Application of Citrus CsDREB Gene in Regulating Plant Height of Citrus and Cultivating Dwarf Varieties
The CsDREB gene is used to genetically engineer citrus plants for height regulation, resulting in a 67.4% reduction in plant height, addressing the lack of molecular understanding in citrus dwarfing and improving agricultural efficiency.
Patent Information
- Application Number
- CN202411626668.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-14
- Publication Date
- 2025-07-15
- Estimated Expiration
- 2044-11-14
AI Technical Summary
The molecular regulatory mechanism of the height of citrus plants in the prior art is unclear, and there is a lack of effective genetic means to cultivate dwarf varieties, resulting in low efficiency of high-density planting and mechanized production.
The citrus CsDREB gene was used for overexpression, and by constructing overexpression vectors and transforming citrus plants, the plant height and internode length were significantly reduced, and E. coli and Agrobacterium were used as vectors and mediating tools.
It significantly reduces the height of citrus plants, with an average reduction of 67.4%, improves production efficiency, reduces labor costs, and provides experimental evidence for the molecular mechanism of dwarf citrus varieties.
Smart Images

Figure CN119464358B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of genetic engineering breeding, and in particular to the application of citrus CsDREB gene in citrus plant height regulation and dwarf variety breeding. Background Art
[0002] Citrus is a globally important economic crop, encompassing several high-value cultivars. Citrus fruits are widely used and serve as a valuable source of vitamins, antioxidants, minerals, and dietary fiber, all crucial for human nutrition and health. Dwarfing is a key agronomic trait for intensive cultivation and effective management in modern orchards, significantly impacting crop yield, lodging resistance, planting density, and achieving a high harvest index.
[0003] Sweet orange production relies on grafted rootstocks, which can be used to control plant height by reducing tree vigor. In sweet orange cultivation, growers are beginning to seek out dwarf and semi-dwarf varieties to control tree size, as dwarfing trees has the potential to increase planting density, increase yield, facilitate harvesting, pruning, and efficiently apply foliar fertilizers and pesticides. Therefore, the development and use of dwarf sweet orange germplasm is particularly important. Dwarf sweet oranges for high-density planting or mechanized production systems will be key to future sustainable production. However, the specific molecular mechanisms that determine sweet orange plant height remain unclear.
[0004] In recent years, numerous dwarfing-related genes have been discovered in model plants and woody fruit trees, most of which are involved in plant hormone synthesis and signal transduction. Furthermore, important genes involved in growth and development, such as cell wall-related genes, homeobox genes, and transcription factors, also determine plant height. These include smallgrain and dwarf2 (SGD2), dwarftiller1 (DWT1), dwarf and delayed-flowering 1 (DDF1), and a novel GRAS transcription factor (SlGRAS26) in tomato. In citrus, the citrus dwarfing viroid (CDVd), a graft-transmitted dwarfing agent, has been shown to reduce branch tip growth by over 20% and crown volume by approximately 50% in dwarfed sweet orange rootstocks.
[0005] Breeding dwarf sweet orange varieties is an effective way to reduce labor costs and increase productivity. However, little is known about the genetic factors controlling sweet orange tree size and shape. Therefore, there is an urgent need to elucidate the molecular mechanisms underlying the dwarf phenotype and to utilize molecular breeding methods to create dwarf sweet orange germplasm for high-density sweet orange cultivation.
