Application of rice low potassium response transcription factor gene KTR2 in regulating drought stress tolerance
By overexpressing or knocking out the KTR2 gene in rice, the response of rice to drought stress was regulated, which solved the problem of insufficient tolerance of rice to drought stress, improved the growth performance and yield during the booting stage, and enhanced the ability to retain potassium.
Patent Information
- Application Number
- CN202411675499.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-21
- Publication Date
- 2025-12-12
- Estimated Expiration
- 2044-11-21
AI Technical Summary
Existing technologies are insufficient to effectively improve rice's tolerance to drought stress, especially during the booting stage, which affects crop yield and quality.
By constructing a recombinant expression vector for the rice low-potassium response transcription factor KTR2, the KTR2 gene was overexpressed in rice using Agrobacterium-mediated transgenic technology, thereby enhancing its tolerance to drought stress. Specific methods include inserting the KTR2 gene into its own promoter and constructing a recombinant expression vector, or knocking out the KTR2 gene using the CRISPR/Cas9 system to regulate the rice response to drought stress.
It significantly improved rice's tolerance to drought stress, enhanced its growth performance during the booting stage, increased the relative yield of rice under drought conditions, and enhanced its potassium uptake capacity.
Smart Images

Figure CN119464360B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering technology and relates to the application of the rice low-potassium response transcription factor gene KTR2 in drought stress tolerance. Background Technology
[0002] Drought stress is one of the most significant abiotic stresses in agricultural production and one of the most severe abiotic factors causing damage to plant growth and crop productivity (Flowers, 2004; Godfray et al., 2010; Tester and Langridge, 2010; Agarwal et al., 2013). When faced with different levels of drought stress, plants activate different coping mechanisms to enhance their resistance to external stimuli, thereby regulating their growth and reproduction. For example, when water stress is not prolonged or intense, plants typically strengthen their resistance to potassium (K) levels. + and water absorption ( and Kirkby, 2010; Plants maintain growth by reducing transpiration and increasing salt excretion (Munns, 2005; Shabala et al., 2010). Under persistent and intense stress, plants may reduce growth rate and shorten the reproductive period to complete reproduction as much as possible (Flowers, 2004; Godfray et al., 2010; Tester and Langridge, 2010; Agarwal et al., 2013).
[0003] Potassium (K) + K+ is the most abundant inorganic cation in plant cells, accounting for 2-10% of the plant's dry weight. It is one of the three essential nutrients for plant growth and development (Adams and Shin, 2014; Leigh and Wyn Jones, 1984; Walker et al., 1996), and is widely involved in many physiological processes of plant growth and development, including osmotic regulation, enzyme activation, ion balance, stomatal movement, and resistance to biotic and abiotic stresses (Wang et al., 2013; Anschütz et al., 2014). As an important inorganic osmotic ion, K+... + It can regulate the osmotic potential of plant cells and plays an important role in plant stress response to osmotic / drought. + It can also regulate plant photosynthesis, as well as the transfer and metabolism of carbohydrates, ultimately determining crop yield and quality. When K +Under K + sufficient supply, plants can enhance their resistance to biotic and abiotic stresses. Low K + will induce K + deficiency signals in root epidermal cells, including Ca 2+ , ROS, phytohormones, microRNAs, etc. These signals are further conducted and trigger the expression of downstream target genes (especially K + channels and high-affinity K + transporters) through transcription factors, ultimately achieving plant adaptation to low K + environments (Wang and Wu, 2013).
