MU61-1R are as follows (5'-3'):

[0208] MU61-3F: TGCACTGCACAA;

[0209] MU61-1R:AATTCGGTGCTTGCCGGCTC;

[0210] The PCR reaction program was as follows: denaturation at 94℃ for 5 min; denaturation at 94℃ for 30 sec, annealing at 60℃ for 30 sec, extension at 72℃ for 1 min, for a total of 35 cycles; extension at 72℃ for 10 min.

[0211] (3) Fusion of U6 and sgRNA

[0212] Using the PCR product and synthesized sgRNA from the previous step as templates, U6 and sgRNA were fused together by overlap PCR using primers MUsgR-1F and MUsgR-2R to obtain a DNA fragment containing the sgRNA expression cassette. The PCR system and procedure are the same as in step (2).

[0213] The nucleotide sequences of primers MUsgR-1F and MUsgR-2R are as follows (5'-3'):

[0214] MUsgR-1F:GAGCCGCAAGCACCGAATTGGCCGTCCCTTGCCAAAGTT;

[0215] MUsgR-2R: GGCCAGTGCCAAGCTTAAAAAAAGCACCGACTCG;

[0216] (4) Finally, using the principle of homologous recombination, the DNA fragment containing the sgRNA expression cassette was fused into the CRISPR-Cas9 vector to construct the CRISPR-ZmRIN4 vector. In the nucleotide sequence (5′→3′) of the CRISPR-ZmRIN4 vector, positions 435-4535 are the Cas9 coding gene, positions 6680-7179 are the U6 promoter, and positions 7180-7282 are the gRNA gene (positions 7180-7199 are the gRNA target sequence, and positions 7200-7282 are the structural sequence of the sgRNA gene (gRNA scaffold)).

[0217] Following this, ligation transformation and identification of positive recombinants were performed. 5 μL of the ligation product was added to 50 μL of Trans1-T1 competent E. coli cells thawed on ice, gently mixed, and incubated on ice for 30 min; followed by heat shock at 42°C for 42 s; immediately placed on ice for 2 min; 500 μL of antibiotic-free liquid LB medium was added, and the cells were incubated at 37°C with shaking at 200 rpm for 1 h; centrifuged at 3,000 g for 2 min, discarding some of the supernatant, and the cells were gently resuspended by pipetting. All bacterial culture was spread onto solid LB agar plates containing kanamycin and incubated overnight at 37°C; medium-sized single colonies were picked and incubated in 5 mL of antibiotic-containing LB liquid medium at 37°C with shaking at 200 rpm for approximately 10-16 h; plasmids were extracted for enzyme digestion, PCR, and sequencing identification. Clones with correct sequencing were used for subsequent genetic transformation.

[0218] 3.2 Preparation of Maize Knockout Lines

[0219] The constructed CRISPR-ZmRIN4 vector was handed over to the Life Science and Technology Center (Wuhan) of China Seed Group Co., Ltd. for genetic transformation to obtain T0 generation knockout lines. The recipient line was maize inbred line C01. The preparation method of gene knockout homozygous lines was the same as in Example 3, except that the overexpression plasmid was replaced with a knockout plasmid and the recipient maize was replaced with maize inbred line C01. CRISPR / Cas9 gene-editing lines were self-crossed to screen for homozygous lines, and sequencing was used to determine the editing site and type. T0 generation knockout lines were self-crossed to obtain T1 generation, and continuous self-crossing was used to obtain T3 generation gene knockout homozygous lines. Sequencing identification revealed homozygous mutants including KO-2 and KO-21.

[0220] (1) Method

[0221] PCR primers RIN4-Crispr-F / RIN4-Crispr-R were designed based on the gene sequence, using the genomic DNA of maize inbred line C01 as a template, with an expected amplified fragment size of 663 bp.

