Breeding method of large-seed and high-oil brassica napus

Abstract

The invention discloses a breeding method of large-seed and high-oil type brassica napus L. The disclosed method comprises the following steps: knocking out a BnaWIP2 gene in brassica napus L., so that the BnaWIP2 gene is mutated to obtain the large-seed and high-oil type brassica napus L.. According to the method, six copies of the BnaWIP2 gene are knocked out at the same time, the large-seed and high-oil brassica napus CRISPR / Cas9 gene editing material is obtained, and the gene editing material provides precious gene resources and germplasm resources for breeding of high-oil and high-yield brassica napus varieties.

Description

Technical Field

[0001] The invention belongs to the field of plant genetic engineering and biotechnology, and relates to a method and application of site-directed mutagenesis of the BnaWIP2 gene of Brassica napus, and in particular to a gene editing material of Brassica napus based on CRISPR / Cas9. Background Art

[0002] Edible oil is an important strategic material related to the national economy and people's livelihood, and is an important component of food security. At present, more than 65% of my country's edible oil consumption depends on imports, and the national edible oil supply security risks are prominent (Yan Maolin, Shi Wenhua, Zhou Xiaoliang, et al. 2023, Research on the safety of my country's major vegetable oil and fat industry based on the perspective of imports. Chinese Journal of Oil Crops, 45(4): 643-653). Rapeseed is my country's largest oil crop, with an annual planting area of ​​about 120 million mu. It is the largest source of domestic edible vegetable oil, accounting for more than 55% of the oil production of domestic oil crops, and plays an irreplaceable role in ensuring the safety of my country's edible oil (Wang Hanzhong. 2018, Rapeseed industry development strategy guided by new demands. Chinese Journal of Oil Crops, 40(5): 613-617). However, my country's average per mu yield and rapeseed oil content are still far behind those of major foreign producing areas such as the European Union and Canada.

[0003] Rapeseed oil production is mainly determined by seed oil content and yield. Studies have shown that a 1% increase in seed oil content is equivalent to a 2.5% increase in yield (Li Dianrong, Zheng Lei, Li Shaoqin. 2014, Analysis of changes in yield and oil content of new winter rapeseed varieties in my country over the past thirteen years. Seeds, 33(2):96-100). Seed size and grain weight are important factors in yield composition, with advantages such as strong environmental stability and high heritability. Therefore, synergistically improving seed size, grain weight and oil content is an important way to significantly increase rapeseed oil production.

[0004] The zinc finger protein transcription factor family is one of the largest transcription factor families in plants and plays an important role in plant growth, development and nutritional metabolism (Han G., Li Y., Qian Z., et al., 2021, Advances in the regulation of epidermal cell development by C2H2 Zinc finger proteins in plants. Frontiers in Plant Science, 12: 754512). Arabidopsis AtWIP2 belongs to the C2H2 zinc finger protein family transcription factor. Studies have shown that AtWIP2 is a gene required for transmitting-tract development in carpels of Arabidopsis thaliana. AtWIP2 mutations can seriously affect pollen tube development, resulting in a 30% shorter length of mature fruit than the wild type, significantly larger seeds, and a 60% decrease in seed number (Crawford BCW, Ditta G., Yanofsky MF2007, The NTT gene is required for transmitting-tract development in carpels of Arabidopsis thaliana. Current Biology, 17(13):1101-1108; Marsch-Martínez N., -Mayo VM, Herrera-Ubaldo H., et al., 2014, The NTT transcription factor promotes replum development in Arabidopsis fruits. Plant Journal, 80: 69-81). Gain-of-function mutants of AtWIP2 and overexpression of AtWIP2 both inhibit the dehiscence of siliques (Chung KS, Lee JH, Lee J Set al., 2013, Fruit dehiscence caused by enhanced expression of NO TRANSMITTING TRACT in Arabidopsis thaliana. Molecular and Cells, 35: 519-525). AtWIP2 also interacts with the MADS-box transcription factor AtSTK (SEEDSTICK), co-targets the KAWAK gene, and regulates the expression of genes related to cell wall polysaccharides and lipid deposition, thereby determining the reproductive capacity of the plant (Herrera-Ubaldo H., Lozano-Sotomayor P., Ezquer I. et al., 2019, New roles of NO TRANSMITTING TRACT and SEEDSTICK during medialdomain development in Arabidopsis fruits. Development, 146: dev. 172395). In addition, studies have found that AtWIP2 redundantly mediates auxin signaling with AtWIP4 and AtWIP5 to regulate the initiation of Arabidopsis root apical meristems (Crawford BCW, Sewell J., Golembeski G. et al., 2015, Genetic control of distal stem cell fate within root and embryonic meristems. Science, 347: 655-659).