[0004] There are about 58 transcription factor families in higher plants, of which six major transcription factor families AP2 / ERF, WRKY, bZIP, NAC, MYB and bHLH have been shown to be involved in plant response to drought and other stresses. Among them, APETALA2 / ethylene response factor (AP2 / ERF) transcription factor is considered to play an important role in the response of plants to multiple hormones and drought and salt stresses (Zhang et al., 2009). AP2 / ERF is one of the largest plant transcription factor families, containing 119-200 family members (Du et al. 2014; Nakano et al. 2006; Rao et al. 2015; Zhuang et al. 2008), which are involved in physiological processes such as plant ethylene signaling, stress response, metabolism and response to external stimuli (Han et al., 2016; Koyama et al. 2013; Lee et al. 2012; Li et al. 2007; Fits and Memelink 2000; Trujillo et al. 2008; Zhu et al. 2014). The member of the Vb subfamily of Arabidopsis ERF transcription factors, RAP2.11, regulates the expression of high-affinity K + transporter AtHAK5 gene and other related genes in the low K + signal transduction pathway, improving plant resistance to low K +environmental stresses. For example, overexpression of JERF3 and SodERF3 in rice and tobacco increased the tolerance of plants to drought, osmotic stress, salt-alkaline and freezing stress (Trujillo et al. 2008; Wu et al. 2008; Zhang et al. 2010c). The expression of rice AP2 / ERF transcription factor KTR2 was up-regulated by low potassium induction, and KTR2 overexpression enhanced the absorption and accumulation of K + of K in rice (Patent Application No. 2024110687042). In this study, we need to further explore how KTR2 regulates the tolerance of rice to drought stress by affecting the absorption and accumulation of K + SUMMARY
[0005] The purpose of the present application is to provide the application of rice low potassium response transcription factor KTR2 in the tolerance of rice to drought stress, mainly that the self-promoter overexpression material can increase the relative yield of rice under drought stress at the booting stage.
[0006] The purpose of the present application is achieved by the following technology:
[0007] Use of rice low potassium response transcription factor KTR2 in regulating the tolerance of rice to drought stress, the CDS sequence of the rice low potassium response transcription factor KTR2 is as shown in SEQ ID NO.1 (ATGGAGCTCAACTTCCAAGTGCAACCTCCAGTGTTCCAGCTGCAAGACTACTGCTACTACTACAGCCAAGAGGTGGCGGCGGCGGCGTCGCCGGCGGCGAAGCCGACGAAGCCGCGGGGGAGGAAGAAGGGCAGCACGAGCCACAGCAAGTTCGTCGGCGTCCGGCAGCGGCCGTCGGGGCGGTGGGTGGCGGAGATCAAGGACACGACGCAGAAGATCCGCATGTGGCTCGGCACCTTCGAGACCGCCGACGCCGCCGCGCGCGCCTACGACGAGGCCGCGCGCCTCCTCCGCGGCGCCGAGGCGCGCACCAACTTCGCGCCACGCATCTCGCCGGACTGCCCGCTCGCCGTCCGCATCCGCGGAATCCTCCACCACAAGAAGCTCAAGAAGGCCAGGTCCGCCGCCGCGGCCACGGCCGGCTCCCCCGGCGCCGCATCCAAGAAGAGGTCCACCACGGCGGCGGCGGCGGCGGCCACTCCGACGATCACAACCACAAGCAATAGCAATAGCGATGGTGCGGGTAGTGCTTGTGGTGGCTCGAGCAGCAGCAGCAGCAGCACGGACAGCTGCGACGGCGCCGTGAAGCAAGGCGGCGGCGGCGGCGGCGCACCAACGGACGCCAGCGAGGTGTACCGGCCGGACTTCGTCCACGCGGGCGCCGAGGAGTTCGATTCTTGGATGTTCGACACGGCGTTCGGCCCGTTCCCAGAGCTGGACAGCTTCGCCGCCGTCGACGCCGTCACGCCACCGCCAGCAACGGCGTCGCCGGAGGAGTCAAGCGCCGGCACGCCGCCGGTCGAGATGGCGGAGTTCGAGCGGATAAAGGTGGAGCGGCGGATCTCGGCGTCCCTGTACGCCATGAACGGCCTGCAGGAGTACTTCGACAAGGTGTTCGACGCGTCCGCCTGCGACCCGTTCTGGGATTTCTCGCCACTGTGCCATTAG).