[0006] APETALA2 / Ethylene-Response Element-Binding Protein (AP2 / EREBP) is a plant-specific transcription factor superfamily that plays a crucial regulatory role in plant growth and development and various stress responses. Among them, the dehydration-responsive element-binding protein (DREB) subfamily can specifically bind to DRE / CRT cis-acting elements to regulate the expression of genes related to plant development and stress response. For example, OsDREB2B, a member of the rice AP2 / ERF family DREB subgroup, negatively regulates rice plant height by modulating the expression of gibberellin metabolism genes. The crosstalk between ethylene and gibberellins mediated by rice OsEATB inhibits internode elongation and plant development. The SlERF.J2-IAA23 module in tomato integrates light, auxin, and gibberellin signaling to regulate hypocotyl elongation and plant height. Overexpression of either SlERF.H5h or SlERF.H7 in tomato represses the expression of the gibberellin biosynthesis gene GA20ox1, leading to severe dwarfing and reduced gibberellin content. Arabidopsis AtERF11 plays a dual role in promoting internode elongation by inhibiting ethylene biosynthesis and activating GA biosynthesis and signaling pathways. Currently, there is no research or application of DREBs in the breeding of dwarf citrus. Summary of the Invention
[0007] The purpose of the present invention is to provide the application of the citrus CsDREB gene in citrus plant height regulation and dwarf variety breeding, so as to reveal the function of the citrus CsDREB gene, provide an effective candidate gene for the breeding of citrus dwarf varieties, facilitate the use of genetic engineering methods to cultivate and / or select citrus dwarf varieties, reduce the labor costs of fruit farmers, and improve production efficiency, and provide experimental evidence for the early elucidation of the molecular mechanism of the plant dwarf phenotype.
[0008] To achieve the above objectives, the present invention provides an application of the citrus CsDREB gene in regulating the height of citrus plants. The coding sequence of the citrus CsDREB gene is shown in SEQ ID NO.1. Overexpression of the citrus CsDREB gene significantly reduces the height of citrus plants.
[0009] Preferably, the higher the expression level of the citrus CsDREB gene, the lower the height of the citrus plant.
[0010] The vector and engineered bacteria containing the above-mentioned citrus CsDREB gene are used to regulate the growth of citrus plants. The vector is an overexpression vector, and the strains include Escherichia coli and Agrobacterium.
[0011] The application of the citrus CsDREB gene as described above in breeding dwarf citrus varieties.
[0012] The application of the vector and engineered bacteria containing the above-mentioned citrus CsDREB gene in cultivating dwarf citrus varieties, the vector is an overexpression vector, and the strains include Escherichia coli and Agrobacterium.
[0013] The method for cultivating dwarf citrus germplasm using the above-mentioned CsDREB gene comprises the following steps:
[0014] (1) Cloning the coding sequence of the citrus CsDREB gene;
[0015] (2) constructing an overexpression vector containing the CsDREB gene;
[0016] (3) The overexpression vector containing the CsDREB gene is transformed into citrus, and the transgenic plants are identified and cultivated to obtain the dwarf citrus germplasm.
[0017] Preferably, in step (1), the method for cloning the coding sequence of the citrus CsDREB gene is: extracting total RNA from citrus, reverse transcribing it into cDNA as a template, using primers OE-CsDREB-F and OE-CsDREB-R for PCR amplification, and recovering the CsDREB coding sequence DNA fragment, wherein the nucleotide sequence of primer OE-CsDREB-F is shown in SEQ ID NO.2, and the nucleotide sequence of primer OE-CsDREB-R is shown in SEQ ID NO.3.
[0018] Preferably, in step (3), the method for transforming citrus with the overexpression vector containing the CsDREB gene is: transforming the overexpression vector containing the CsDREB gene into Agrobacterium tumefaciens by electroporation, and then transforming citrus explants mediated by Agrobacterium tumefaciens.
[0019] Preferably, in step (3), the transgenic plants are identified by PCR, and the primers used are: ID-CsDREB-F and ID-CsDREB-R, ID-CsDREB-F is a sequence taken from CaMV 35S on the pLGNe vector, and ID-CsDREB-R is a primer designed based on the terminal sequence of the CsDREB gene. The nucleotide sequence of ID-CsDREB-F is shown in SEQ ID NO.4, and the nucleotide sequence of ID-CsDREB-R is shown in SEQ ID NO.5.
[0020] Preferably, qRT-PCR is used to analyze the expression level of CsDREB to identify transgenic plants, and the primers used are: RT-CsDREB-F and RT-CsDREB-R, the nucleotide sequence of RT-CsDREB-F is shown in SEQ ID NO.6, and the nucleotide sequence of RT-CsDREB-R is shown in SEQ ID NO.7.