[0222] The nucleotide sequences of primers RIN4-Crispr-F / RIN4-Crispr-R are as follows (5'-3'):

[0223] RIN4-Crispr-F: ATCTGCTTGCAGAAGCCTGT

[0224] RIN4-Crispr-R:GCTGGCTGTCACACAACAAA

[0225] Genomic DNA was extracted and PCR amplified according to the following reaction system:

[0226] Reaction system: 30 ng template DNA, 2.0 μL 10× buffer, 1.0 μL 2 mM dNTPs, 1.5 μL 25 mM MgCl2, 0.4 μL 10 μM primer, 1.5 U Taq enzyme, and ddH2O to a final volume of 20 μL.

[0227] The reaction procedure is as follows: denaturation at 94℃ for 5 min; denaturation at 94℃ for 30 sec, annealing at 60℃ for 30 sec, extension at 72℃ for 45 sec, for a total of 35 cycles; extension at 72℃ for 5 min.

[0228] (2) Results

[0229] Sanger sequencing confirmed the gene knockout homozygous line. The sequencing results of the knockout homozygous line are as follows: Figure 2 The mutations in the homozygous mutants KO-1, KO-2, KO-3, KO-21, and KO+1 are as follows:

[0230] Homozygous mutant KO-2: Compared with wild-type maize C01, the target gene in the two homologous chromosomes of mutant KO-2 has the following changes: nucleotide AA is deleted at positions 2773-2774 of SEQ ID No.3, resulting in a frameshift mutation of the target gene, which in turn leads to the inability of the target protein to be expressed normally, thus achieving the knockout of the target gene.

[0231] Homozygous mutant KO-21: Compared to wild-type maize C01, the target gene in the two homologous chromosomes of mutant KO-21 undergoes the following changes: nucleotides AAGTTGGTGAATGGGATGTC at positions 2776-2796 of SEQ ID No.3 are deleted, resulting in a mutation in the target gene, which in turn leads to the inability of the target protein to be expressed normally, thus achieving the knockout of the target gene.

[0232] Homozygous mutant KO-1: Compared to wild-type maize C01, the target gene in the two homologous chromosomes of mutant KO-1 undergoes the following changes: nucleotide A at position 2773 of SEQ ID No.3 is deleted, resulting in a frameshift mutation in the target gene, which in turn leads to the inability of the target protein to be expressed normally, thus achieving the knockout of the target gene.

[0233] Homozygous mutant KO-3: Compared to wild-type maize C01, the target gene in the two homologous chromosomes of mutant KO-3 undergoes the following changes: nucleotide A at positions 2772-2774 of SEQ ID No.3 is deleted, resulting in a frameshift mutation in the target gene, which in turn leads to the inability of the target protein to be expressed normally, thus achieving the knockout of the target gene.

[0234] Homozygous mutant KO+1: Compared to wild-type maize C01, the target gene in the two homologous chromosomes of mutant KO+1 undergoes the following changes: nucleotides AAA at positions 2773-2775 of SEQ ID No.3 are replaced with AAAA, resulting in a frameshift mutation in the target gene, which in turn leads to the inability of the target protein to be expressed normally, thus achieving the knockout of the target gene.

[0235] Example 4: ZmRIN4 regulates corn stalk strength

[0236] The ZmRIN4 gene knockout materials were selected as KO-21, KO-2 and wild-type C01, T3 generation ZmRIN4 overexpression materials OE-3, OE-4, OE-6 and control KN5585 (a total of 7 lines). They were sown in the experimental field in Hainan in the winter of 2022 and 2023, respectively. Each line was planted in three replicates, and each replicate was set up in 2 rows with 12 plants per row.

[0237] Eight lines were selected: ZmRIN4 gene knockout materials KO-21, KO-2, and wild-type C01; T4 generation ZmRIN4 overexpression materials OE-3, OE-4, OE-6, OE-9; and control KN5585. These were sown in the experimental field in Changji City, Xinjiang Uygur Autonomous Region in the summer of 2023. Two water treatments were set up: normal irrigation (also known as the control area or normal irrigation group or non-drought stress group) and drought stress during flowering (also known as the drought area or drought stress group). Each line was planted in three replicates, and each replicate was set up in 6-row plots (18-row plots for each of the two water treatments), with 12 plants per row.

