Application of circular RNA circICMT in preparation of products for preventing and treating bladder cancer

Abstract

The invention discloses application of circular RNA circICMT in preparation of a product for preventing and treating bladder cancer, and relates to the technical field of biotechnology. Proliferation, metastasis and clone formation of bladder cancer cells can be promoted by inhibiting expression of the circICMT, and proliferation, metastasis and clone formation of the bladder cancer cells can be inhibited by overexpressing the circICMT, so that the circICMT can be used as a new molecular target for bladder cancer treatment. Furthermore, the invention obtains siRNA or shRNA capable of effectively inhibiting the expression of the circICMT, and the expression of the circICMT can be reduced by about 5 times. Results of in-vivo and in-vitro experiments show that the circICMT interference can promote the proliferation ability, migration ability, clone formation ability and nude mouse tumorigenesis ability of bladder cancer cells with malignant phenotypes, which indicates that the circICMT is an expected bladder cancer treatment target.

Description

Technical Field

[0001] The present invention relates to the technical field of biotechnology, and in particular to an application of circular RNA circICMT in preparing a product for preventing and treating bladder cancer. Background Art

[0002] Bladder cancer (Bca) is one of the most common malignancies worldwide and ranks second among urinary tract malignancies. Bca is a heterogeneous disease that poses significant challenges to accurate diagnosis, effective treatment, and prognosis prediction. Early diagnosis can lead to more ideal treatment outcomes. Therefore, there is an urgent need to develop minimally invasive diagnostic techniques to improve the possibility of recovery.

[0003] Circular RNA (circRNA) is an emerging endogenous noncoding RNA molecule with unique structural features, including a closed covalent loop, no cap structure at the 5' end, and a poly(A) tail at the 3' end. Compared with traditional linear RNA, circRNA is mainly generated by the reverse splicing process of exons or introns. CircRNAs are endogenous, abundant, and evolutionarily conserved molecules in mammalian cells, which suggests their role in cell physiology. They may play an important role in this process. In addition, studies have shown that many circular RNAs play an important role in carcinogenesis. circICMT is a circular RNA from the ICMT gene, corresponding to the circBase database ID hsa_circ_0007427. The function of circICMT in disease has not been reported. Summary of the invention

[0004] In order to overcome the shortcomings and deficiencies of the prior art, the object of the present invention is to provide an application of circular RNA circICMT in the preparation of products for preventing and treating bladder cancer.

[0005] The present invention provides a new application of circICMT, which can promote the proliferation, metastasis and clone formation of bladder cancer cells by inhibiting the expression of circICMT, and inhibit the proliferation, metastasis and clone formation of bladder cancer cells by overexpressing circICMT, so circICMT can be used as a new molecular target for the treatment of bladder cancer. The present invention also obtains a shRNA that can better inhibit the expression of circICMT through optimization.

[0006] The purpose of the present invention is achieved through the following technical solutions:

[0007] Use of circular RNA circICMT as a target in the preparation of any of the following products or models:

[0008] (1) Application in the preparation of products for the prevention and treatment of bladder cancer;

[0009] (2) Use in the preparation of products for inhibiting the growth of bladder cancer;

[0010] (3) Application in the preparation of a product for increasing the expression of circular RNA circICMT in bladder cancer cells;

[0011] (4) Application in screening products for the prevention and treatment of bladder cancer;

[0012] (5) Application in the preparation of products for inhibiting the expression of circular RNA circICMT;

[0013] (6) Application in constructing animal models of bladder cancer;

[0014] The circBase ID of the circular RNA circICMT is hsa_circ_0007427, and its sequence is shown in SEQ ID NO: 1.

[0015] The products described in applications (1) to (3) include preparations, kits, test strips or chips, etc.; further, the product is a kit.

[0016] Furthermore, the products described in applications (1) to (3) include reagents for increasing the expression of circular RNA circICMT.

[0017] The reagent for increasing the expression amount of circular RNA circICMT includes biological materials related to circular RNA circICMT;

[0018] The circular RNA circICMT-related biological material is any one or more combinations of the following biological materials:

[0019] a) an expression cassette containing the circular RNA circICMT shown in SEQ ID NO: 1;

[0020] b) a recombinant expression vector containing the circular RNA circICMT shown in SEQ ID NO: 1;

[0021] c) a recombinant expression vector containing the expression cassette described in a);

[0022] d) a recombinant microorganism containing the circular RNA circICMT shown in SEQ ID NO: 1;

[0023] e) a recombinant microorganism containing the expression cassette described in a);

[0024] f) a recombinant microorganism containing the recombinant expression vector described in b) or c);

[0025] Furthermore, the products described in application (4) include potential drugs, etc.;

[0026] Furthermore, the product described in application (5) includes preparations, kits, test strips, chips, bladder cancer cell lines, etc.; further, it is a kit or a bladder cancer cell line.