[0021] Therefore, the application of the citrus CsDREB gene provided by the present invention in citrus plant height regulation and dwarf variety breeding has the following specific technical effects:
[0022] (1) The present invention provides a gene that significantly regulates citrus plant height, the CsDREB gene. Overexpression of the CsDREB gene can significantly reduce citrus plant height and internode length. Compared with the wild type, the plant height of the transgenic plants can be reduced by an average of 67.4%, and the higher the relative expression level, the more significant the reduction in plant height.
[0023] (2) The CsDREB gene provided by the present invention can be used as a candidate gene for cultivating and / or breeding dwarf citrus varieties using genetic engineering methods, helping to reduce the labor costs of fruit farmers and improve production efficiency. It can also provide experimental evidence for clarifying the molecular mechanism of the dwarf citrus phenotype. BRIEF DESCRIPTION OF THE DRAWINGS
[0024] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for use in the description of the embodiments of the present invention. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative labor.
[0025] Figure 1 This is an agarose gel electrophoresis diagram of the PCR amplification product of the CsDREB gene clone of Example 1 of the present invention, wherein M is a DNA molecular weight standard and DREB is the CsDREB gene;
[0026] Figure 2 This is a diagram of the structure of the CsDREB gene overexpression vector constructed in Example 2 of the present invention, wherein GUS is the β-glucosidase gene; P35S is the plant constitutive promoter derived from cauliflower mosaic virus; NOS is the opine synthase gene terminator;
[0027] Figure 3 This is a flow chart of citrus genetic transformation according to Example 3 of the present invention;
[0028] Figure 4The GUS staining results of the transgenic plants in Example 4 of the present invention are shown, wherein DREB-OE-1, DREB-OE-2, and DREB-OE-3 represent three transgenic plants, respectively, and WT represents a wild-type sweet orange plant;
[0029] Figure 5 The electrophoresis results of the PCR products of the transgenic plants in Example 4 of the present invention are shown, wherein P represents the plasmid pLGNe-CsDREB;
[0030] Figure 6 The expression analysis results of the CsDREB gene in the transgenic plants of Example 4 of the present invention are shown, where ** indicates that the difference is extremely significant compared with the WT (P≤0.01);
[0031] Figure 7 This is a photo of the transgenic plant in Example 5 of the present invention;
[0032] Figure 8 This is a photo of the leaves of the transgenic plant of Example 5 of the present invention;
[0033] Figure 9 This is a photo of the internodes of the transgenic plant in Example 5 of the present invention;
[0034] Figure 10 The statistical results of plant height of transgenic plants in Example 5 of the present invention are shown, where ** indicates extremely significant difference compared with WT (P≤0.01). DETAILED DESCRIPTION
[0035] The technical solution of the present invention is further described below with reference to the accompanying drawings and embodiments.
[0036] In order to make the purpose, technical solutions and advantages of the present application clearer, more thorough and more complete, the technical solutions of the present invention are clearly and completely described below through the accompanying drawings and Examples. The following detailed description is an explanation of the embodiments and is intended to provide further details of the present invention. Unless otherwise specified, all technical terms used in the present invention have the same meaning as those generally understood by those skilled in the art to which the application belongs.
[0037] The instruments, equipment, reagents and materials used in the examples were obtained from commercial sources, and the steps not described in detail in the examples are conventional techniques in the art.
[0038] The culture medium used in the examples is as follows:
[0039] Seed germination medium: MS + 30 g / L sucrose + 2.5 g / L Gelrite, pH 5.8.
[0040] Co-culture medium: MS + 2 mg / L BA + 0.5 mg / L IAA + 1 mg / L 2,4-D + 100 μmol AS + 30 g / L sucrose + 2.5 g / L Gelrite, pH 5.8.
[0041] Screening medium: MS + 2 mg / L BA + 0.5 mg / L IAA + 500 mg / L Cef + 50 mg / L Kan + 30 g / L sucrose + 2.5 g / L Gelrite, pH 5.8.
[0042] Seedling medium: MS + 30g / L sucrose, pH 5.8.
[0043] Example 1
[0044] The cloning steps of the citrus CsDREB gene coding sequence are as follows:
[0045] (1) Extract total RNA and synthesize cDNA.