[0008] As a preferred embodiment of the present application, overexpression of the rice low potassium response transcription factor KTR2 enhances the drought stress tolerance of rice at the booting stage.
[0009] As a further preferred embodiment of the present application, the enhanced drought stress tolerance of rice at the booting stage is selected from any one or more of the following:
[0010] (1) enhanced drought stress tolerance of rice at the seedling stage;
[0011] (2) increased potassium content of rice at the booting stage under drought stress;
[0012] (3) increased relative yield of rice at the booting stage under drought stress.
[0013] As a preferred embodiment of the present application, knocking out the rice low potassium response transcription factor OsKTR2 reduces the drought stress tolerance of rice at the seedling and booting stages.
[0014] The recombinant expression vector for overexpression of the rice low potassium response transcription factor OsKTR2 is used to improve the relative yield of rice under drought stress, and further improve the drought resistance of rice.
[0015] As a preferred embodiment of the present application, the recombinant expression vector is obtained by inserting the rice low potassium response transcription factor KTR2 into the SacI and PstI enzyme cutting sites of the starting vector pCAMBIA1305, then removing the Ubiquitin promoter by double enzyme digestion with EcoRI and SacI, and inserting the KTR2 gene's own promoter.
[0016] The recombinant expression vector for overexpression of the rice low potassium response transcription factor OsKTR2, characterized in that the recombinant expression vector is obtained by inserting the rice low potassium response transcription factor OsKTR2 as claimed in claim 1 into the SacI and PstI enzyme cutting sites of the starting vector pCAMBIA1305, then removing the Ubiquitin promoter by double enzyme digestion with EcoRI and SacI, and inserting the OsKTR2 gene's own promoter.
[0017] The vector for knocking out the rice low potassium response transcription factor OsKTR2 is used to reduce the relative yield of rice under drought stress, and ultimately leads to high sensitivity of rice to drought stress.
[0018] As a preferred embodiment of the present application, the vector for knocking out the rice low potassium response transcription factor OsKTR2 is a pYLCRISPR / Cas9-Pubi-B vector, primers are designed and synthesized according to the target sequences T1 (SEQ ID No. 2: GGTGGCGGCGGCGGCGTCGCCGG), T2 (SEQ ID No. 3: ACGAGCCACAGCAAGTTCGTCGG), T3 (SEQ ID No. 4: GCCGTCGGGGCGGTGGGTGGCGG) and T4 (SEQ ID No. 5: CAGAAGATCCGCATGTGGCTCGG) of OsKTR2, and then the primers are inserted into the BsaI enzyme cutting sites of the basic vector after annealing.
[0019] A vector for knocking out the rice low potassium response transcription factor OsKTR2, which is a pYLCRISPR / Cas9-Pubi-B vector, primers are designed and synthesized according to the target sequences T1 (SEQ ID No. 2: GGTGGCGGCGGCGGCGTCGCCGG), T2 (SEQ ID No. 3: ACGAGCCACAGCAAGTTCGTCGG), T3 (SEQ ID No. 4: GCCGTCGGGGCGGTGGGTGGCGG) and T4 (SEQ ID No. 5: CAGAAGATCCGCATGTGGCTCGG) of OsKTR2, and then the primers are inserted into the BsaI enzyme cutting sites of the basic vector after annealing.
[0020] Advantages of the present application:
[0021] 1. In the present application, a recombinant expression vector constructed by the rice low potassium response transcription factor KTR2 is first discovered in the world, which is transfected into wild-type rice Nipponbare (Oryza sativa.ssp.cv.Japonica) by Agrobacterium-mediated rice transgenic technology, and the KTR2 overexpression material significantly improves the tolerance to drought stress in the seedling stage compared with the wild-type rice.
