Molecular marker related to salt-tolerant and rapid growth traits of grass carp and application of molecular marker

Abstract

The invention provides a molecular marker related to salt-tolerant rapid growth traits of grass carps and application of the molecular marker, and belongs to the technical field of molecular markers. According to the invention, a group of molecular markers related to salt-tolerant and rapid growth traits of grass carp are obtained through GWAS analysis and screening. The invention also develops a group of amplification primers based on the molecular marker, the amplification primers can realize screening and / or identification of salt-tolerant fast-growing grass carp germplasm, and the more the enriched dominant genotypes are, the higher the growth trait index is. Compared with the prior art, the molecular marker provided by the invention can be used for accurately and efficiently identifying high-quality grass carp individuals with salt-tolerant and fast-growing characters, and the salt-tolerant breeding progress of grass carp is accelerated.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular markers, and in particular relates to a molecular marker related to the salt-tolerant and rapid-growth trait of grass carp and an application thereof. Background Art

[0002] At present, domestic freshwater aquaculture resources are increasingly scarce, and how to effectively expand inland aquaculture space has become a key issue that needs to be solved urgently. Coastal saline land has been proven to have the potential for aquaculture development and utilization. Freshwater fish have a certain range of salinity adaptation. High salinity that freshwater fish cannot adapt to will cause osmotic regulation imbalance, metabolic disorders, and a decrease in body weight and immunity. Therefore, breeding new excellent fish varieties with traits such as salt tolerance and fast growth has good production application value.

[0003] Grass carp has become one of the important fish farming varieties in China due to its advantages such as fast growth, delicious meat and strong adaptability. Traditional breeding methods have enhanced the salt tolerance of grass carp to a certain extent, but because the salt tolerance trait is regulated by multiple genes and is complexly affected by multiple environmental factors, conventional breeding methods are less efficient in improving the salt tolerance of grass carp. In contrast, molecular marker-assisted breeding technology can improve traits more accurately and efficiently by identifying and selecting molecular markers that are closely related to the target traits at the genetic level. This method relies on molecular markers that are closely linked to the target gene or show a co-segregation relationship to screen specific phenotypes, thereby significantly reducing genetic linkage drag, optimizing the target traits, and thus improving breeding efficiency. However, there is currently a lack of corresponding molecular markers for grass carp with salt-tolerant and fast-growing traits, which restricts the progress of the selection and breeding of new salt-tolerant strains and has become a technical bottleneck that needs to be solved urgently. Summary of the invention

[0004] In view of this, the purpose of the present invention is to provide a molecular marker related to the salt-tolerant and fast-growing trait of grass carp, so as to provide a new idea for the molecular marker-assisted breeding of salt-tolerant and fast-growing grass carp.

[0005] The present invention provides a molecular marker related to the salt tolerance and rapid growth trait of grass carp, including at least one of the following: SNP1, SNP2, SNP3 and SNP4;

[0006] The SNP1 is a T / G polymorphic site at position 220 in the DNA sequence shown in SEQ ID NO: 1;

[0007] The SNP2 is a G / T polymorphic site at position 104 in the DNA sequence shown in SEQ ID NO: 2;

[0008] The SNP3 is a C / T polymorphic site at position 379 in the DNA sequence shown in SEQ ID NO: 3;

[0009] The SNP4 is an A / G polymorphic site at position 120 in the DNA sequence shown in SEQ ID NO:4.

[0010] The present invention provides amplification primers for molecular markers related to the salt-tolerant and rapid growth trait of grass carp, comprising at least one of the following primers: a SNP1 amplification primer, a SNP2 amplification primer, a SNP3 amplification primer and a SNP4 amplification primer;

[0011] The SNP1 amplification primers include a forward primer having a nucleotide sequence as shown in SEQ ID NO:5 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO:6;

[0012] The SNP2 amplification primers include a forward primer having a nucleotide sequence as shown in SEQ ID NO:7 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO:8;

[0013] The SNP3 amplification primers include a forward primer having a nucleotide sequence as shown in SEQ ID NO:9 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO:10;

[0014] The SNP4 amplification primers include a forward primer having a nucleotide sequence as shown in SEQ ID NO:11 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO:12.

[0015] The invention provides a detection kit for salt-tolerant and fast-growing grass carp germplasm, comprising the amplification primers.