[0046] Total RNA was extracted from sweet orange (Wanjincheng) leaves using a plant total RNA extraction kit (Adlai, Cat: RN09). RNA quality was verified by agarose gel electrophoresis, and RNA concentration was determined using a Nanodrop 2000 spectrophotometer. High-quality RNA was selected and used to synthesize cDNA using the reverse transcription kit PrimeScript RT MasterMix (TaKaRa, Cat: RR036A).
[0047] (2) PCR amplified the coding sequence of the CsDREB gene.
[0048] According to the coding sequence of the CsDREB gene obtained from NCBI (as shown in SEQ ID NO. 1), primers were designed (so that the fragment to be amplified contains an enzyme cutting site).
[0049] SEQ ID NO.1:
[0050] ATGGGTGATCATGACCCTCAAAATCCTACCAACGTATCCGAATTAGACCACTATCTTCAACTTCGAGGGCCACATTCCCTTCACAATAATACTTCCACGTGTCAAAATTACCCTTCTCCCGTAAGTGAAAATTTAGCTCACCCATCATCTAACACCAGTACCATGGCCGCTG CCCCGTCAAGTCCCACCAAGAAACACCCTTCGTACAGGGGAATCCGTTGCCGGAACAGCAAATGGGTGTCGGAGATCCGGGAGCCTCGCAAGAGCACACGTATATGGCTCGGTACATATCCTACTCCTGAAATGGCAGCGGCCGCTTATGATGTTGCAGCCCTAGCCCTAAAA GGAAGTGATGCTGTGCTCAATTTCCCTAACTTTGTTTCAACCTACCCGGTGCCTGCTTCTTCTTCTTCTGTAGACATACGTAACGCCGCTGCAGCTGCGGCTGCTTTCTTGTGCTCGAAGAAAGGCCGAAAGTGTAAGTGATCCTGATGAGAATCAAAGAATGGAACAGTCGC GCAGCAATGATGTGATTGGAGAATTTGTTGACGAGGACGCCCTTTTGAACATGCCTAATTTGCTAGTGGACATGGCAGAGGGAATGATGGTGTCCCCGCCTAGAATAAACTCTTCGCCGTCTGATGATTCGCCGGAGAATTCTGATGGAGAACGTTTGTGGAGCTACTTTTGA
[0051] PCR amplification was performed using primers OE-CsDREB-F (sequence shown in SEQ ID NO. 2), OE-CsDREB-R (sequence shown in SEQ ID NO. 3), and the high-fidelity enzyme PrimeSTAR Max DNA Polymerase (TaKaRa, CAT: R045Q), with the citrus cDNA obtained in step (1) as a template and a reaction system prepared according to the instructions attached to the high-fidelity enzyme PrimeSTAR Max DNA Polymerase.
[0052] The PCR amplification program was as follows: 94°C, 5 min; 94°C, 15 s, 58°C, 15 s, 72°C, 1 min, 38 cycles; and 72°C extension for 10 min. The amplified products were subjected to agarose gel electrophoresis. Figure 1 As shown, the obtained DNA fragment of the CsDREB gene coding sequence was 754 bp in length (including the restriction enzyme cleavage site). The amplified fragment was sent to a company for sequencing, and the sequence was consistent with the coding sequence of the citrus CsDREB gene. Under ultraviolet light, the agarose gel containing the target fragment was cut with a clean blade and the DNA fragment was recovered using a gel recovery kit (BioFlux, Cat: BSC02M1).
[0053] SEQ ID NO.2:GCGGTACCATGGGTGATCATGACCCTCA
[0054] SEQ ID NO.3:
[0055] GCGTCGACTCACTTATCATCATCATCCTTGTAATCCTTATCATCATCATCCTTG
[0056] TAATCAAAGTAGCTCCACAAACG
[0057] Example 2
[0058] The specific steps for constructing the CsDREB gene overexpression vector are as follows:
[0059] The CsDREB gene coding sequence DNA fragment recovered in Example 1 and the overexpression vector pLGNe were double-digested with the restriction endonucleases KpnI and SalI (ThermoFisher). The digestion conditions were as described in the instructions for the restriction endonucleases KpnI and SalI. After double digestion, agarose gel electrophoresis was performed, and the target fragment was recovered using a gel extraction kit. The recovered target fragment was ligated overnight at 4°C using a T4 DNA Ligase kit (Promega, Cat: M1801).