[0027] Furthermore, the product for inhibiting the expression of circular RNA circICMT described in (5) is a bladder cancer cell line that inhibits the expression of circular RNA circICMT.

[0028] Furthermore, the agent for inhibiting the expression of circular RNA circICMT includes at least one of siRNA, shRNA, double-stranded oligonucleotide, siRNA or shRNA expression vector and shRNA-related biological materials that inhibit the expression of circular RNA circICMT.

[0029] The siRNA for inhibiting the expression of circular RNA circICMT, wherein the siRNA is siRNA-1 to 3, the sense strand sequence of the siRNA-1 is shown in SEQ ID NO: 2, the antisense strand sequence of the siRNA-1 is shown in SEQ ID NO: 3, the sense strand sequence of the siRNA-2 is shown in SEQ ID NO: 4, the antisense strand sequence of the siRNA-2 is shown in SEQ ID NO: 5, the sense strand sequence of the siRNA-3 is shown in SEQ ID NO: 6, and the antisense strand sequence of the siRNA-3 is shown in SEQ ID NO: 7;

[0030] The shRNA that inhibits the expression of circular RNA circICMT, the target sequence of the shRNA is SEQ ID NO: 2, SEQ ID NO: 4 or SEQ ID NO: 6.

[0031] In the present invention, the "target sequence" refers to the sequence common to the target gene and the gene of the shRNA; because of the "target sequence", the shRNA or the siRNA product obtained by its processing can specifically recognize the mRNA of the target gene.

[0032] Furthermore, the sense strand sequence of the shRNA is expressed as shown in SEQ ID NO:8, SEQ ID NO:10 or SEQ ID NO:12.

[0033] The double-stranded oligonucleotide has a sense strand sequence as shown in SEQ ID NO: 8, and an antisense strand sequence as shown in SEQ ID NO: 9; or, a sense strand sequence as shown in SEQ ID NO: 10, and an antisense strand sequence as shown in SEQ ID NO: 11; or, a sense strand sequence as shown in SEQ ID NO: 12, and an antisense strand sequence as shown in SEQ ID NO: 13.

[0034] The siRNA or shRNA expression vector is a recombinant expression vector containing the above siRNA or shRNA. Further, the shRNA expression vector includes a DNA sequence expressing the above shRNA.

[0035] Furthermore, the shRNA expression vector is a recombinant vector obtained by inserting a DNA sequence expressing the above shRNA into a PLent-U6-GFP-PURO vector;

[0036] Furthermore, the DNA sequence expressing the above shRNA is the above double-stranded oligonucleotide.

[0037] The method for constructing the shRNA expression vector for inhibiting the expression of circular RNA circICMT comprises the following steps:

[0038] 1) Synthesizing oligonucleotides: first denaturing primers with sequences such as SEQ ID NO: 8 and SEQ ID NO: 9, or primers with sequences such as SEQ ID NO: 10 and SEQ ID NO: 11, or primers with sequences such as SEQ ID NO: 12 and SEQ ID NO: 13, and then annealing to obtain double-stranded oligonucleotides;

[0039] 2) Double digest the PLent-U6-GFP-PURO vector with BamHI and MluI to obtain two fragments, and recover the larger fragment;

[0040] 3) The double-stranded oligonucleotide obtained in step 1) and the larger fragment obtained in step 2) are connected using T4 ligase to obtain a shRNA expression vector that inhibits the expression of circular RNA circICMT.

[0041] Furthermore, the denaturation procedure of step 1) is: boiling for 5 min;

[0042] Furthermore, the annealing procedure of step 2) is: 72° C. for 15 min, and naturally cooling to room temperature for about 30 min.

[0043] The shRNA-related biological material is any one or more combinations of the following biological materials:

[0044] (I) a recombinant lentivirus, wherein the recombinant lentivirus is prepared by co-transfecting cells with the above-mentioned shRNA expression vector and packaging plasmid;

[0045] (II) A recombinant bacterium comprising the above-mentioned shRNA expression vector.