[0016] Preferably, a PCR amplification premix is ​​also included.

[0017] The present invention provides the use of the molecular markers related to the salt-tolerant and fast-growing traits of grass carp as detection targets, the amplification primers or the detection kit in detecting and / or screening salt-tolerant and fast-growing grass carp germplasm or salt-tolerant and fast-growing grass carp breeding.

[0018] Preferably, the salt-tolerant and fast-growing grass carp germplasm tolerates a salinity of 6‰ to 8‰.

[0019] Preferably, the rapid growth indicators in the salt-tolerant and fast-growing grass carp germplasm include at least two of the following: body weight, body thickness and body height.

[0020] The present invention provides a method for screening salt-tolerant and fast-growing grass carp based on the molecular marker, comprising the following steps:

[0021] Using the genomic DNA of the sample to be tested as a template, PCR amplification is performed using the amplification primers to obtain a PCR product;

[0022] Analyze the genotype of the molecular marker in the PCR product, and determine whether the sample to be tested belongs to the salt-tolerant and fast-growing grass carp according to the genotype of the molecular marker in the PCR product:

[0023] When the sample to be tested contains at least one dominant genotype, it is judged that the sample to be tested belongs to the salt-tolerant and fast-growing grass carp; otherwise, the sample to be tested does not belong to the salt-tolerant and fast-growing grass carp;

[0024] The dominant genotype of the SNP1 is TT, the dominant genotype of the SNP2 is GG, the dominant genotype of the SNP3 is CC, and the dominant genotype of the SNP4 is AG.

[0025] Preferably, the reaction volume of the PCR amplification is 20 μl, including the following components: 10 μl Premix ExTaq, 8 μl ddH2O, 1 μl 10 μM forward primer, 1 μl 10 μM reverse primer, and 1 μl 50 ng / μl DNA template.

[0026] Preferably, the reaction conditions for the PCR amplification are: 95°C for 5 min; 95°C for 30 s, 52°C for 30 s, 72°C for 50 s, 35 cycles; 72°C for 5 min.

[0027] The present invention provides a molecular marker related to the salt tolerance and rapid growth trait of grass carp, comprising at least one of the following: SNP1, SNP2, SNP3 and SNP4; the SNP1 is a T / G polymorphic site at the 220th position in the DNA sequence of the nucleotide sequence as shown in SEQ ID NO:1; the SNP2 is a G / T polymorphic site at the 104th position in the DNA sequence of the nucleotide sequence as shown in SEQ ID NO:2; the SNP3 is a C / T polymorphic site at the 379th position in the DNA sequence of the nucleotide sequence as shown in SEQ ID NO:3; the SNP4 is an A / G polymorphic site at the 120th position in the DNA sequence of the nucleotide sequence as shown in SEQ ID NO:4. The present invention determines the growth phenotype data of grass carp cultured under the optimal salt tolerance concentration and resequencing the genome of the cultured grass carp to obtain the resequencing data, performs GWAS association analysis on the growth phenotype data and the genotype data, and screens out two SNP1 and SNP2 that are simultaneously related to body weight and body thickness and two SNP3 and SNP4 that are simultaneously related to body height and body thickness. The molecular marker is used as a detection target, and the genotype of the molecular marker is used to quickly determine whether the sample to be tested belongs to a salt-tolerant and fast-growing grass carp, providing a new means for quickly carrying out genetic breeding of grass carp. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 The phenotypic statistical results of the grass carp test group, where A is the extremely large and extremely small grass carp individuals; B is the statistical results of the weight and body length of the test group; C is the statistical results of the height and body thickness of the test group; D is the frequency distribution diagram of the weight of the test group; E is the frequency distribution diagram of the body length of the test group; F is the frequency distribution diagram of the height of the test group; G is the frequency distribution diagram of the body thickness of the test group;

[0029] Figure 2 The principal component analysis results of the grass carp experimental population;

[0030] Figure 3 NJ phylogenetic tree of the experimental population of grass carp;

[0031] Figure 4 is the K-fold cross validation error rate result, where K = 1-10;

[0032] Figure 5 This is the group structure diagram when K=7;

[0033] Figure 6 It is a heat map of kinship;