[0060] The ligation product was transformed into Escherichia coli DH5α, and the plasmid of the positive clone was extracted using a plasmid extraction kit (Omega, CAT: D6942) to obtain the CsDREB overexpression vector pLGNe-CsDREB. The structure of the pLGNe-CsDREB recombinant vector is as follows: Figure 2 shown.
[0061] Example 3
[0062] The CsDREB overexpression vector pLGNe-CsDREB obtained in Example 2 was genetically transformed into citrus, as follows: Figure 3 The specific steps are as follows:
[0063] (1) Obtain epicotyls of citrus seedlings.
[0064] Fresh citrus fruits were washed and surface-sterilized with 75% ethanol. The seeds were removed under sterile conditions, the seed coats removed, and placed on seed germination medium. The seeds were incubated in the dark at 28°C for two weeks, followed by one week of incubation under 16-hour light / 8-hour dark conditions. The epicotyls of the germinated seedlings were aseptically cut into 1 cm segments and used as explants for Agrobacterium tumefaciens-mediated genetic transformation.
[0065] (2) The overexpression vector pLGNe-CsDREB was transformed into Agrobacterium.
[0066] The constructed overexpression vector was introduced into Agrobacterium tumefaciens EHA105 by electroporation. The specific steps are as follows: pre-thaw frozen Agrobacterium competent cells EHA105 (50 μL) on ice; add 2 μL of the overexpression vector plasmid to the competent cells, pipette to mix, and place on ice for 5 minutes; transfer the mixed solution to the bottom of the pre-dried electric shock cup, place the electric shock cup into the slot and adjust it to the correct position, adjust the electric shock device to the "Agr" gear, press the electric shock button, check the electric shock data to ensure that the electric shock is successful; add 1 mL of LB liquid culture medium to the electric shock cup, pipette to mix, transfer to a sterile centrifuge tube, and shake at 260 rpm at 28°C for 60 minutes; centrifuge the bacterial solution at 10,000 rpm for 1 minute, discard the supernatant (leaving about 100 μL of resuspended bacteria), resuspend and spread on LB solid culture medium, and culture in the dark at 28°C for 2 days; after plaque growth, pick a single clone and perform PCR verification on the single colony using the system and primers in Example 1.
[0067] The PCR reaction conditions were as follows: 94°C for 3 min; 94°C for 30 s, 58°C for 30 s, and 72°C for 30 s, for 38 cycles; and 72°C for 10 min.
[0068] (3) Prepare Agrobacterium tumefaciens bacterial solution.
[0069] Before transfection, streak the Agrobacterium (containing the pLGNe-CsDREB vector) for transfection on LB solid medium containing 50 mg / L kanamycin. Pick a single colony and inoculate it into 25 mL of LB liquid medium containing the same antibiotics. Cultivate the culture with shaking at 28°C overnight. Dilute the culture to an OD value of 0.1 and continue culturing to an OD value of 0.5. Centrifuge at 5000 rpm for 10 min, discard the supernatant, and resuspend the culture in MS liquid medium (pH 5.4) for transfection.
[0070] (4) Transformation of citrus epicotyls.
[0071] The citrus epicotyl stem segments obtained in step (1) were soaked in the Agrobacterium solution obtained in step (2) for 13 minutes and then dried with sterile filter paper. The stem segments were transferred to a co-cultivation medium and cultured in the dark at 26°C for 2 days. After the co-cultivation was completed, the epicotyls were transferred to a screening medium and cultured in the dark at 28°C for 7 days. Thereafter, the epicotyls were cultured at 28°C with 16 hours of light and 8 hours of darkness. The screening medium was used for subculture every two weeks, and then the cells were identified by GUS staining.
[0072] (5) Seedling culture of transformants.
[0073] When the seedlings grow to more than 1 cm, they are cut and grafted onto sweet orange (Wanjincheng) seedlings in sterile test tubes and cultured in seedling culture medium; when the seedlings grow to about 5 cm, they are grafted onto trifoliate orange seedlings and cultured in a 28°C greenhouse.