[0022] 2. The KTR2 gene in the present application is derived from rice, and the promoter is also the sequence upstream of the KTR2 gene, which is not an exogenous gene, and thus has biological safety. The constructed rice low potassium response transcription factor KTR2 plant expression vector can be directly used for Agrobacterium-mediated plant genetic transformation to obtain new germplasm that can enhance the tolerance of rice to drought stress.
[0023] 3. The KTR2 gene in the present application can enhance the tolerance of rice to drought stress in the booting stage by improving the potassium holding of the sheath, thereby improving the relative yield of rice under drought stress. BRIEF DESCRIPTION OF DRAWINGS
[0024] Figure 1 Molecular identification and plant type screening of OsKTR2 transgenic rice materials
[0025] Figure A: Phenotype of wild type rice WT and OsKTR2 own promoter overexpression material Pro-KTR2; Figure B: Expression amount of OsKTR2 in Pro-KTR2 relative to WT; Figure C-D: Biomass of root and aboveground part of WT and Pro-KTR2 materials.
[0026] Figure 2 KTR2 expression is up-regulated by mannitol and ABA stress induction
[0027] Figure A-B: Expression amount of KTR2 gene in root and aboveground part respectively at different time points after 120.4 g L -1 Figure C-D: Expression amount of KTR2 gene in root and aboveground part respectively at different time points after 30 μΜ ABA stress.
[0028] Figure 3 KTR2 expression in different tissues of rice is up-regulated by drought stress induction
[0029] Figure 4 Difference in drought stress tolerance of KTR2 knockout and corresponding wild type materials at seedling stage
[0030] Figure 5 Leaf rolling phenotype of KTR2 own promoter overexpression, knockout and corresponding wild type materials under drought stress
[0031] Figure 6 Yield of KTR2 own promoter overexpression, knockout and corresponding wild type materials under drought stress Figure A: Single plant yield of WT and KTR2 overexpression and knockout materials under drought stress; Figure B: Relative single plant yield of WT and KTR2 overexpression and knockout materials under drought stress.
[0032] Figure 7 Potassium content in different tissues of KTR2 transgenic and corresponding wild type materials under drought stress Figure A: Potassium content in root of WT and KTR2 overexpression and knockout materials under drought stress; Figure B: Potassium content in stem and leaf sheath of WT and KTR2 overexpression and knockout materials under drought stress; Figure C: Potassium content in leaf of WT and KTR2 overexpression and knockout materials under drought stress.
[0033] Figure 8 Map of pCAMBIA1305 expression vector.
[0034] Figure 9, pYLCRISPR / Cas9-Pubi-B basic vector map. DETAILED DESCRIPTION
[0035] Example 1. Cloning of OsKTR2 gene
[0036] 1. Template: Extract RNA from normal water-cultured 2-week-old Nipponbare (NB) wild-type rice leaves and reverse transcribe into cDNA as a template for cloning OsKTR2-CDS sequence.
[0037] 2. PCR primer design: Find the gene sequence of OsKTR2 on the NCBI website (https: / / www.ncbi.nlm.nih.gov / ), and design primers using the primer design software Primer 5.0. Add SacI (GAGCTC) and PstI (CTGCAG) enzyme digestion site sequences to the 5' and 3' ends of the primers, and then add a sequence on the pCAMBIA1305 plasmid vector to form a 41 bp homologous recombination primer (F1 and R1).
[0038] Upstream primer F1:
[0039] 5'-ATTTACGAACGATAG GAGCTC ATGGAGCTCAACTTCCAAGT-3';
[0040] Downstream primer R1:
[0041] 5'-GTGATTTTTGCGGAC CTGCAG CTAATGGCACAGTGGCGAGA-3'.