[0034] Figure 7 The results of genetic background analysis of the grass carp test population, where A is the LD decay diagram of the test population; B is the identification of high-quality SNPs and their distribution in the 24 chromosomes of grass carp; the gradient from green to red indicates the increase in SNP density within the 1Mb interval;

[0035] Figure 8 The results of GWAS analysis related to growth performance of the grass carp test group are shown in Figure 1, where A is the QQ plot related to body weight; B is the QQ plot related to body length; C is the QQ plot related to body height; D is the QQ plot related to body thickness; E is the QQ plot related to body weight; F is the QQ plot related to body length; G is the QQ plot related to body height; H is the QQ plot related to body thickness;

[0036] Fig. 9 The Sankey diagram of the association between SNP markers and growth traits, where BH: body height; BT: body thickness; BW: body weight;

[0037] Fig.10 The figures are the comparative results of the dominant genotype distribution of 300 verified grass carp populations, where A is the number of dominant genotype enriched tails; B is the statistics of dominant genotypes enriched in body weight traits; C is the statistics of dominant genotypes enriched in body length traits; D is the statistics of dominant genotypes enriched in body height traits; and E is the statistics of dominant genotypes enriched in body thickness traits. DETAILED DESCRIPTION

[0038] The invention provides a molecular marker related to the salt-tolerance and fast-growth trait of grass carp, comprising at least one of the following: SNP1, SNP2, SNP3 and SNP4; the SNP1 is a T / G polymorphic site at the 220th position in a DNA sequence such as a nucleotide sequence as shown in SEQ ID NO:1; the SNP2 is a G / T polymorphic site at the 104th position in a DNA sequence such as a nucleotide sequence as shown in SEQ ID NO:2; the SNP3 is a C / T polymorphic site at the 379th position in a DNA sequence such as shown in SEQ ID NO:3; and the SNP4 is an A / G polymorphic site at the 120th position in a DNA sequence such as a nucleotide sequence as shown in SEQ ID NO:4.

[0039] In the present invention, the screening method of the molecular markers includes screening the optimal salt tolerance concentration of grass carp, breeding grass carp in the water body with the optimal salt tolerance concentration of the screened grass carp, counting the growth phenotype of grass carp, and resequencing the genome of the grass carp at the same time, performing correlation analysis on the growth phenotype of grass carp and the resequencing data, and screening to obtain 4 SNP molecular markers related to the growth phenotype of grass carp. The verification shows that the 4 SNP molecular markers are all related to the salt-tolerant and fast-growing trait, and the more dominant genotypes of the enriched SNP molecular markers, the more obvious the salt-tolerant and fast-growing trait. At the same time, the relationship between the SNP molecular markers and gender is analyzed, and the results show that there is no gender linkage phenomenon in the salt-tolerant and fast-growing markers, and they can be used for salt-tolerant and fast-growing grass carp breeding.

[0040] The present invention provides amplification primers for molecular markers related to the salt-tolerance and rapid growth trait of grass carp, comprising at least one of the following primers: a SNP1 amplification primer, a SNP2 amplification primer, a SNP3 amplification primer and a SNP4 amplification primer; the SNP1 amplification primer comprises a forward primer having a nucleotide sequence as shown in SEQ ID NO:5 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO:6; the SNP2 amplification primer comprises a forward primer having a nucleotide sequence as shown in SEQ ID NO:7 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO:8; the SNP3 amplification primer comprises a forward primer having a nucleotide sequence as shown in SEQ ID NO:9 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO:10; the SNP4 amplification primer comprises a forward primer having a nucleotide sequence as shown in SEQ ID NO:11 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO:12.

[0041] In the present invention, the amplification primers can quickly amplify the molecular markers, and the amplification has good specificity. The amplification primers can realize the screening of salt-tolerant and fast-growing grass carp germplasm based on molecular markers related to the salt-tolerant and fast-growing traits of grass carp. The present invention does not place any special restrictions on the source of the amplification primers, and the primers can be obtained by methods known in the art, such as artificial synthesis. In an embodiment of the present invention, the amplification primers were commissioned to Yixin Biotechnology (Shanghai) Co., Ltd.

[0042] The invention provides a detection kit for salt-tolerant and fast-growing grass carp germplasm, comprising the amplification primers.

[0043] In the present invention, the detection kit preferably further comprises a PCR amplification premix. The present invention has no particular restrictions on the source of the PCR amplification premix, and the source of the PCR amplification premix known in the art can be used. In an embodiment of the present invention, the PCR amplification premix is ​​purchased from Takara Biotechnology (Dalian) Co., Ltd.