[0074] Example 4
[0075] The CsDREB overexpressing transgenic plants obtained in Example 3 were verified by the following steps:
[0076] (1) Identification of transgenic plants by GUS staining.
[0077] A small piece of the transgenic plant leaf obtained in the initial screening was subjected to GUS histochemical staining for 24 hours. The results were as follows: Figure 4 As shown, the edges of the leaves of the positive plants appeared blue, while the leaves of the WT plants did not show color.
[0078] (2) PCR identification of transgenic plants.
[0079] 100 mg of leaves from the transgenic plants were extracted and genomic DNA was extracted using a DNA extraction kit (Adlai, CA T: DN15). PCR was then performed to detect the integration of the CsDREB gene coding sequence into the citrus genome. The detection primers were ID-CsDREB-F (sequence shown in SEQ ID NO. 4, located in the 35S region) and ID-CsDREB-R (sequence shown in SEQ ID NO. 5, located in the CDS region). The obtained genomic DNA was used as a template. The PCR system was the same as that in Example 1. The PCR reaction conditions were: 94°C for 3 min; 30 cycles of 94°C for 30 s, 58°C for 30 s, and 72°C for 30 s; and 72°C for 10 min.
[0080] The wild type sweet orange was used as negative control (WT) and the plasmid pLGNe-CsDREB was used as positive control (P). The amplified products were subjected to agarose gel electrophoresis. Figure 5 As shown, a 960 bp amplified fragment was obtained from the positive plants, while no amplification was obtained from the WT plants.
[0081] SEQ ID NO.4:TCGTTGAAGATGCCTCTGCCGACAG
[0082] SEQ ID NO.5:
[0083] GCGTCGACTCACTTATCATCATCATCCTTGTAATCCTTATCATCATCCTTGTAATCAAAGTAGCTCCACAAACG
[0084] (3) qRT-PCR analysis of transgenic plants.
[0085] Total RNA from the leaves of transgenic plants was extracted using a kit (Adlai, CAT No: RN09), and then cDNA was synthesized using a reverse transcription kit PrimeScript RT Master Mix (TaKaRa, CAT No: RR036A). The expression level of the target gene was detected by qRT-PCR. The detection primers were RT-CsDREB-F (sequence shown in SEQ ID NO.6) and RT-CsDREB-R (sequence shown in SEQ ID NO.7). The qRT-PCR reaction conditions were: 95℃ for 3min, 94℃ for 10s; 56℃ for 10s, 72℃ for 10s, 40 cycles; 72℃ for 10min. -△△Ct The relative expression of CsDREB gene in transgenic plants was calculated by defining the water-treated sample as the reference factor, i.e., its CsDREB expression level was 1, and then the expression multiple of the reference factor gene in transgenic citrus was calculated. -△△Ct , which is its relative expression level.
[0086] SEQ ID NO.6:ACCATGGCCGCTGCC
[0087] SEQ ID NO.7: CATAAGCGGCCGCTGC
[0088] The results are as follows Figure 6 As shown, the CsDREB gene was expressed at a higher level in the transgenic plants than in the wild-type plants, and was at least 400 times that of the wild-type plants.
[0089] Example 5
[0090] The phenotypes of CsDREB overexpressing transgenic plants were investigated.
[0091] Photos of 3 transgenic plants Figure 7 and Figure 9 As shown in Figure 2, compared with wild-type plants, transgenic plants were significantly dwarfed and had shorter internodes. The higher the relative expression level, the more significant the reduction in plant height (see Figure 9), the quantitative results of plant height are as follows Figure 10 As shown in the results, overexpression of the CsDREB gene can significantly reduce the height of sweet orange plants.
[0092] Therefore, the present invention provides a gene that has a significant regulatory effect on the plant height of citrus - the CsDREB gene. Overexpression of the CsDREB gene can significantly reduce the plant height and internode length of citrus. Compared with the wild type, the plant height of transgenic plants can be reduced by an average of 67.4%, and the higher the relative expression level, the more significant the reduction in plant height; the provided CsDREB gene can be used as a candidate gene for cultivating and / or breeding dwarf citrus varieties using genetic engineering methods, which can help reduce the labor costs of fruit farmers and improve production efficiency. It can also provide experimental evidence for clarifying the molecular mechanism of the dwarf citrus phenotype.