[0046] Furthermore, the method for constructing an animal model of bladder cancer described in (6) is to subcutaneously inject a bladder cancer cell line that inhibits the expression of circular RNA circICMT into an animal to construct an animal model of bladder cancer.

[0047] A kit comprises the above-mentioned reagent for increasing the expression amount of circular RNA circICMT, or the reagent for inhibiting the expression of circular RNA circICMT.

[0048] An inhibitor of circular RNA circICMT, the inhibitor comprising the above-mentioned reagent for inhibiting the expression of circular RNA circICMT; the reagent for inhibiting the expression of circular RNA circICMT comprises at least one of the above-mentioned siRNA, shRNA, double-stranded oligonucleotide, siRNA or shRNA expression vector and shRNA-related biological materials that inhibit the expression of circular RNA circICMT.

[0049] A method for preparing a bladder cancer cell line that inhibits the expression of circular RNA circICMT comprises the following steps: infecting bladder cancer cells with the above-mentioned recombinant lentivirus, and obtaining a stable expression cell line through puro drug screening, that is, a bladder cancer cell line that inhibits the expression of circular RNA circICMT.

[0050] Furthermore, the bladder cancer cells are RT4 cells, T24 cells, etc.

[0051] A method for constructing a bladder cancer animal model comprises the following steps: subcutaneously injecting the prepared bladder cancer cell line inhibiting the expression of circular RNA circICMT into an animal to construct a bladder cancer animal model.

[0052] Furthermore, the animal is a mouse, etc.;

[0053] Furthermore, the inoculation amount of the bladder cancer cell line is 1×10 6 ~1×10 7 Pieces / piece; preferably 2×10 6 Piece / piece.

[0054] Furthermore, the vaccination site is the armpit or groin, etc.

[0055] Furthermore, the tumor formation was observed, and a bladder cancer animal model was established one week after inoculation.

[0056] The present invention also provides a method for in vitro screening of potential drugs for preventing and treating bladder cancer, comprising the following steps: (A) treating an in vitro system expressing or containing circICMT with a candidate agent; (B) detecting the expression of circICMT. If the expression of circICMT is promoted, the candidate agent can be used as a potential drug for preventing and treating bladder cancer.

[0057] Furthermore, the primers for detecting the expression of circICMT in step (B) include an upstream primer as shown in SEQ ID NO: 14 and a downstream primer as shown in SEQ ID NO: 15.

[0058] Compared with the prior art, the present invention has the following advantages and effects:

[0059] (1) The present invention has confirmed for the first time that overexpression of circICMT can inhibit the proliferation, metastasis and cloning of bladder cancer cells, thereby playing an anti-bladder cancer role. Therefore, circICMT can be used as a new molecular target for treating bladder cancer and screening drugs for treating bladder cancer. Furthermore, the present invention has also obtained a siRNA or shRNA that can effectively inhibit the expression of circICMT through optimization. Its inhibitory effect on circICMT is better than other siRNA or shRNA, and the expression of circICMT can be reduced by about 5 times.

[0060] (2) The siRNA or shRNA designed and synthesized by the present invention targeting circICMT can effectively interfere with and reduce the expression level of circICMT. The results of in vivo and in vitro experiments showed that interfering with circICMT can promote the proliferation ability, migration ability, cloning ability and tumor formation ability of bladder cancer cells with malignant phenotypes, which indicates that circICMT is a promising target for bladder cancer treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0061] Figure 1 It is the RNA electrophoresis diagram; among them, lane 1 is NC, lane 2 is circICMT-sh1, lane 3 is circICMT-sh2, and lane 4 is circICMT-sh3.

[0062] Figure 2 The figure shows the expression detection results of circICMT in the stable cell lines of the Blank group, NC group and shRNA interference group; among them, the Blank group is RT4 cells that are not infected with the virus.

[0063] Figure 3 The figure shows the proliferation ability test results of the stable cell lines in the Blank group, NC group and shRNA interference group;

[0064] Figure 4 The figure shows the migration ability test results of the stable cell lines in the Blank group, NC group and shRNA interference group;

[0065] Figure 5 This is the result of detecting the clone formation ability of the stable cell lines in the Blank group, NC group and shRNA interference group.

[0066] Figure 6 This is the result of subcutaneous tumor formation detection in nude mice of stable cell lines in NC group and shRNA interference group.

[0067] Figure 7 This is the expression detection result of circICMT in the stable cell lines of Blank group, Vector group, and circICMT overexpression group.