[0005] As an allotetraploid crop, Brassica napus has a complex genome with many homologous copies. Different homologous copies often have gene redundancy and gene additive effects (Schranz, ME, Lysak, MA, Mitchell-Olds, T. et al., 2006, The ABC's of comparative genomics in the Brassicaceae: building blocks of crucifer genomes. Trends in Plant Science, 11: 535-542). Traditional hybrid breeding is time-consuming and inefficient. Mutation breeding is blind, the direction of mutagenesis is uncontrollable, and there are few favorable mutations. Summary of the invention

[0006] In view of the defects or shortcomings of the prior art, the present invention provides a breeding method for large-seed and high-oil Brassica napus.

[0007] To this end, the present invention provides a method for breeding large-grain, high-oil Brassica napus, comprising knocking out the BnaWIP2 gene in the Brassica napus to obtain a large-grain, high-oil Brassica napus by causing the BnaWIP2 gene to mutate;

[0008] The BnaWIP2 gene includes BnaA04.WIP2 gene, BnaA07.WIP2 gene, BnaA09.WIP2 gene, BnaC04.WIP2 gene, BnaC06.WIP2 gene and BnaC08.WIP2 gene;

[0009] The BnaA04.WIP2 gene sequence is shown in SIQ ID NO.1, the BnaA07.WIP2 gene sequence is shown in SIQ ID NO.2, the BnaA09.WIP2 gene sequence is shown in SIQ ID NO.3, the BnaC04.WIP2 gene sequence is shown in SIQ ID NO.4, the BnaC06.WIP2 gene sequence is shown in SIQ ID NO.5, and the BnaC08.WIP2 gene sequence is shown in SIQ ID NO.6.

[0010] An optional solution is to use CRISPR / Cas9 gene editing technology to knock out the BnaWIP2 gene in Brassica napus. In a further solution: the method comprises:

[0011] Step 1, constructing a BnaWIP2 gene CRISPR / Cas9 expression vector and an Agrobacterium strain containing the BnaWIP2 gene CRISPR / Cas9 expression vector;

[0012] Step 2: Genetically transforming Brassica napus varieties based on the Agrobacterium-mediated method, and obtaining multiple gene-edited mutant plants through hygromycin resistance screening;

[0013] Step three: Select plants with large seeds and high oil content from multiple gene-edited mutant plants.

[0014] An optional scheme is that the sgRNA sequence sgR-BnaWIP2 of the BnaWIP2 gene in the above step one is 5'-TACTCAGTTCTCTTGTCCTG-3'. The upstream primer sgR-BnaWIP2-F of sgR-BnaWIP2 in the above step one is: 5'-ATTGCAGGACAAGAGAACTGAGTA-3'; the downstream primer sgR-BnaWIP2-R of sgR-BnaWIP2 is: 5'-AAACTACTCAGTTCTCTTGTCCTG-3'. In the above step two, the Brassica napus variety is genetically transformed based on the Agrobacterium-mediated method, and multiple gene-edited mutant plants are obtained by hygromycin resistance screening;

[0015] The CRISPR / Cas9-based Brassica napus gene editing material of the present invention uses CRISPR / Cas9 gene editing technology to simultaneously knock out 6 copies of the BnaWIP2 gene to obtain a Brassica napus CRISPR / Cas9 gene editing material with large grains and high oil content. These gene editing materials provide valuable gene resources and germplasm resources for the breeding of high-oil and high-yield varieties of Brassica napus. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 Agarose gel electrophoresis results for identification of BnaWIP2-Cas9 gene editing materials. Const represents the BnaWIP2-Cas9 plasmid, which is the positive control of the experiment; Westar represents the wild-type receptor, which is the negative control of the experiment.