[0042] 3. OsKTR2 gene PCR amplification: PCR Buffer 2 μl, dNTP Mix 2 μl, 1 μl of upstream and downstream primers, 1 μl of template, KOD high-fidelity enzyme 1 μl, and 13 μl of double-distilled water. The PCR amplification program is as follows: 94°C pre-denaturation for 5 min, 94°C denaturation for 30 s, 62°C annealing for 30 s, 72°C recombination extension for 1 min, 35 cycles, and 72°C for 10 min for full extension,
[0043] 10°C. The amplified PCR product was detected by 1% agarose gel electrophoresis. The size of OsKTR2 gene was 948 bp. Example 2. Construction of plant recombinant expression vector pCAMBIA1305-OsKTR2 and obtaining of transgenic rice material 1. Construction of OsKTR2 gene expression vector: pCAMBIA1305 plasmid vector was digested with Sac I and Pst I, and the linearized expression vector was recovered by gel recovery, and then subjected to homologous recombination with the PCR linear product containing OsKTR2. The homologous recombination product was transformed into E. coli DH5a competent cells, and after antibiotic screening, positive single clones were picked and stored. The E. coli plasmid was extracted and sent to a company for sequencing. After correct sequencing, the pCAMBIA1305-OsKTR2 intermediate vector containing the Ubiquitin strong promoter was obtained. On this basis, the vector was double-digested with EcoRI (GAATTC) and Sac I (GAGCTC) to obtain a pCAMBIA1305 intermediate vector carrying the OsKTR2 gene but without the Ubiquitin promoter, and the digested product was recovered by gel recovery. According to the OsKTR2 gene promoter sequence, a 1964 bp sequence was extracted, and a pair of homologous recombination primers (F2 and R2) for amplifying the OsKTR2 gene promoter was designed by using software Primer 5.0. EcoRI (GAATTC) and Sac I (GAGCTC) enzyme digestion site sequences were added to the 5' and 3' ends of the primers, and a sequence on the pCAMBIA1305 plasmid vector was added. The wild-type Nipponbare rice gDNA was used as a template to obtain the linear fragment of the target promoter by PCR technology, and after verification, the homologous recombination vector was subjected to homologous recombination with the pCAMBIA1305-OsKTR2 linear vector without the Ubiquitin promoter. The homologous recombination product was transformed into E. coli DH5a competent cells, and after antibiotic screening, positive single clones were picked and stored. The E. coli plasmid was extracted and sent to a company for sequencing. After correct sequencing, the pCAMBIA1305-OsKTR2 recombinant expression vector was obtained, which was transformed into EHA105 Agrobacterium competent cells by electroporation method, and after antibiotic screening, positive clones were picked. The E. coli was extracted and the plasmid was extracted. After sequencing verification, the Agrobacterium liquid was added to an equal volume of 30% glycerol and stored at -70°C. The bacterial liquid was stored in the refrigerator at -70°C, and was used for subsequent experiments.
[0044] Upstream primer F2:
[0045] 5'-TATGACCATGATTAC GAATTC TTGTGGGATAGTAAACGAGA-3';
[0046] Downstream primer R1:
[0047] 5'-GGATCCCCGGGTACC GAGCTC GTGTTTGTGTGTGAGCTTGT-3'.
[0048] 2. Obtaining of transgenic rice: The above obtained Agrobacterium carrying pCAMBIA1305-OsKTR2 self promoter overexpression vector was used to infect rice callus, and after co-cultivation (dark culture) for 2.5 days, the bacteria were washed, and the dried callus was transferred to a selection medium containing 500 mg / L carbenicillin and 50 mg / L hygromycin for the first round of selection culture, and cultured at 28°C under light for 2 weeks. The resistant callus was transferred to a selection medium containing 500 mg / L carbenicillin and 80 mg / L hygromycin for the second round of selection culture, and cultured at 28°C under light until granular resistant callus grew. The yellowish resistant callus from the same callus was transferred to a plastic wide-mouth bottle containing differentiation medium for differentiation culture, and waited for differentiation into seedlings (25-30d). When the seedlings grew to about 2-3 cm, they were placed in rooting medium for seedling strengthening. The differentiated seedlings were picked out from the rooting tube, and an appropriate amount of sterile water was added for seedling training for one week. The root agar medium was washed away, and the seedlings were transplanted into rice nutrient solution for growth and positive seedling identification. The positive seedlings were transferred to the field for harvesting to obtain T1 generation transgenic seeds. The culture medium used is prior art.