[0068] Figure 8 This is the result of the proliferation ability test of the stable cell lines in the Blank group, Vector group, and circICMT overexpression group;

[0069] Fig. 9 This is the migration ability test result of the stable cell lines in the Blank group, Vector group, and circICMT overexpression group;

[0070] Fig.10 This is the result of the clone formation ability test of the stable cell lines in the Blank group, Vector group, and circICMT overexpression group.

[0071] Fig.11 This is the result of subcutaneous tumor formation detection in nude mice of stable cell lines in NC and circICMT overexpression groups.

[0072] Note: * indicates significant difference (P<0.05), ** indicates extremely significant difference (P<0.01). DETAILED DESCRIPTION

[0073] The present invention is further described in detail below in conjunction with embodiments and drawings, but the embodiments of the present invention are not limited thereto.

[0074] The present invention is further described in detail below in conjunction with embodiments and drawings, but the embodiments of the present invention are not limited thereto.

[0075] The experimental methods in the following examples of the present invention, where no specific conditions are specified, are usually carried out under conventional conditions or under conditions recommended by the manufacturers. The various commonly used chemical reagents used in the examples are all commercially available products.

[0076] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those commonly understood by those skilled in the art of the present invention. The terms used in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention.

[0077] The terms "including" and "having" and any variations thereof of the present invention are intended to cover non-exclusive inclusions. For example, a process, method, device, product or equipment comprising a series of steps is not limited to the listed steps or modules, but may optionally include steps not listed, or may optionally include other steps inherent to these processes, methods, products or equipment.

[0078] The terms "including" and "having" and any variations thereof of the present invention are intended to cover non-exclusive inclusions. For example, a process, method, device, product or equipment comprising a series of steps is not limited to the listed steps or modules, but may optionally include steps not listed, or may optionally include other steps inherent to these processes, methods, products or equipment.

[0079] In the present invention, the term "multiple" refers to two or more than two. "And / or" describes the association relationship of associated objects, indicating that three relationships may exist. For example, A and / or B can represent the following three situations: A exists alone, A and B exist at the same time, and B exists alone. The character " / " generally indicates that the associated objects are in an "or" relationship.

[0080] siRNA: Small interfering RNA, is a double-stranded RNA molecule with double-ended fragments that can reduce specific RNA by targeting RNA with homologous complementary sequences.

[0081] shRNA: short hairpin RNA, can be cloned into a vector using genetic engineering technology. After cell transfection, it can express short interfering RNA (siRNA) to exert its effect. We can design shRNA sequences according to specific RNA targets and clone them into a vector.

[0082] In the present invention:

[0083] According to the circICMT sequence (SEQ ID NO: 1) and the design principles of RNA interference sequences, three siRNA sequences (si-circICMT-1~3, referred to as siRNA-1~3) were designed. The sequences are as follows:

[0084] circICMT sequence (SEQ ID NO: 1):

[0085] gtacatgtgctccctgtcattgttccactattctgaatacttggtgacagcagtcaataatcccaaaagtctgtccttggattcctttctcctgaatcacagcc tggagtatacagtagctgctctttcttcttggttagagttcacacttgaaaatatcttttggccagaactgaagcagattacctggctcagtgtcacagggctgc tgatggtggtcttcggagaatgtctgaggaaggcggccatgtttacagctggctccaatttcaaccacgtggtacagaatgaaaaatcagatacacatactctg gtgaccagtggagtgtacgcttggtttcggcatccttcttacgtcgggtggttttactggagtattggaactcagsiRNA-1 sense strand sequence: 5'-GTATTGGAACTCA GG TACATG-3', SEQ ID NO: 2;

[0086] The antisense sequence of siRNA-1: 5′-CATGTACCTGAGTTCCAATAC-3′, SEQ ID NO: 3;

[0087] Sense strand sequence of siRNA-2: 5'-TTGGAACTCA GG TACATGTGC-3', SEQ ID NO: 4;

[0088] The antisense sequence of siRNA-2: 5′-GCACATGTACCTGAGTTCCAA-3′, SEQ ID NO: 5;

[0089] Sense strand sequence of siRNA-3: 5'-GGAACTCA GG TACATGTGCTC-3', SEQ ID NO: 6;

[0090] The antisense strand sequence of siRNA-3: 5′-GAGCACATGTACCTGAGTTCC-3′, SEQ ID NO: 7;

[0091] Based on the above siRNA-1~3 sequences, the upstream primers and downstream primers of the corresponding shRNA (circICMT-sh1~3) were designed and synthesized. The sequences are as follows:

[0092] circICMT-sh1-F:5'-gatcc GTATTGGAACTCAGGTACATG CTCGAGCATGTACCTGAGTTCCAATACTTTTTTa-3', SEQ ID NO: 8;

[0093] circICMT-sh1-R: 5'-cgcgtAAAAAAGTATTGGAACTCAGGTACATGCTCGAGCATGTACCTGAGTTCCAATACg-3', SEQ ID NO: 9;

[0094] The lowercase letters are restriction enzyme cleavage site sequences, and the underlined portion is the positive chain sequence of siRNA-1.