[0017] Figure 2 The BnaWIP2 gene and the sequencing results of the related BnaWIP2 homozygous mutants in the embodiments; wherein, Figure 2 A is a schematic diagram of the 6-copy CRISPR / Cas9 target sites of the BnaWIP2 gene;

[0018] Figure 2 B is the sequencing result of the BnaWIP2 homozygous mutant BnaWIP2-Cas9#4 strain in the target site region; Figure 2 C is the sequencing result of the BnaWIP2 homozygous mutant BnaWIP2-Cas9#5 strain in the target site region.

[0019] Figure 3The results of the analysis of mature seeds, seed weight, total fatty acid content and fatty acid component content of seeds of the relevant BnaWIP2 mutants in the examples; wherein, Figure 3 A is a photo of mature seeds of Brassica napus variety Westar (wild type) and BnaWIP2 mutants BnaWIP2-Cas9#4 and BnaWIP2-Cas9#5; Figure 3 B is a bar chart showing the seed quality of Brassica napus variety Westar (wild type) and BnaWIP2 mutants BnaWIP2-Cas9#4 and BnaWIP2-Cas9#5; Figure 3 C is a bar chart showing the total fatty acid content in seeds of Brassica napus variety Westar (wild type) and BnaWIP2 mutants BnaWIP2-Cas9#4 and BnaWIP2-Cas9#5; Figure 3 D is a bar chart showing the contents of various components of seed fatty acids in the Brassica napus variety Westar (wild type) and the BnaWIP2 mutants BnaWIP2-Cas9#4 and BnaWIP2-Cas9#5. DETAILED DESCRIPTION

[0020] First of all, it should be noted that in the following examples, the reagents used are all from commercial channels unless otherwise specified, and the test methods, detection methods, etc. involved, unless otherwise specified, are all conventional test methods and detection methods already available in the prior art.

[0021] Specific embodiments of the present invention are given below. It should be noted that the present invention is not limited to the following specific embodiments, and all equivalent changes made on the basis of the technical solution of this application fall within the protection scope of the present invention.

[0022] In the following examples, the Brassica napus variety "Westar" known in the prior art was used. The reagents and materials used in the following examples are all commercially available products.

[0023] In order to analyze the effect of the BnaWIP2 gene of Brassica napus on seed development and seed oil accumulation, this example uses CRISPR / Cas9 gene editing technology to simultaneously knock out 6 copies of the BnaWIP2 gene of Brassica napus (BnaA04.WIP2, BnaA07.WIP2, BnaA09.WIP2, BnaC04.WIP2, BnaC06.WIP2 and BnaC08.WIP2), thereby obtaining gene-edited materials of Brassica napus with enlarged seeds and increased fatty acid content.

[0024] CRISPR / Cas9 is a site-directed editing technology that uses RNA to guide the Cas9 protein nuclease to cut the target gene at a specific site, and mutants created using CRISPR / Cas9 can remove the vector through self-fertilization.

[0025] Example 1: Construction of CRISPR / Cas9 expression vector of Brassica napus BnaWIP2 gene

[0026] 1.1 Selection of sgRNA target sites and synthesis of upstream and downstream primers

[0027] In the previous study, the inventors used bioinformatics analysis methods to find multiple homologous genes of AtWIP2 in the Brassica napus variety Westar, and named them BnaA04.WIP2, BnaA07.WIP2, BnaA09.WIP2, BnaC04.WIP2, BnaC06.WIP2 and BnaC08.WIP2 according to their different chromosome locations. The full-length coding region nucleic acid sequences of the six copies of the BnaWIP2 gene in the Brassica napus variety Westar are shown in SIQ ID NOs. 1 to 6.

[0028] According to the structure and homology of the six copies of the BnaWIP2 gene in the Brassica napus variety Westar, a sgRNA sequence was designed on the first exon of the BnaWIP2 gene based on the CRISPRdirect website (http: / / crispr.dbcls.jp / ), and the selected sequence was 5'-TACTCAGTTCTCTTGTCCTG-3', such as Figure 1 shown.