[0044] The present invention provides the use of the molecular markers related to the salt-tolerant and fast-growing traits of grass carp as detection targets, the amplification primers or the detection kit in detecting and / or screening salt-tolerant and fast-growing grass carp germplasm or salt-tolerant and fast-growing grass carp breeding.

[0045] In the present invention, the salt tolerance of the salt-tolerant and fast-growing grass carp germplasm is preferably 6‰ to 8‰, and can be 7‰. In one embodiment of the present invention, a screening experiment for the optimal tolerance of grass carp to salinity was carried out, and grass carp were cultured in salt water with final concentrations of 0‰, 4‰, 7‰, and 10‰, respectively. The growth performance and mortality of grass carp in different groups were statistically analyzed. The results showed that with the gradual increase in salinity, the weight of grass carp showed a downward trend, and the weight of grass carp in the 10‰ group was the lowest, at 71.08g. From the coefficient of variation of body weight, the coefficient of variation of the 7‰ group was the highest, at 14.36%, which shows that grass carp will show obvious phenotypic variation under this salinity, which is conducive to salt tolerance breeding.

[0046] In the present invention, the fast growth index in the salt-tolerant fast-growing grass carp germplasm preferably includes at least two of the following: body weight, body thickness and body height. Different types of molecular markers are associated with different growth indicators: SNP1 and SNP2 are associated with both body weight and body thickness; SNP3 and SNP4 are associated with both body height and body thickness.

[0047] The present invention provides a method for screening salt-tolerant and fast-growing grass carp based on the molecular marker, comprising the following steps:

[0048] Using the genomic DNA of the sample to be tested as a template, PCR amplification is performed using the amplification primers to obtain a PCR product;

[0049] Analyze the genotype of the molecular marker in the PCR product, and determine whether the sample to be tested belongs to the salt-tolerant and fast-growing grass carp according to the genotype of the molecular marker in the PCR product:

[0050] When the sample to be tested contains at least one dominant genotype, it is judged that the sample to be tested belongs to the salt-tolerant and fast-growing grass carp; otherwise, the sample to be tested does not belong to the salt-tolerant and fast-growing grass carp;

[0051] The dominant genotype of the SNP1 is TT, the dominant genotype of the SNP2 is GG, the dominant genotype of the SNP3 is CC, and the dominant genotype of the SNP4 is AG.

[0052] The present invention uses the genomic DNA of the sample to be tested as a template and utilizes the amplification primers to perform PCR amplification to obtain a PCR product.

[0053] The present invention has no special restrictions on the extraction method of the genomic DNA of the sample to be tested, and the genomic DNA extraction method known in the art can be used, for example, using a commercial detection kit. The sample to be tested includes grass carp blood, fins or scales.

[0054] In the present invention, the reaction volume of the PCR amplification is preferably 20 μl, including the following components: 10 μL Premix Ex Taq, 8 μL ddH2O, 1 μL 10 μM forward primer, 1 μL 10 μM reverse primer, 1 μL 50 ng / μl DNA template. The reaction conditions of the PCR amplification are: 95°C for 5 min; 95°C for 30 s, 52°C for 30 s, 72°C for 50 s, 35 cycles; 72°C for 5 min.

[0055] After obtaining the PCR product, the present invention analyzes the genotype of the molecular marker in the PCR product, and determines whether the sample to be tested belongs to the salt-tolerant and fast-growing grass carp according to the genotype of the molecular marker in the PCR product.

[0056] In the present invention, the analysis method of the genotype of the molecular marker in the PCR product preferably includes sequencing. Experiments show that the more dominant genotypes are enriched in the sample to be tested, the higher the growth trait value of the grass carp individual from which the sample to be tested is derived, and the enrichment of 4 dominant genotype individuals has the highest 4 trait values, which are 10.10%, 1.31%, 5.73% and 5.71% higher than those of only 3 dominant genotype individuals in the 4 traits. Compared with only 1 dominant genotype individual, the 4 traits are increased by 48.02%, 8.99%, 18.65% and 19.35% respectively. Therefore, the screening purpose can be achieved by using 1 SNP molecular marker, 2 molecular markers, 3 molecular markers and 4 molecular markers. The more molecular markers are selected, the better the performance of the screened grass carp in salt tolerance and rapid growth.