[0095] circICMT-sh2-F:5'-gatcc TTGGAACTCAGGTACATGTGC CTCGAGGCACATGTACCTGAGTTCCAATTTTTTa-3', SEQ ID NO: 10;

[0096] circICMT-sh2-R: 5'-cgcgtAAAAAAATTGGAACTCAGGTACATGTGCCTCGAGGCACATGTACCTGAGTTCCAAg-3', SEQ ID NO: 11;

[0097] The lowercase letters are restriction enzyme cleavage site sequences, and the underlined portion is the positive chain sequence of siRNA-2.

[0098] circICMT-sh3-F:5'-gatcc GGAACTCAGGTACATGTGCTC CTCGAGGAGCACATGTACCTGAGTTTCCTTTTTTa-3', SEQ ID NO: 12;

[0099] circICMT-sh3-R: 5'-cgcgtAAAAAAGGAACTCAGGTACATGTGCTCCTCGAGGAGCACATGTACCTGAGTTCCg-3', SEQ ID NO: 13.

[0100] The lowercase letters are restriction enzyme cleavage site sequences, and the underlined portion is the positive chain sequence of siRNA-3.

[0101] Example 1 Vector Construction

[0102] Take equal volumes of the upstream primer and downstream primer of the above-mentioned synthetic shRNA and mix them, boil them in a boiling water bath for 5 minutes, then 72°C for 15 minutes, and naturally cool to room temperature for about 30 minutes to form shRNA. At this time, circICMT-sh1, circICMT-sh2, and circICMT-sh3 can be connected to the double-enzyme-digested PLent-U6-GFP-Puro vector, or stored at -20°C.

[0103] The shRNA expression vector was constructed through the five steps of double restriction digestion of PLent-U6-GFP-Puro vector, recovery of restriction digestion products, ligation of target fragments with vectors, transformation of ligation products and sequencing identification. After sequencing identification, the shRNA expression vector was successfully constructed, and PLent-circICMT-sh1 vector, PLent-circICMT-sh2 vector and PLent-circICMT-sh3 vector were obtained respectively for subsequent experiments.

[0104] Among them, the above 5 steps refer to steps 3 to 7 of Example 1 in the document "CN118240824A, shRNA inhibiting hsa_circ_0099132 expression and its application".

[0105] Example 2 Virus packaging and stable strain preparation

[0106] The recombinant expression vector plasmids (PLent-circICMT-sh1 vector, PLent-circICMT-sh2 vector, PLent-circICMT-sh3 vector) and the empty vector (i.e., PLent-U6-GFP-PURO vector, denoted as NC) verified by sequencing in Example 1 were used for virus packaging, mixed with the packaging plasmids in a certain proportion, transfected into HEK-293T cells, prepared lentivirus, and then the lentivirus was transferred into RT4 cells, respectively, and the stable expression cell lines were obtained by referring to step 3 of Example 2 in the document “CN114457081A, New Application of Circular RNA hsa_circ_0000745”, i.e., cell lines transfected with NC, cell lines transfected with circICMT-sh1, cell lines transfected with circICMT-sh2, and cell lines transfected with circICMT-sh3; then the total RNA of each group of cells was extracted and reverse transcribed into cDNA, and the GAPDH gene was used as the internal reference gene, and the expression level of circICMT was detected by qPCR. Among them, the steps of total RNA extraction, reverse transcription, and quantitative PCR can refer to Example 2 in the document "CN118240824A, shRNA inhibiting hsa_circ_0099132 expression and its application".

[0107] The results of total RNA extraction were as follows Figure 1As shown, the 5s rRNA, 18s rRNA and 28s rRNA bands of the total RNA are complete, the extraction quality is good, and it can be used for subsequent experiments.