[0029] This sgRNA sequence is synthesized into a pair of adapter primers for constructing a CRISPR / Cas9 expression vector.

[0030] According to the sgRNA sequence, the adapter primers shown in Table 1 (named BnaWIP2-sgRNA-F and BnaWIP2-sgRNA-R) were designed, and the first 4 bases of the adapter primers were the sticky ends of the AarI restriction endonuclease.

[0031] Table 1 Primer sequence list

[0032] Primer name Primer sequence (5'-3') BnaWIP2-sgRNA-F ATTGCAGGACAAGAGAACTGAGTA BnaWIP2-sgRNA-R AAACTACTCAGTTCTCTTGTCCTG Cas9-F CTGTGGTTGGCATGCACATAC Cas9-R ACCACTCATCATAGCTCCGC BnaA04.WIP2-genotyping-F TCGCCGTCCACCACCTACTA BnaA04.WIP2-genotyping-R CACAAAGATATATTAGAGTGGTTT BnaA07.WIP2-genotyping-F AGGCCTTCCAAGCCCTAGTA BnaA07.WIP2-genotyping-R TCGAGGAAACTAAGTGAGCATGT BnaA09.WIP2-genotyping-F CTCAACTAGCCCTTCGCCTC BnaA09.WIP2-genotyping-R CGAGGAAACTTAGTGAGCAAACA BnaC04.WIP2-genotyping-F CGTCAACAAACAACAAAATTA BnaC04.WIP2-genotyping-R GACGAATGAGTTAATCGTTAT BnaC06.WIP2-genotyping-F ATCACGATGACCATGACCATGAC BnaC06.WIP2-genotyping-R GATATAGTCATTTACGTATGCA BnaC08.WIP2-genotyping-F CTCCATCCTTGTGTCTTCTTGT BnaC08.WIP2-genotyping-R AGGAAACTTAGTGAGCAAACAA

[0033] 1.2 Obtaining double-stranded gDNA:

[0034] The above two pairs of adapter primers were sent to Shanghai Sangon Biotechnology Co., Ltd. for primer synthesis. The synthesized adapter primers were diluted to 10 μM, and 10 μL of each pair of primers were mixed and added to a PCR tube and incubated at 95°C for 5 min to synthesize double-stranded gDNA for subsequent vector construction.

[0035] 1.3 Connection of double-stranded gDNA and CRISPR / Cas9 vector:

[0036] The CRISPR / Cas9 plasmid was digested with AarI restriction endonuclease in a 37°C constant temperature incubator for 10 hours. The digestion reaction system is shown in Table 2:

[0037] Table 2 Enzyme digestion reaction system

[0038] Component Volume 10×BufferAarI 2μL CRISPR / Cas9 Plasmids 15μL 50×oligonucleotide 0.4μL Aa 1μL Nuclease-free water 1.6μL Total 20μL

[0039] After the enzyme digestion reaction, the enzyme digestion product was purified according to the OMEGA gel recovery kit, and the product concentration and quality were detected using NanoDropND-1000. The enzyme-cleaved and purified CRISPR / Cas9 linearized plasmid and the above double-stranded gDNA were added to the PCR tube and incubated at 16°C for 5-6 hours for T4 ligation. The ligation reaction system is shown in Table 3:

[0040] Table 3: Ligation reaction system

[0041] Component Volume 10× T4 DNA Ligase Buffer 2μL T4 DNA Ligase 1μL ds-gDNA 10μL Plasmid fragment 3μL <![CDATA[ddH 2 The]]> 4μL Total 20μL

[0042] 1.4 Heat shock transformation of Escherichia coli and identification of expression vector

[0043] Add the above T4 ligation product to E. coli competent cells DH5α, gently pipette to mix, place on ice for 20 minutes, place in a 42°C water bath for 90 seconds, quickly place on ice for 2 minutes, add 700 μL of LB culture medium, place in a 37°C shaker for shaking culture for 30 minutes, then spread the bacterial solution on an LB solid culture medium plate containing 100 ug / ml spectinomycin, and invert at 37°C incubator overnight.