[0049] 3. Identification of overexpression effect of OsKTR2 transgenic rice material: The above obtained OsKTR2 overexpression strain T1 generation transgenic seeds and Nipponbare wild type rice seeds were sown by water method. Healthy seeds were selected, soaked in 30% sodium hypochlorite solution for 30 minutes, then rinsed with water for 5 times, and then placed in a paper cup covered with 20 mesh nylon net, half of the seeds were immersed in water, and then the whole was placed in a 37°C oven for germination for 24-36h. Ten days after germination, GUS staining identification was performed on all overexpression strains, and the positive seedlings were moved to a turnover box for water culture. After 2 weeks of culture with full IRRI nutrient solution, a part of the seedlings were selected, and total RNA was extracted from the tissues of OsKTR2 gene overexpression strains and wild type Nipponbare wild type rice using Trizol reagent. cDNA was obtained by reverse transcription, which was used as a template to identify the expression amount of OsKTR2 gene at the transcription level by RT-qPCR. The internal reference and OsKTR2 gene primers for RT-qPCR are shown in Table 1. Another part of the seedlings was used for selection of plant type, and the biomass of all plants was counted. Figure 1 Among the 9 OsKTR2 overexpression seedlings detected (A), the expression amount of OsKTR2 was up-regulated to different degrees (B), in addition, the root dry weight (C) and shoot dry weight (D) of these overexpression seedlings were also increased. Figure 1 Figure 1 Figure 1 Figure 1 D) No obvious difference with wild type. Based on the expression level of OsKTR2 and dry weight of seedlings, we selected 3 representative lines from the 9 overexpression seedlings and named them as Pro1, Pro2 and Pro3 for the following physiological experiments.
[0050] Table 1 Primer sequences of OsActin and OsKTR2 for RT-qPCR
[0051]
[0052] Example 3. Construction of KTR2 knockout materials and homozygote identification
[0053] 1. Construction of KTR2 knockout vector and obtaining of transgenic rice: According to the appendix of the article published by Miao et al. (2013), the Spacer sequence of KTR2 was designed using the Spacer design website (http: / / crispr.tefor.net / ), and the sequence with better cutting efficiency and specificity score was selected as the candidate target for related primer design. Target sequences T1 (SEQ ID No. 2: GGTGGCGGCGGCGGCGTCGCCGG), T2 (SEQ ID No. 3: ACGAGCCACAGCAAGTTCGTCGG), T3 (SEQ ID No. 4: GCCGTCGGGGCGGTGGGTGGCGG) and T4 (SEQ ID No. 5: CAGAAGATCCGCATGTGGCTCGG). The designed F and R primers (Table 2) were sent to Jinweizhi Company for synthesis, and the dry powder of the obtained primers was centrifuged, diluted, and mixed before use. An equal volume of the mixed F and R primers was centrifuged and placed in a PCR instrument, and a temperature gradient program (95°C, 2 min; 72°C, 2 min; 55°C, 2 min; 45°C, 2 min; 37°C, 2 min; 25°C, 2 min; 15°C, ∞) was set to obtain annealed double-stranded products. The expression vector containing the U6a::sgRNA backbone linearized by BsaI endonuclease and the annealed double-stranded product were subjected to enzyme ligation reaction by T4 ligase to obtain the U6a::Spacer::sgRNA expression vector. The ligation product was transformed into competent Escherichia coli DH5α, and overnight culture was performed on the medium containing the corresponding antibiotic. Single colony was selected and sent to Jinweizhi Company for Sanger sequencing verification. After correct sequencing alignment, the plasmid was extracted and stored at -20°C for standby use. According to the same construction method, the U3::Spacer::sgRNA expression vector was obtained. Finally, different U::Spacer::sgRNA expression cassettes were assembled into the pYLCRISPR / Cas9-Pubi-B expression vector by Golden Gate cloning strategy to obtain the final gene targeting vector. In the same way, the gene targeting vector was transformed into competent Escherichia coli DH5α, and the positive clones required were obtained after antibiotic screening. The plasmid of the positive bacteria was extracted and transformed into EHA105 competent Agrobacterium, and the KTR2 knockout transgenic plants required were finally obtained by Agrobacterium infection of rice callus.