[0108] The detection primers are as follows:

[0109] The detection primers for circICMT include circICMT-F / R (upstream primer shown in SEQ ID NO: 14 and downstream primer shown in SEQ ID NO: 15), and the fragment size is 148 bp:

[0110] circICMT-F: 5'-TACACATACTCTGGTGACCAGTG-3', SEQ ID NO: 14;

[0111] circICMT-R: 5'-TTATTGACTGCTGTCACCAAGTA-3', SEQ ID NO: 15.

[0112] The detection primers for the internal reference GAPDH include GAPDH-F / R (upstream primer shown in SEQ ID NO: 16 and downstream primer shown in SEQ ID NO: 17), and the internal reference fragment size is 299 bp:

[0113] GAPDH-F: 5'-GGGAAACTGTGGCGTGAT-3', SEQ ID NO: 16;

[0114] GAPDH-R: 5'-GAGTGGGTGTCGCTGTTGA-3', SEQ ID NO: 17.

[0115] GAPDH was used as the internal reference gene and 2 -△△CT The relevant expression level of circICMT was calculated by the formula, and the detection results were as follows Figure 2 As shown in the figure, compared with the Blank group and the NC group, the expression of circICMT in the circICMT-sh group cell line was significantly downregulated, indicating that the siRNA or shRNA played a role in inhibiting the expression of circICMT. Among them, circICMT-sh1 had the best inhibitory effect and was selected as the subsequent experiment.

[0116] Example 3 Cell proliferation, migration, clone formation and nude mouse tumorigenesis detection

[0117] The proliferation (CCK8 method), migration (scratch test), clone formation and nude mouse tumor formation ability of the Blank group, NC group and circICMT-sh1 group stably expressing cell lines prepared in Example 2 were detected. Among them, the CCK8 method for detecting cell proliferation, clone formation experimental methods and nude mouse tumor formation experimental methods refer to the literature "CN118240824A, shRNA inhibiting hsa_circ_0099132 expression and its application".

[0118] Cell migration assay (scratch assay)

[0119] 1) First, use a marker pen and a ruler to evenly draw horizontal lines on the back of the 6-well plate, approximately every 0.5 to 1 cm, across the holes; at least 5 lines should be drawn for each hole.

[0120] 2) Add 50 μL of 10 μg / mL fibronectin (FN) to each well of a 6-well plate under aseptic operation in a clean bench, place in a 4°C refrigerator overnight, and add DMEM high-glucose culture medium containing 10% FBS the next day and sterilize under ultraviolet light for 2 hours for later use.

[0121] 3) The concentration in the logarithmic growth phase is about 1×10 6 / mL cells, and made into a suspension, which was evenly inoculated into a 6-well culture plate and placed in a 37°C 5% CO2 incubator for routine culture.

[0122] 4) After the cells grew into a monolayer under an inverted microscope, the medium was changed after each cell group was treated.

[0123] 5) Use a 10μL sterile micropipette tip to scratch the cell plate. Use the tip of the pipette to measure against the ruler and try to make it vertical to the horizontal scratch on the back. The tip of the pipette should be vertical and not tilted.

[0124] 6) Rinse 2-3 times with PBS to remove the scraped cells and add serum-free culture medium.

[0125] 7) Place the cells in a 37°C 5% CO2 incubator for continued culture, take samples at 0, 12, 24, and 48 hours after scratching, take photos, and observe the healing of the scratches.

[0126] 8) Image Pro-Plus 6.0 software was used to measure the scratch width of each group of cells at the same time point, and the cell migration distance migration rate (Wound healing rate, %) was calculated = (0 h scratch width - other time points scratch width) / 0 h scratch width × 100% to reflect the movement and migration ability of each group of cells, and the data were statistically analyzed.

[0127] Cell proliferation results Figure 3As shown, starting from 24h of culture, the proliferation of cells in the circICMT-sh1 group was significantly promoted compared with the Blank group and the NC group, indicating that reducing the expression of circICMT can significantly promote the proliferation of RT4 cells.

[0128] The migration experiment results are as follows Figure 4 As shown in the figure, compared with the Blank group and NC group, the migration ability and migration rate of the cells in the circICMT-sh1 group were significantly improved, indicating that inhibiting the expression of circICMT can significantly improve the migration ability of RT4 cells.

[0129] The results of clone formation are as follows Figure 5 As shown in the figure, compared with the Blank group and the NC group, the cell clone formation ability of the circICMT-sh1 group was significantly improved, and the number of cells in the formed clones increased, indicating that inhibiting the expression of circICMT can significantly improve the clone formation ability of RT4 cells.