[0044] Pick a monoclonal colony for PCR, and use the primers Cas9-F and BnaWIP2-sgRNA-R shown in Table 1 for colony PCR verification. The monoclonal PCR reaction system is shown in Table 4, and the PCR reaction conditions are shown in Table 5:

[0045] Table 4: Monoclonal PCR reaction system

[0046] Component Volume 2×rTaq Mix 7.5μL Forward Primer 1μL Reverse Primer 1μL Monoclonal colonies 1μL <![CDATA[ddH 2 The]]> 4.5μL Total 15μL

[0047] Table 5: PCR reaction conditions

[0048]

[0049] After the PCR reaction, the product was verified by 1% agarose gel electrophoresis. Three colonies with the correct PCR detection band size were selected and added to LB liquid culture medium containing 100ug / ml spectinomycin. After pipetting and mixing, they were placed in a 37℃ / 220rpm shaker for overnight culture. The monoclonal bacterial solution was selected and sent to Shanghai Sangon Biotechnology Co., Ltd. for sequencing. The monoclonal bacterial solution with the correct sequencing results was subjected to plasmid extraction using the OMEGA plasmid extraction kit, and the CRISPR / Cas9 gene editing vector of BnaWIP2 was successfully constructed.

[0050] 1.6 Agrobacterium transformation

[0051] 5 μL of the successfully constructed BnaWIP2 CRISPR / Cas9 gene editing vector was added to Agrobacterium competent cells GV3101, gently pipetted and mixed, and placed on ice for 30 minutes. After quick freezing in liquid nitrogen for 5 minutes, it was immediately placed in a 37°C water bath for incubation for 5 minutes. After the incubation, it was placed on ice for 3 minutes, 700 μL of LB culture solution (containing 25ug / ml rifampicin) was added, and it was placed in a 28°C shaker for shaking culture for 2 hours. The bacterial solution was spread on an LB solid culture medium plate containing 100ug / ml spectinomycin and 25ug / ml rifampicin, and inverted in a 28°C constant temperature incubator overnight. Single clone colony PCR was picked, and colony PCR verification was performed using the primers Cas9-F and BnaWIP2-sgRNA-R shown in Table 1. The PCR reaction system is shown in Table 4, and the PCR reaction conditions are shown in Table 5.

[0052] Pick three positive colonies detected by PCR and add them to LB liquid culture medium containing 100ug / ml spectinomycin and 25ug / ml rifampicin respectively. After pipetting and mixing, place them in a shaker at 28℃ / 220rpm for shaking culture. Finally, store the bacterial liquid of the positive strain in 33% glycerol and store it at -80℃.

[0053] Example 2: Acquisition and identification of CRISPR / Cas9 gene-edited mutants of the BnaWIP2 gene of Brassica napus

[0054] The CRISPR / Cas9 gene editing vector constructed above was used for rapeseed genetic transformation based on plant tissue culture combined with Agrobacterium-mediated genetic transformation method to obtain two hygromycin-resistant CRISPR / Cas9 gene-edited mutant rapeseed lines.

[0055] The specific operations of rapeseed genetic transformation and positive seedling identification are as follows: Westar seeds are selected for disinfection, and the disinfected rapeseed seeds are inoculated on MS culture medium. After culturing for 7 days, the sterile seedlings are taken out with tweezers in the clean bench, the cotyledon petioles and cotyledon tips are removed, and the hypocotyls are cut into small segments of 1 to 2 cm as explants, which are placed on pre-culture culture medium for pre-culture. After 3 days, the activated Agrobacterium containing the BnaWIP2 CRISPR / Cas9 gene editing vector is inoculated into the Agrobacterium suspension, and the OD value is adjusted to about 0.2. The pre-cultured rapeseed explants were infecting in an Agrobacterium suspension for 10 minutes, then placed on a filter paper board to dry, and the infected explants were placed on a co-cultivation medium. Two days later, the explants were transferred to a screening medium for 7 days, and effective callus tissue was selected and transferred to a screening medium containing hygromycin for screening for about 15 days. The screening was repeated 2 to 3 times, and the vigorously growing positive callus tissue was transferred to a differentiation medium and waited for it to differentiate into seedlings. The differentiated seedlings were transferred to a rooting culture medium and rooted for 7 to 10 days. The rooted seedlings were numbered, and a total of 5 seedlings were screened on a hygromycin resistance medium, named BnaWIP2-Cas9#1 to #5. Take a small amount of rapeseed young leaves, extract the genomic DNA template for PCR amplification, and judge the positive seedlings by agarose gel electrophoresis. PCR verification was performed using the primers Cas9-F and BnaWIP2-sgRNA-R shown in Table 1. The PCR reaction system is shown in Table 4, and the PCR reaction conditions are shown in Table 5. The test results are shown in Table 5. Figure 1 As shown, BnaWIP2-Cas9#1~#3 have no bands, while BnaWIP2-Cas9#4~#5 have bands, indicating that BnaWIP2-Cas9#4~#5 are positive strains.