[0057] The molecular marker related to the salt-tolerance and rapid growth trait of grass carp provided by the present invention and its application are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0058] Example 1

[0059] Determination of salinity concentration for screening salt tolerance and rapid growth of grass carp

[0060] The grass carp used in this experiment were selected from a random group of one-year-old fish bred in Suzhou Future Aquaculture Farm, totaling 3,000 fish. The fish were neatly sized, intact in body surface, healthy and disease-free. Before the experiment began, the grass carp were temporarily kept in cement pools for one week. Commercial feed was fed regularly at 8:00 and 17:00 every day, and the amount of feed was about 1% to 2% of the fish body weight. During the temporary period, the water temperature was maintained at 24-26℃, and the dissolved oxygen was >7mg / L.

[0061] In order to determine the salinity concentration suitable for salt-tolerant grass carp breeding, the growth performance and mortality of grass carp under different salinities were first evaluated. Four treatment groups were set up, 0‰, 4‰, 7‰, and 10‰, with three parallels in each treatment group. The experiment was conducted in 12 round plastic buckets, and 30 grass carps (53.56±3.21g) with good physique were randomly placed in each bucket. In order to reduce the acute stress response of grass carp, sea crystal (Chuangyi Biotechnology Co., Ltd., Shanghai) was used to prepare water with corresponding salinity, and the salinity was increased at a rate of 2‰ / day. When the salinity exceeded 6‰, the salinity was increased by 1‰ / day to the target salinity. A portable salinometer was used to monitor the salinity of the water body to ensure that the salinity of the water body was maintained at the set value. The experiment started when the salinity of each group reached the set value. During the experiment, other breeding conditions, such as dissolved oxygen, water temperature, and feeding frequency, were consistent with the temporary breeding period. The breeding experiment lasted for 60 days. After the end, the weight data of the experimental fish were accurately measured and recorded.

[0062] The experimental results show that as the salinity gradually increases, the weight of grass carp shows a downward trend, and the weight of grass carp in the 10‰ group is the lowest, at 71.08g. From the perspective of the coefficient of variation of body weight, the coefficient of variation in the 7‰ group is the highest, at 14.36%, which indicates that grass carp will show obvious phenotypic variation under this salinity, which is conducive to salt-tolerant breeding. In addition, from the perspective of survival rate, the survival rate of the 0-7% group is not significantly different, while the survival rate of grass carp in the 10% group drops sharply, and the low survival rate is not conducive to the development of breeding work. In summary, salinity below 7‰ was selected for grass carp growth performance testing, so as to explore salt-tolerant related sites.

[0063] Table 1 Comparison of growth performance and mortality of grass carp at different salinities

[0064] index 0‰ 4‰ 7‰ 10‰ Average initial body weight (g) 53.56±2.65 52.98±2.28 54.39±2.88 53.79±3.04 Average final body weight (g) 112.31±7.82 103.62±8.65 85.89±12.33 71.08±5.46 Weight variation coefficient (%) 6.96 8.35 14.36 7.68 Survival rate (%) 97.8±1.92 94.4±3.85 88.8±5.09 54.44±8.39

[0065] Example 2

[0066] Screening and verification of SNPs associated with salt tolerance and rapid growth in grass carp

[0067] A total of 500 grass carps with an initial weight of 51.56±3.62g were selected and placed in a cement pool (4.7×8.3×1.3m) in fresh water for temporary breeding for one week. According to the salinity concentration of salt-tolerant grass carp in Example 1, the target salinity was set to 7‰, and the salinity improvement method was the same as in Example 1. The experiment lasted for 2 months, and commercial puffed feed (crude protein content 32%, crude fat content 5%) was fed once a day in the morning and evening during the experiment. Fasting for 24h before sampling, 200 grass carps were randomly caught, anesthetized with MS-222 for about 10min, and the weight (BW), body length (BL), body height (BH), and body thickness (BT) of the experimental fish were measured and recorded. About 0.5g of the tail fin was cut and quickly frozen in liquid nitrogen, and promptly transferred to a -80°C refrigerator for storage. According to the manufacturer's instructions, genomic DNA in the tail fin sample was extracted using a genomic DNA extraction kit (Vazyme, Nanjing, China). DNA samples of 200 grass carps were randomly collected and sent to Painuosen Biotechnology Co., Ltd. for resequencing and subsequent GWAS association analysis.