[0130] The results of nude mouse tumor formation were as follows Figure 6 As shown in the figure, after the tumor cells were inoculated, the tumor grew out in about 4 days. As time went on, the tumor volume continued to grow. The observation lasted for 35 days. At the end of the experiment, all mice were dissected and the tumors were removed. Compared with the RT4-NC group, the tumor volume and tumor weight of the mice in the circICMT-sh1 group were significantly increased.

[0131] Example 4 Construction of circICMT overexpression vector

[0132] 1. Design amplification primers based on the circICMT sequence (SEQ ID NO: 1), the sequence is as follows:

[0133] circICMT-EcoRI-F: 5'-ccggaattcGTACATGTGCTCCCTGTCATTGTTCCACTA-3';

[0134] circICMT-BamHI-R: 5'-cgcggatccCTGAGTTCCAATACTCCAGTAAAACCACCC-3';

[0135] 2. Using the cDNA reverse transcribed from RT4 cell total RNA as a template, circICMT-EcoRI-F / circICMT-BamHI-R was used for PCR amplification to obtain the circICMT sequence, and then the sequence and the pLNCX2 vector were double-digested with EcoRI / BamHI, respectively, and then the target fragment was connected to the pLNCX2 vector with T4 DNA ligase, and transformed into Escherichia coli DH5α competent cells. After ampicillin (Amp) screening, positive clones were picked for plasmid extraction, double-digestion identification and sequencing, and the pLNCX2-circICMT overexpression vector was successfully constructed. It can be used for subsequent experiments.

[0136] Example 5 Cell proliferation, migration, clone formation and nude mouse tumorigenesis detection

[0137] 1. The circICMT overexpression vector (pLNCX2-circICMT overexpression vector) prepared in Example 4 was used for virus packaging. The specific steps were as shown in Example 2. T24 cells (human bladder transitional cell carcinoma cells, conventional commercially available cells) were transfected to obtain a stable expression cell line, i.e., a cell line transfected with circICMT (circICMT). An uninfected virus group (Blank) and an infected empty vector pLNCX2 lentivirus group (Vector) were set up. Referring to Example 2, the expression level of circICMT in the cell line transfected with circICMT was detected. The results are shown in FIG. Figure 7 As shown in the figure, compared with the Blank group and Vector group, the expression of circICMT in the cell lines of the circICMT overexpression group was significantly increased.

[0138] 2. Detect the proliferation, migration, cloning and nude mouse tumorigenesis of the stable expression cell lines in the Blank group, Vector group and circICMT overexpression group. Refer to Example 3 for the specific steps.

[0139] The results of proliferation ability test were as follows Figure 8 As shown, starting from 24h of culture, the proliferation of cells in the circICMT overexpression group was significantly inhibited compared with the Blank group and Vector group, indicating that the overexpression of circICMT inhibited the proliferation ability of T24 cells.

[0140] The migration ability test results are as follows Fig. 9 As shown in the figure, compared with the Blank group and Vector group, the migration ability of cells in the circICMT overexpression group was significantly inhibited, and the migration rate was significantly decreased, indicating that the overexpression of circICMT inhibited the migration ability of T24 cells.

[0141] The results of clone formation ability test were as follows Fig.10As shown in the figure, compared with the Blank group and Vector group, the cell clone-forming ability of the circICMT overexpression group was significantly decreased, and the number of cells in the formed clones was reduced, indicating that the overexpression of circICMT inhibited the clone-forming ability of T24 cells.

[0142] To establish an in vivo model to study the role of overexpressed circICMT in tumor growth, nude mice were subcutaneously injected with T24 cells overexpressing circICMT (denoted as T24-circICMT) in the axilla, and cells transfected with the empty vector pLNCX2 were used as controls (denoted as T24-NC). Tumor volume was evaluated 7 days after injection. Mice were killed 35 days after injection. Then, subcutaneous tumor tissues were dissected, and tumor volume and weight were calculated. Results ( Fig.11 ) showed that overexpression of circICMT reduced tumor growth rate and tumor weight.

[0143] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. Use of circular RNA circICMT as a target in the preparation of any of the following products or models, characterized in that: (1) Application in the preparation of products for the prevention and treatment of bladder cancer; (2) Use in the preparation of products for inhibiting the growth of bladder cancer; (3) Application in the preparation of a product for increasing the expression of circular RNA circICMT in bladder cancer cells; (4) Application in screening products for the prevention and treatment of bladder cancer; (5) Application in the preparation of products for inhibiting the expression of circular RNA circICMT; (6) Application in establishing animal models of bladder cancer; The circBase ID of the circular RNA circICMT is hsa_circ_0007427, and its sequence is shown in SEQ ID NO:

1.