[0056] Using the genomic DNA of BnaWIP2-Cas9#4~#5 strains as templates, BnaX.WIP2-genotyping-F and BnaX.WIP2-genotyping-R (X represents A04, A07, A09, C04, C06, and C08) shown in Table 1 as amplification primers, PCR amplification was performed on the six copies of the BnaWIP2 gene. The amplified products were gel-cut and purified, and their quality and concentration were tested. They were then sent to Shanghai Sangon Biotechnology Co., Ltd. for sequencing to detect the editing status of each BnaWIP2 copy in each CRISPR / Cas9 gene editing mutant.

[0057] The sequencing results of the BnaWIP2-Cas9#4 strain are as follows Figure 2As shown in B, the editing sites of the 6 copies are all on the first exon, among which: BnaA04.WIP2 deleted 7 bases, BnaA07.WIP2 inserted 2 bases, BnaA09.WIP2 deleted 20 bases, BnaC04.WIP2 deleted 7 bases, BnaC06.WIP2 deleted 4 bases, and BnaC08.WIP2 deleted 7 bases.

[0058] The sequencing results of BnaWIP2-Cas9#5 strain are as follows Figure 2 As shown in C, the editing sites of the six copies are all on the first exon, among which BnaA04.WIP2 has a deletion of 7 bases, BnaA07.WIP2 has an insertion of 2 bases, BnaA09.WIP2 has an insertion of 1 base, BnaC04.WIP2 has a deletion of 5 bases, BnaC06.WIP2 has a deletion of 4 bases, and BnaC08.WIP2 has a deletion of 5 bases.

[0059] Example 3: Verification of the effects of BnaWIP2-Cas9#4 and BnaWIP2-Cas9#5 mutants of Brassica napus on seed development and seed oil accumulation

[0060] The total fatty acid content of seeds and the fatty acid content of each component in this embodiment are detected as follows: first, weigh about 15 mg of the above rapeseed seed powder in a glass test tube, add 4 mL of 2.5% sulfuric acid methanol extract (add methyl heptadecanoate (Cat No. CDAA-251017M, Anpu) with a final concentration of 25 μg / mL as an internal standard in advance), tighten the lid and bathe in a constant temperature water bath at 80°C for 2 hours for esterification. After the esterification reaction is completed, take out the glass test tube and cool it to room temperature, add 2 mL of 0.9% NaCl (w / v) to terminate the esterification reaction, then add 2 mL of n-hexane, vortex and oscillate for 40 seconds, centrifuge at 1500 rpm for 5 minutes, then draw 800 μL of the upper organic phase and transfer it to a clean GC vial, and analyze each fatty acid component using a GC-2010plus (Shimadzu, Japan) gas chromatograph. The parameters of the chromatographic column (Supelco wax-10, Cat. No. 24079, Supelco) equipped with the GC-2010plus gas chromatograph were 30m (length) × 0.25mm (internal diameter) × 0.5μm (liquid membrane thickness). The heating parameters for chromatographic analysis were set as follows: the starting temperature was 160°C for 1min, then increased to 240°C at a rate of 4°C / min and maintained for 16min. After the chromatographic analysis was completed, the fatty acid components were determined according to the peak retention time, and the fatty acid components in the sample were homogenized by the internal standard.