[0054] Table 2 Primers for KTR2 knockout using CRISPR-Cas9 system
[0055]
[0056] 2. Identification and plant type screening of KTR2 knockout material homozygous: KTR2 knockout lines need two rounds of PCR detection. First, extract gDNA samples of mutant materials and corresponding wild type, the first round uses Cas9 universal primers (Table 3) to verify the Cas9 sequence, the second round uses KTR2-CRISPR-F / R primers (Table 3) to amplify the gDNA of transgenic lines as a template, the product is sent to the company for sequencing, and homozygous knockout materials are selected. Through sequencing verification of mutant materials, we obtained 10 KTR2 knockout homozygous lines. Further through physiological and quantitative experimental data, we selected two phenotypically similar lines and named them ktr2-1 and ktr2-2 to carry out subsequent experiments.
[0057] Table 3 KTR2 knockout material identification primers
[0058]
[0059] Example 4. Identification of rice KTR2 response to environmental stress such as drought using RT-qPCR technology
[0060] In order to explore the response of KTR2 gene to environmental stress, we performed different environmental stresses on 10d old Nipponbare wild type rice, and took root and aboveground samples for RT-qPCR analysis of KTR2 expression pattern, with untreated samples as control group. The specific steps of RT-qPCR are as follows: according to the instructions of TaKaRa kit, use 10μL reaction system: SYBR Premix Ex Taq 5μL, 0.2μL of upstream and downstream primers, 50×ROX Reference Dye 0.2μL, ddH2O 2.4μL, diluted cDNA template 2μL. Reaction conditions: 95℃ 5min, 95℃ 5s, 60℃ 30s, 40 cycles; 95℃ 15s, 60℃ 1min, 95℃ 15s. The quantitative results are calculated according to the C T (Threshold Cycle) value of the internal reference gene and the gene to be detected. -ΔCt Method. The RT-qPCR internal reference and KTR2 gene quantitative primers are shown in Table 1.
[0061] The experimental results show that the expression of KTR2 is induced and up-regulated by drought and other stresses. When treated with 120.4g L -1 Mannitol for 12h and 24h, the expression of KTR2 reaches about 3-10 times that of WT Figure 2A-B). When treated with 30uM of ABA (abscisic acid) for 24h and 72h, the expression of KTR2 was significantly up-regulated, reaching 2-5 times of WT, while the expression of KTR2 in roots was only about 1 / 2 of WT when treated with ABA for 3h and 6h Figure 2 C-D). Meanwhile, we detected the expression of KTR2 in each tissue of the booting stage potted seedlings under drought stress for 7d, reaching about 100 times of WT Figure 3 ), indicating that the expression of KTR2 was induced by environmental stress such as drought.
[0062] Example 5 Water loss test of wild type and transgenic rice seedlings
[0063] We found that the expression of KTR2 was up-regulated in response to drought and abscisic acid stress by RT-qPCR experiment. To further explore the role of KTR2 in controlling the tolerance of rice to drought stress, we first conducted a water loss test of rice seedlings. After 10-day-old transgenic and wild type rice seedlings were cultured in 1mM K + IRRI nutrient solution for 4 weeks, they were subjected to water loss treatment for 2.5h. When the leaves of KTR2 knockout materials were completely curled, the transgenic and wild type rice seedlings were put back into 1mM K + IRRI nutrient solution for 12h. The survival rate of KTR2 knockout materials and the corresponding wild type rice seedlings was counted. The results showed that compared with the wild type, the survival rate of KTR2 knockout lines after restoring water supply was only about 50% of the wild type Figure 4 ), resulting in a significant decrease in the tolerance of rice seedlings to drought stress.