2. The use according to claim 1, characterized in that: The products described in applications (1) to (3) include preparations, kits, test strips or chips; The products described in application (4) include potential drugs; The product described in application (5) includes a preparation, a kit, a test strip, a chip or a bladder cancer cell line; The method for constructing a bladder cancer animal model as described in (6) is to subcutaneously inject a bladder cancer cell line that inhibits the expression of circular RNA circICMT into an animal to construct a bladder cancer animal model.

3. The use according to claim 1, characterized in that: The products described in applications (1) to (3) include reagents for increasing the expression of circular RNA circICMT.

4. The use according to claim 3, characterized in that: The reagent for increasing the expression amount of circular RNA circICMT includes biological materials related to circular RNA circICMT; The circular RNA circICMT-related biological material is any one or more combinations of the following biological materials: a) an expression cassette containing the circular RNA circICMT shown in SEQ ID NO: 1; b) a recombinant expression vector containing the circular RNA circICMT shown in SEQ ID NO: 1; c) a recombinant expression vector containing the expression cassette described in a); d) a recombinant microorganism containing the circular RNA circICMT shown in SEQ ID NO: 1; e) a recombinant microorganism containing the expression cassette described in a); f) A recombinant microorganism containing the recombinant expression vector described in b) or c).

5. The use according to claim 1, characterized in that: In application (5), the agent for inhibiting the expression of circular RNA circICMT includes at least one of siRNA, shRNA, double-stranded oligonucleotide, siRNA or shRNA expression vector and shRNA-related biological materials that inhibit the expression of circular RNA circICMT.

6. The use according to claim 5, characterized in that: The siRNA for inhibiting the expression of circular RNA circICMT, wherein the siRNA is siRNA-1 to 3, the sense strand sequence of the siRNA-1 is shown in SEQ ID NO: 2, the antisense strand sequence of the siRNA-1 is shown in SEQ ID NO: 3, the sense strand sequence of the siRNA-2 is shown in SEQ ID NO: 4, the antisense strand sequence of the siRNA-2 is shown in SEQ ID NO: 5, the sense strand sequence of the siRNA-3 is shown in SEQ ID NO: 6, and the antisense strand sequence of the siRNA-3 is shown in SEQ ID NO: 7; The shRNA for inhibiting the expression of circular RNA circICMT, wherein the target sequence of the shRNA is SEQ ID NO: 2, SEQ ID NO: 4 or SEQ ID NO: 6; The double-stranded oligonucleotide, the sense strand sequence of which is shown in SEQ ID NO: 8, and the antisense strand sequence of which is shown in SEQ ID NO: 9; or, the sense strand sequence of which is shown in SEQ ID NO: 10, and the antisense strand sequence of which is shown in SEQ ID NO: 11; or, the sense strand sequence of which is shown in SEQ ID NO: 12, and the antisense strand sequence of which is shown in SEQ ID NO: 13; The siRNA or shRNA expression vector is a recombinant expression vector containing the siRNA or shRNA; The shRNA-related biological material is any one or more combinations of the following biological materials: (I) a recombinant lentivirus, wherein the recombinant lentivirus is prepared by co-transfecting cells with the shRNA expression vector and the packaging plasmid; (II) A recombinant bacterium comprising the above-mentioned shRNA expression vector.

7. The agent for inhibiting the expression of circular RNA circICMT according to claim 5 or 6.

8. A kit, characterized in that: The invention comprises the reagent for increasing the expression amount of circular RNA circICMT as described in claim 4, or the reagent for inhibiting the expression of circular RNA circICMT as described in claim 5.

9. A method for in vitro screening of potential drugs for preventing and treating bladder cancer, characterized in that: The following steps are involved: (A) treating an in vitro system expressing or containing circICMT with a candidate agent; (B) detecting the expression of circICMT. If the expression of circICMT is promoted, the candidate agent can be used as a potential drug for preventing and treating bladder cancer.

10. The method according to claim 9, characterized in that: The primers for detecting the expression of circICMT in step (B) include an upstream primer as shown in SEQ ID NO: 14 and a downstream primer as shown in SEQ ID NO: 15.

Images