[0068] The results showed that there were differences in growth performance among the tested groups of grass carp ( Figure 1 Middle A), average body weight was 82.42±16.31g, average body length was 17.34±0.94cm, average body height was 3.42±0.25cm, and average body thickness was 2.44±0.21cm ( Figure 1 B and C), each trait is normally distributed ( Figure 1 (in DG).

[0069] The genetic background and kinship of the grass carp population were studied by principal component analysis, kinship analysis and population structure analysis. The principal component analysis showed that there was no obvious stratification in the experimental population ( Figure 2 The phylogenetic tree based on the NJ method showed that there was no obvious branching clustering in the experimental population ( Figure 3 ). In the population genetic structure analysis, the cross-validation error decreases continuously with the increase of K value, reaching the minimum value when K = 7. This indicates that the experimental population is likely to be divided into 7 subgroups ( Figure 4 and Figure 5 ). The kinship heat map shows that the genetic correlation of the experimental population is weak, as most of the correlation values ​​are below 0.5 ( Figure 6 ). The above results indicate that the genetic background of the experimental grass carp population is rich and there is no obvious human interference and selection.

[0070] Figure 7Figure A shows that the linkage disequilibrium (LD) of the salt-tolerant grass carp population decays very quickly, indicating a high level of genetic diversity within the population. The SNP density map shows the number of SNPs per 1Mb on each chromosome, showing that the SNPs on the 24 chromosomes are relatively evenly distributed ( Figure 7 (middle B).

[0071] The growth phenotype data were associated with the genotype data, and the suggestive threshold was set at 6.785. Sites with P values ​​reaching this threshold were considered key targets. A total of 7 SNPs potentially associated with growth were found, including Figure 8 As shown. Among them, there are 3 SNP sites related to weight, 2 SNP sites related to height, 6 SNP sites related to body thickness, and no SNP sites related to body length were found. It is worth noting that there are 2 SNPs associated with both weight and body thickness, namely chr17-118382 and chr23-8110438, and there are also 2 SNPs associated with both height and body thickness, namely chr03-52363181 and chr04-12090100( Fig. 9 ).

[0072] The correlation between two SNPs associated with both body weight and body thickness: chr17-118382 and chr23-8110438 and two SNPs associated with both body height and body thickness: chr03-52363181 and chr04-12090100 and the growth performance of grass carp under 7‰ salinity was analyzed. The growth trait results corresponding to different genotypes of the four SNP markers are shown in Table 2. The individuals with the TT genotype of SNP chr17-118382, the GG genotype of SNP chr23-8110438, the CC genotype of SNP chr03-52363181 and the AG genotype of SNP chr04-12090100 had the highest values ​​in the four traits of body weight, body length, body height and body thickness, and had significant differences in growth traits with individuals with other genotypes, and could be regarded as growth-dominant genotypes.

[0073] Table 2 Distribution of growth traits of grass carp corresponding to different genotypes of the four SNP markers (n=200)

[0074]

[0075] Note: Different letters in each column indicate significant differences among different genotypes of SNP loci (P<0.05).

[0076] The physical locations and sequence information of these four SNP sites are shown in Table 3. SNP: chr17-118382 is located at position 118382 of chromosome 17 of grass carp, which is the 220th position of the corresponding sequence in Table 3, where the base at position 220 is T (thymine) or G (guanine); SNP: chr23-8110438 is located at position 8110438 of chromosome 23 of grass carp, which is the 104th position of the corresponding sequence in Table 3, where the base at position 104 is G (guanine). SNP: chr03-52363181 is located at position 52363181 of chromosome 3 of grass carp, which is the 380th position of the corresponding sequence in Table 3, wherein the base at position 380 is C (cytosine) or T (thymine); SNP: chr04-12090100 is located at position 12090100 of chromosome 4 of grass carp, which is the 120th position of the corresponding sequence in Table 3, wherein the base at position 120 is A (adenine) or G (guanine).

[0077] Table 3 SNPs associated with salt tolerance and rapid growth of grass carp

[0078]

[0079]

[0080] Based on the information of the four SNP sites located in Table 3, specific primers were designed, as shown in Table 4.