[0064] Example 6 Tolerance test of wild type and transgenic rice to drought stress at booting stage
[0065] To further explore the role of KTR2 in controlling drought tolerance in rice at booting stage, we performed drought stress experiment at booting stage. First, we prepared several 20L buckets, each containing 19kg of mixed soil and sand, and applied 12,5g of base fertilizer (N, P2O5 and K2O each 2g) for use. KTR2 overexpression, knockout and wild type rice seedlings at 10 days old were cultured in normal nutrient solution for 2-4 weeks, and then transplanted into the buckets, 3 seedlings per bucket. Drought stress treatment was started at the early booting stage, and the drought stress was repeated until all leaves of the drought stress plants were rolled up (this usually occurs at noon, when the soil water content is about 72-75%). After 24h of water supply, the second round of drought stress treatment was performed, and the leaf rolling degree of KTR2 overexpression, knockout and wild type rice was observed and counted. The results showed that when the wild type rice was subjected to drought stress, the leaves of the KTR2 overexpression plants were completely stretched, while the leaves of the KTR2 knockout plants were completely stretched when the wild type rice leaves were completely rolled up. Figure 5
[0066] After two rounds of drought stress treatment, the plants were normally cultured until maturity, and the agronomic statistics of KTR2 overexpression, knockout and wild type rice were performed. The results showed that after drought stress, the relative yield of KTR2 overexpression plants was about 20-30% higher than that of the wild type ( Figure 6 ). This indicates that KTR2 overexpression enhances the drought tolerance of rice under drought stress, resulting in an increase in the relative yield of the crop under drought stress. The phenotype of KTR2 knockout plants is opposite to that of KTR2 overexpression plants, i.e., KTR2 knockout leads to a significant decrease in the relative yield of rice compared to the wild type ( Figure 6 ).
[0067] By detecting the K + content in the roots, leaves, stems and leaf sheaths of KTR2 overexpression, knockout and WT plants at maturity under drought stress, the results showed that the K + content in the stems and leaf sheaths of KTR2 overexpression plants was significantly higher than that of the wild type, about 23%, and the K + content in the stems and leaf sheaths of KTR2 knockout plants was significantly lower than that of the wild type, about 14% ( Figure 7 ).
[0068] The above results show that KTR2 overexpression enhances the K + uptake of rice stems and leaf sheaths, and improves the drought tolerance of rice at booting stage, while knockout leads to high sensitivity of rice to drought stress at booting stage.
Claims
1. Overexpression of rice low-potassium response transcription factor OsKTR2 Its application in enhancing the tolerance of rice to drought stress is characterized by, The rice low-potassium response transcription factor OsKTR2 The CDS sequence is shown in SEQ ID NO.
1.
2. The application according to claim 1, characterized in that, Overexpression of rice low-potassium response transcription factor OsKTR2 It will enhance the tolerance of rice seedlings and booting stages to drought stress.
3. Overexpression of the rice low-potassium response transcription factor as described in claim 1 OsKTR2 The application of recombinant expression vectors in improving the drought resistance of rice, thereby increasing the relative yield of rice under drought stress.
4. The application according to claim 3, characterized in that, The recombinant expression vector is the rice low-potassium response transcription factor described in claim 1. OsKTR2 Inserted into the launch carrier pCAMBIA1305 Sac I and Pst After the I restriction site is used EcoR I and Sac I. Double enzyme digestion Ubiquitin Startup and Insertion OsKTR2 Obtained from the gene's own promoter.