[0238] 4.1 Stem diameter

[0239] Stem diameter determination method: On the day of silking, the entire plant was dug up, leaves and leaf sheaths were removed, and a photograph was taken. The stem diameter of the node below the ear was measured using ImageJ, and the unit was recorded as cm. Eight individual plants with consistent growth were selected from each line for measurement. Statistical analysis of conventional phenotypic data was performed using the Student's t-test method in Excel (Excel 2013, Microsoft) (*: P < 0.05, **: P < 0.01).

[0240] The results of a survey conducted in Hainan in the winter of 2022 showed that ZmRIN4 overexpressing plants (OE-3, OE-4) had thinner stems, with a stem diameter of 1.68-2.02 cm, which was 14.28-29.51% lower than the control KN5585 (2.38 cm). Gene-edited plants (KO-2, KO-21) had thicker stems, with a stem diameter of 1.68-2.35 cm, which was 17.52-64.28% higher than the wild-type C01 (1.43 cm). Figure 3 ).

[0241] The results of a winter 2023 survey in Hainan showed that in the control area (normal irrigation group), ZmRIN4 overexpressing plants (OE-3, OE-4) had thinner stems, with a stem diameter of 1.62-1.89 cm, a decrease of 16.54-25.72% compared to the control KN5585 (2.18 cm). Gene-edited plants (KO-2, KO-21) had thicker stems, with a stem diameter of 1.86-2.23 cm, an increase of 7.30-28.32% compared to the wild-type C01 (1.74 cm). Figure 4 The above results indicate that the ZmRIN4 gene can regulate the diameter of maize stalks.

[0242] 4.2 Stem Strength

[0243] In the summer of 2023, a field trial was conducted in Changji City, Xinjiang Uygur Autonomous Region. ZmRIN4 gene knockout materials with consistent growth were selected from KO-21 and KO-2, wild-type C01, and ZmRIN4 overexpression materials from OE-3, OE-4, OE-6, and OE-9. The control was KN5585. Drought treatment was applied based on accumulated temperature (GDD). In the drought-stricken area, soil water potential reached 150 cBar 7 days before flowering, and drought stress continued until 14 days after silking, during which time soil water potential was maintained at 150-180 cBar. The control area received normal irrigation.

[0244] Stalk strength testing method: On the day of silking, the tensile force at a 45° angle to the first node below the ear was measured using a digital push-pull force meter. The unit was recorded as N. Under both water treatment conditions, 15-20 individual plants were measured for each material. Statistical analysis of conventional phenotypic data was performed using the Student's t-test method in Excel (Excel 2013, Microsoft) (*: P < 0.05, **: P < 0.01, ***: P < 0.001).

[0245] The results showed that in the control area (normal irrigation group), ZmRIN4 overexpressing plants had thinner stems with a stem strength of 12.1-13.1 N, which was 5.07-12.32% lower than the control KN5585 (13.8 N); gene-edited plants (KO-1, KO-2, and KO-21) had thicker stems with a stem strength of 16.6-22.1 N, which was 5.73%-45.86% higher than the wild-type CO1 (15.7 N). Figure 5 In arid regions (under drought stress during the flowering period), RIN4 overexpression resulted in thinner stems with a stem strength of 11.1-12.3 N, which was 8.89-17.78% lower than the control KN5585 (13.5 N). Gene-edited plants (KO-1, KO-2, KO-21) exhibited thicker stems with a stem strength of 18.9-22.7 N, which was 8.0%-29.71% higher than the wild-type CO1 (17.5 N). Figure 6 The above results indicate that the ZmRIN4 gene can regulate maize stalk strength under both drought and non-drought stress conditions.