[0081] Table 4 SNP primer sequences related to salt tolerance and rapid growth of grass carp

[0082]

[0083]

[0084] In addition, 500 grass carps were selected from the basic population of 3,000 grass carps as the verification population and raised at a salinity of 7‰ for 2 months. The feeding and management methods were the same as above. After the breeding, 300 grass carps were randomly caught to measure the growth traits such as BW, BL, BH, BT as phenotypic data, and then the tail fins were cut and preserved and DNA was extracted in the above manner. Using grass carp genomic DNA as a template, PCR amplification was performed using the primers shown in Table 4. The amplification volume was 20μl, including 10μL Premix Ex Taq, 8μL ddH2O, 1μL forward and reverse primers (10uM), and 1μL DNA template (50ng). The amplification conditions were: 95℃5min; 95℃30s, 52℃30s, 72℃50s, 35 cycles; 72℃5min. The PCR products were detected by 0.8% agarose gel electrophoresis, and the qualified products were subjected to Sanger sequencing.

[0085] Sanger sequencing showed that among the 300 grass carps, 4 dominant genotypes were enriched at most, 0 dominant genotypes were enriched at least, and the number of individuals enriched with 3 dominant genotypes was the largest. The distribution of the number of dominant genotype enrichment tails was spindle-shaped ( Fig.10 A). The results of growth trait analysis of the number of enriched dominant genotypes in the enriched population showed that ( Fig.10 In the BE, the more the number of enriched dominant genotypes, the higher the values ​​of the four traits, showing an upward trend. The four trait values ​​of individuals enriched with four dominant genotypes were the highest, which were 10.10%, 1.31%, 5.73% and 5.71% higher than those of individuals with only three dominant genotypes. Compared with individuals with only one dominant genotype, the four traits were increased by 48.02%, 8.99%, 18.65% and 19.35% respectively, which shows that the aggregation effect of dominant genotypes is significant, and these four SNP sites can be used for the screening of salt-tolerant and fast-growing grass carp parents.

[0086] Example 3

[0087] Sex linkage analysis of salt tolerance and fast growth SNP markers

[0088] The sex-specific molecular marker Sca971_3_652 of grass carp, F: CTTGTGTTTGTGTAAAGTGAGAGTG (SEQ ID NO: 13); R: TACAGGTGAAGGAATAAAATCAGTC (SEQ ID NO: 14), was used to identify the sex of 78 grass carps enriched with 4 dominant genotypes in the validation population of Example 2. The PCR amplification system and procedure were the same as those described in Example 2. By distinguishing the male-female ratio of these 78 salt-tolerant and fast-growing grass carps, it was analyzed whether the enrichment of salt-tolerant and fast-growing markers was related to the sex difference of grass carp.

[0089] Table 5 Relationship between salt tolerance and fast growth markers and grass carp gender

[0090] index Male fish Female fish quantity 45 33

[0091] The results showed (Table 5) that the enrichment of the four salt-tolerant and fast-growth markers existed in both male and female individuals, and there was no sex-linked phenomenon in the salt-tolerant and fast-growth markers, which can be used for the breeding of salt-tolerant and fast-growth grass carp.

[0092] Example 4

[0093] Application of special molecular marker combination in grass carp breeding

[0094] In Yangzhong, Jiangsu, six half-acre ponds were selected to compare the salt-tolerant growth performance of grass carp. Three half-acre ponds were selected to place salt-tolerant F1 grass carp fry at a density of 500 per acre. Another three half-acre ponds were selected to place unselected control group grass carp fry at a density of 500 per acre. The pond salinity was adjusted to 7‰ using the method of Example 1. Feed with a protein content of 32% was fed twice a day. The feeding amount was about 3% of the fish body weight, and the pond was patrolled 3 to 4 times a day to check the water color and the fish conditions. The aerator was turned on in time on rainy days to record the incidence and death of the fish. The breeding experiment lasted for 120 days, and the experimental results are shown in Table 6.

[0095] Table 6 Comparative experiment on growth of grass carp in salt tolerance breeding group and control group

[0096] Group Average initial body weight (g) Average final body weight (g) Breeding F1 grass carp for salt tolerance 15.38±1.67 183.31±10.66* Grass carp 16.12±2.14 148.47±12.31

[0097] Note: * indicates significant difference (P<0.05).