[0061] After self-pollination of BnaWIP2-Cas9#4 and BnaWIP2-Cas9#5 to homozygosity, the seed development of Brassica napus variety Westar (wild type) and BnaWIP2 mutants BnaWIP2-Cas9#4 and BnaWIP2-Cas9#5 were compared. It was found that the seed size and grain weight of BnaWIP2-Cas9#4 and BnaWIP2-Cas9#5 mutants were larger than those of wild type ( Figure 3 A, Figure 3 B). Further comparison of the total fatty acid content of seeds of Brassica napus variety Westar (wild type) and BnaWIP2 mutants BnaWIP2-Cas9#4 and BnaWIP2-Cas9#5 revealed that the total fatty acid content of seeds of BnaWIP2-Cas9#4 and BnaWIP2-Cas9#5 was significantly higher than that of wild type ( Figure 3 C). The fatty acid content of each component was analyzed, and it was found that the contents of C16:0, C18:0, C18:2 and C18:3 in the seeds of BnaWIP2-Cas9#4 and BnaWIP2-Cas9#5 were higher than those in the wild type, while the content of C18:1 was lower than that in the wild type ( Figure 3 D), which indicates that BnaWIP2 also has the function of regulating changes in fatty acid composition.

[0062] Based on the above embodiments, the large-grain, high-oil mutant obtained by mutating the BnaWIP2 gene through CRISPR / Cas9 gene editing technology in the present invention can be used as a high-oil material for Brassica napus after vector separation.

[0063]

[0064]

[0065]

[0066]

[0067]

[0068]

[0069]

[0070]

Claims

1. A method for breeding large-seed, high-oil Brassica napus rape, characterized in that: The method comprises knocking out the BnaWIP2 gene in Brassica napus to make the BnaWIP2 gene mutate to obtain a large-grain, high-oil Brassica napus type; The BnaWIP2 gene includes BnaA04.WIP2 gene, BnaA07.WIP2 gene, BnaA09.WIP2 gene, BnaC04.WIP2 gene, BnaC06.WIP2 gene and BnaC08.WIP2 gene; The BnaA04.WIP2 gene sequence is shown in SIQ ID NO.1, the BnaA07.WIP2 gene sequence is shown in SIQ ID NO.2, the BnaA09.WIP2 gene sequence is shown in SIQ ID NO.3, the BnaC04.WIP2 gene sequence is shown in SIQ ID NO.4, the BnaC06.WIP2 gene sequence is shown in SIQ ID NO.5, and the BnaC08.WIP2 gene sequence is shown in SIQ ID NO.

6.

2. The method for breeding large-seed, high-oil Brassica napus according to claim 1, characterized in that: CRISPR / Cas9 gene editing technology was used to knock out the BnaWIP2 gene in Brassica napus.

3. The method for breeding large-seed, high-oil Brassica napus according to claim 2, characterized in that: include: Step 1, constructing a BnaWIP2 gene CRISPR / Cas9 expression vector and an Agrobacterium strain containing the BnaWIP2 gene CRISPR / Cas9 expression vector; Step 2: Genetically transforming Brassica napus varieties based on the Agrobacterium-mediated method to obtain multiple gene-edited mutant plants; Step three: Select plants with large seeds and high oil content from multiple gene-edited mutant plants.

4. The method for breeding large-seed, high-oil Brassica napus according to claim 3, characterized in that: The sgRNA sequence sgR-BnaWIP2 of the BnaWIP2 gene in step 1 is 5'-TACTCAGTTCTCTTGTCCTG-3'.

5. The method for breeding large-seed, high-oil Brassica napus according to claim 4, characterized in that: The upstream primer of sgR-BnaWIP2 in step 1 is sgR-BnaWIP2-F: 5′-ATTGCAGGACAAGAGAACTGAGTA-3′; Downstream primer of sgR-BnaWIP2: sgR-BnaWIP2-R: 5′-AAACTACTCAGTTCTCTTGTCCTG-3′.

6. The method for breeding large-seed, high-oil Brassica napus according to claim 4, characterized in that: In step 2, the Brassica napus variety is genetically transformed based on the Agrobacterium-mediated method, and multiple gene-edited mutant plants are obtained through hygromycin resistance screening.

Images