[0246] Table 1: Main sequences in this application

[0247]

[0248]

[0249]

[0250]

[0251]

[0252]

[0253]

[0254]

[0255]

[0256] The present application has been described in detail above. Those skilled in the art will recognize that the present application can be implemented in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments are given in this application, it should be understood that further modifications can be made to the present application. In summary, in accordance with the principles of this application, this application is intended to include any changes, uses, or improvements to the present application, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. A method for increasing or improving the strength and / or diameter of corn stalks, characterized in that: The method includes step M1, which involves increasing or enhancing the stalk strength and / or stalk diameter of the recipient maize by knocking out the gene encoding the ZmRIN4 protein in the recipient maize; the recipient maize contains the gene encoding the ZmRIN4 protein. The ZmRIN4 protein is a protein with the amino acid sequence shown in SEQ ID No.

1.

2. The method according to claim 1, characterized in that: The M1 includes the introduction of a gRNA gene encoding a gene targeting the ZmRIN4 protein and a gene encoding the Cas protein into the recipient maize.

3. The method according to claim 2, characterized in that: The target nucleotide sequence of the gRNA gene is positions 2759-2778 of SEQ ID No.

3.

4. The method according to claim 2, characterized in that: M1) is any one of the following: M1-1) The nucleotide AA at positions 2773-2774 of the DNA molecule in the genome of the recipient maize, which has the nucleotide sequence of SEQ ID No.3, is deleted; M1-2), the nucleotide sequence of the recipient maize genome is the deletion of nucleotides 2776-2796 of the DNA molecule with the nucleotide sequence of SEQ ID No. 3; M1-3), the nucleotide A at position 2773 of the DNA molecule in the genome of the recipient maize is deleted, which has the nucleotide sequence of SEQ ID No. 3; M1-4), the nucleotide sequence of the recipient maize genome is the deletion of nucleotides AAA at positions 2772-2774 of the DNA molecule with the nucleotide sequence of SEQ ID No. 3; M1-5) Replace nucleotides AAA at positions 2773-2775 of the DNA molecule with SEQ ID No. 3 in the genome of the recipient maize with AAAA.

5. A method for preparing corn with improved stalk strength and / or stalk diameter, characterized in that: The method includes obtaining target maize with higher stalk strength and / or stalk diameter than the recipient maize by knocking out the gene encoding the ZmRIN4 protein as described in claim 1 in the recipient maize, wherein the recipient maize contains the gene encoding the ZmRIN4 protein.

6. The method according to claim 5, characterized in that: The knockout of the ZmRIN4 protein encoding gene in recipient maize includes the steps of introducing a gRNA gene targeting the ZmRIN4 gene and a gene encoding the Cas protein into the recipient maize.

7. The method according to claim 6, characterized in that: The target nucleotide sequence of the gRNA gene is positions 2759-2778 of SEQ ID No.

3.

8. Use of biological material containing the gene encoding the ZmRIN4 protein of claim 1, which has been knocked out from the recipient maize, in any of the following: A1) Application in improving the strength of corn stalks; A2) Application in the preparation of products that improve the strength of corn stalks; A3) Application in increasing the diameter of corn stalks; A4) Application in the preparation of products that increase the diameter of corn stalks; A5) Application in cultivating maize with improved stem strength, increased stem diameter, lodging resistance, and / or tolerance to dense planting; The biomaterial is any one of the following: B1) Nucleic acid molecules of the gRNA encoding the gene of the ZmRIN4 protein described in claim 1, which are transcribed to target the protein. B2), an expression cassette containing the nucleic acid molecule described in B1); B3), a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2); B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3); B5) A transgenic plant cell line containing the nucleic acid molecule described in B1), a transgenic plant cell line containing the expression cassette described in B2), or a transgenic plant cell line containing the recombinant vector described in B3); B6) Transgenic plant tissue containing the nucleic acid molecules described in B1), transgenic plant tissue containing the expression cassette described in B2), or transgenic plant tissue containing the recombinant vector described in B3); B7) Transgenic plant organs containing the nucleic acid molecules described in B1), transgenic plant organs containing the expression cassette described in B2), or transgenic plant organs containing the recombinant vector described in B3).

Images