[0093] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit the same. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that they can still modify or replace the technical solutions of the present invention with equivalents, and these modifications or equivalent replacements cannot cause the modified technical solutions to deviate from the spirit and scope of the technical solutions of the present invention.
Claims
1. Application of citrus genes in regulating the plant height of citrus plants, characterized in that: CsDREB Citrus CsDREB The coding sequence of the gene is shown in SEQ ID NO.
1. Overexpression of the Citrus CsDREB gene significantly reduces the plant height of Citrus plants. 2. Application of the citrus according to claim 1 CsDREB in regulating the plant height of citrus plants, characterized in that: Citrus CsDREB The higher the expression level of the gene, the lower the plant height of the citrus plant.
3. Use of the vector and engineered bacteria containing the citrus gene described in claim 1 in regulating the plant height of citrus plants, characterized in that: CsDREB The vector is an overexpression vector, and the strains include Escherichia coli and Agrobacterium tumefaciens; overexpressing the CsDREB gene significantly reduces the plant height of citrus plants.
4. The citrus as described in claim 1 CsDREB Use of the gene in cultivating dwarf citrus varieties.
5. Use of the vector and engineered bacterium containing the citrus gene described in claim 1 in cultivating dwarf citrus varieties, characterized in that: CsDREB The vector is an overexpression vector, and the strains include Escherichia coli and Agrobacterium tumefaciens.
6. The method for cultivating dwarf citrus germplasm using the gene described in claim 1, characterized in that, CsDREB It includes the following steps: (1) Cloning citrus CsDREB Gene coding sequence; (2)Construct an overexpression vector containing CsDREB gene; (3) Transform citrus with the overexpression vector containing CsDREB gene, identify transgenic plants, and after cultivation, the obtained transgenic plants are dwarf citrus germplasms.
7. The application according to claim 6 CsDREB A method for cultivating dwarf citrus germplasm by genes, characterized in that In step (1), for the cloning method of the citrus CsDREB gene coding sequence: Extract the total RNA of citrus, reverse transcribe it into cDNA as a template, and use primers OE-CsDREB-F and OE-CsDREB-R for PCR amplification, and recover CsDREB the coding sequence DNA fragment, wherein the nucleotide sequence of primer OE-CsDREB-F is as shown in SEQ ID NO.2, and the nucleotide sequence of primer OE-CsDREB-R is as shown in SEQ ID NO.
3.
8. The application according to claim 6 CsDREB A method for cultivating dwarf citrus germplasm by genes, characterized in that In step (3), it includes CsDREB The method for transforming citrus with the overexpression vector containing CsDREB gene is as follows: The overexpression vector containing gene is transformed into Agrobacterium tumefaciens by electroporation, and then the citrus explants are transformed by Agrobacterium tumefaciens-mediated transformation.
9. The application according to claim 6 CsDREB A method for cultivating dwarf citrus germplasm by genes, characterized in that In step (3), the transgenic plants were identified by PCR method, and the primers used were: ID-CsDREB-F and ID-CsDREB-R. ID-CsDREB-F is a sequence taken from CaMV 35S on the pLGNe vector, and ID-CsDREB-R is a primer designed according to CsDREB the gene terminal sequence. The nucleotide sequence of ID-CsDREB-F is shown in SEQ ID NO.4, and the nucleotide sequence of ID-CsDREB-R is shown in SEQ ID NO.
5.
10. The application according to claim 6 CsDREB A method for cultivating dwarf citrus germplasm by genes, characterized in that Analysis was performed using qRT-PCR CsDREB To identify the expression levels of transgenic plants, the primers used were: RT-CsDREB-F and RT-CsDREB-R. The nucleotide sequence of RT-CsDREB-F is shown in SEQ ID NO.6, and the nucleotide sequence of RT-CsDREB-R is shown in SEQ ID NO.7.
Citation Information
Patent Citations
Application of CsDREB1B-1 gene in regulation and control of citrus canker resistance
CN118813678A
DREB repressor modifications and methods to increase agronomic performance of plants
WO2016201038A1