[0098] The growth comparison results showed that the growth rate of the salt-tolerant F1 grass carp was 23.60% faster than that of the control group under a salinity of 7‰, and the growth rate of the breeding group was significantly improved.

[0099] The results of the above embodiments show that the molecular marker-assisted breeding technology for salt-tolerant and fast-growing grass carp germplasm provided by the present invention can quickly achieve the polymerization of multiple fast-growing markers, effectively improve the growth rate of the selected offspring, and the growth rate of the F1 generation is 23.60% higher than that of the control group.

[0100] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A molecular marker related to the salt tolerance and rapid growth trait of grass carp, characterized in that: Includes at least one of the following: SNP1, SNP2, SNP3 and SNP4; The SNP1 is a T / G polymorphic site at position 220 in the DNA sequence shown in SEQ ID NO: 1; The SNP2 is a G / T polymorphic site at position 104 in the DNA sequence shown in SEQ ID NO: 2; The SNP3 is a C / T polymorphic site at position 379 in the DNA sequence shown in SEQ ID NO: 3; The SNP4 is an A / G polymorphic site at position 120 in the DNA sequence shown in SEQ ID NO:

4.

2. A primer for amplifying a molecular marker related to the salt tolerance and rapid growth trait of grass carp according to claim 1, characterized in that: The method comprises at least one of the following primers: a SNP1 amplification primer, a SNP2 amplification primer, a SNP3 amplification primer and a SNP4 amplification primer; The SNP1 amplification primers include a forward primer having a nucleotide sequence as shown in SEQ ID NO:5 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO:6; The SNP2 amplification primers include a forward primer having a nucleotide sequence as shown in SEQ ID NO:7 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO:8; The SNP3 amplification primers include a forward primer having a nucleotide sequence as shown in SEQ ID NO:9 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO:10; The SNP4 amplification primers include a forward primer having a nucleotide sequence as shown in SEQ ID NO:11 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO:

12.

3. A detection kit for salt-tolerant and fast-growing grass carp germplasm, characterized in that: Comprising the amplification primers according to claim 3.

4. The detection kit according to claim 3, characterized in that: Also includes PCR amplification master mix.

5. Use of the molecular marker related to the salt-tolerant and fast-growing trait of grass carp as claimed in claim 1 as a detection target, the amplification primer as claimed in claim 2 or the detection kit as claimed in claim 3 or 4 in detecting and / or screening salt-tolerant and fast-growing grass carp germplasm or salt-tolerant and fast-growing grass carp breeding.

6. The use according to claim 5, characterized in that: The salt-tolerant and fast-growing grass carp germplasm tolerates a salinity of 6‰ to 8‰.

7. The use according to claim 5 or 6, characterized in that: The rapid growth indicators in the salt-tolerant and fast-growing grass carp germplasm include at least two of the following: body weight, body thickness and body height.

8. A method for screening salt-tolerant and fast-growing grass carp based on the molecular markers of claim 1, characterized in that: The following steps are involved: Using the genomic DNA of the sample to be tested as a template, performing PCR amplification using the amplification primers described in claim 2 to obtain a PCR product; Analyze the genotype of the molecular marker in the PCR product, and determine whether the sample to be tested belongs to the salt-tolerant and fast-growing grass carp according to the genotype of the molecular marker in the PCR product: When the sample to be tested contains at least one dominant genotype, it is judged that the sample to be tested belongs to the salt-tolerant and fast-growing grass carp; otherwise, the sample to be tested does not belong to the salt-tolerant and fast-growing grass carp; The dominant genotype of the SNP1 is TT, the dominant genotype of the SNP2 is GG, the dominant genotype of the SNP3 is CC, and the dominant genotype of the SNP4 is AG.

9. The screening method according to claim 8, characterized in that: The reaction volume of the PCR amplification was 20 μl, including the following components: 10 μl Premix Ex Taq, 8 μl ddH2O, 1 μl 10 μM forward primer, 1 μl 10 μM reverse primer, and 1 μl 50 ng / μl DNA template.

10. The screening method according to claim 8 or 9, characterized in that: The reaction conditions of the PCR amplification are: 95°C for 5 min; 95°C for 30 s, 52°C for 30 s, 72°C for 50 s, 35 cycles; 72°C for 5 min.

Images