Primer and probe combination and kit for MAT gene detection of morchella esculenta

Abstract

The invention belongs to the technical field of gene detection, and provides a primer and probe combination and a kit for MAT gene detection of morchella esculenta. The primer and probe combination comprises an MAT1-1-1L / MAT1-1-1R primer, a probe P1-1-1, an MAT1-2-1L / MAT1-2-1R primer, and a probe P1-2-1. The kit comprises the combination of the primer and the probe, # imgabs0 # Univertal Probe qPCR (Quantitative Polymerase Chain Reaction) Master Mix, and Water Nuclease-Free. The invention further discloses a kit for detecting whether the kit is used for detecting whether the kit is used for detecting whether the kit is used for detecting whether the kit is used for detecting whether the kit is used for detecting. Compared with the prior art, the kit has the characteristics of high sensitivity, high specificity and high stability, the procedure is simple, the detection time is short, the result is stable, clear, reliable and easy to break, and the detection efficiency of the MAT gene is improved. The method can be used in the aspects of morchella strain breeding, strain quality detection, cultivation application and the like.

Description

Technical Field

[0001] The present invention belongs to the technical field of gene detection, and in particular relates to a primer and probe combination and a kit for Morchella MAT gene detection. Background Art

[0002] Morchella belongs to the kingdom Fungi, subphylum Ascomycota, class Pechimycetes, orders Pechimycetes, family Morchellaceae, genus Morchella. It is a world-famous rare wild edible and medicinal mushroom with a unique aroma and rich nutrition. There are many species of Morchella. Using the multi-gene lineage consensus phylogenetic species identification method (GCPSR), Morchella fungi are divided into the yellow Morchella clade (Esculenta Clade), the black Morchella clade (Elata Clade) and the red Morchella clade (Rufobrunnea Clade) (Du Xihui et al., 2014). Most of the cultivated Morchella in my country belong to the black Morchella lineage, and artificial cultivation has achieved great success. However, there are reasons for the instability of Morchella fruiting in production practice. In addition to poor field management leading to unsuitable factors such as light, temperature, moisture, and ventilation, this is closely related to the lack of MAT genes (MAT1-1-1 genotype and MAT1-2-2 genotype) of Morchella. The lack of any MAT genotype (MAT1-1-1 and MAT1-2-2) will lead to weak fruiting ability or no fruiting; only when MAT1-1-1 and MAT1-2-1 type hyphae exist at the same time, Morchella has the ability to fruit. Therefore, Morchella species that can successfully fruit must have both MAT1-1-1 and MAT1-2-1 type hyphae. (Xi-Hui Du et al., 2017). The existing methods for detecting the MAT gene of Morchella (CN107151698A, CN106282396A, CN106282397A, CN106282370A, CN201911418237, etc.) are all based on ordinary PCR amplification of the extracted genomic DNA, and then obtaining electrophoresis bands by gel electrophoresis, which are compared with the expected bands to determine whether the MAT gene is missing. The procedures are cumbersome, the detection time is long, the efficiency is low, and it is difficult to fully meet the production needs. Summary of the invention

[0003] To solve the problems of the prior art, the present invention provides a primer and probe combination and a kit for detecting the MAT gene of Morchella, which can realize the rapid detection of the MAT gene. Compared with the previous detection methods, the present invention has the characteristics of high sensitivity, high specificity and high stability, simple procedures, short detection time, stable, clear, reliable and easy results, and improves the detection efficiency of the MAT gene. This method can be used in Morchella strain breeding, strain quality detection and cultivation application.

[0004] The primer and probe combination for detecting the MAT gene of Morchella provided by the present invention is characterized in that the primer and probe combination is used for detecting the combination of gene MAT, and the primer and probe combination comprises: a forward primer S, a reverse primer A, and a probe P of gene MAT, and the nucleotide sequences are respectively: MAT1-1-1L forward primer S 5′GTGAGAACCCRCCTTCTGAGT 3′, MAT1-1-1R reverse primer A 5′GCCTCGGTCTTGCATTAAAAG 3′, and probe P1-1-1: 5′FAM-TTATGCTCATGGACGCTAT-NFQ-MGB 3′; MAT1-2-1L forward primer S 5′TGCGTCCGAAGAATAGCTCTACT3′, MAT1-2-1R reverse primer A 5′AGGGTCACGGCGRGGTTTRA 3′, and probe P1-2-1: 5′VIC-TCGGCCAGAACAGATG-NFQ-MGB 3′.

[0005] The primer and probe combination for detecting the Morchella MAT gene provided by the present invention also has the following technical features: the 5′ end of the probe P1-1-1 of the gene MAT is modified to a fluorescent reporter group FAM, and the 3′ end is modified to a non-fluorescent quencher group MGB; the 5′ end of the probe P1-2-1 is modified to a fluorescent reporter group VIC, and the 3′ end is modified to a non-fluorescent quencher group MGB.

[0006] The present invention also provides a kit for detecting Morchella MAT gene, characterized in that the kit comprises the above primer and probe combination.

[0007] The kit for detecting the MAT gene of Morchella provided by the present invention also has the following technical features: Universal Probe qPCR Master Mix, Water Nuclease-Free, MAT1-1-1L / MAT1-1-1R primers and probe P1-1-1, and MAT1-2-1L / MAT1-2-1R primers and probe P1-2-1.

[0008] The kit for detecting the MAT gene of Morchella provided by the present invention also has such a technical feature that the method for using the kit comprises the following steps: step 1, extracting RNA of the sample to be tested; step 2, reverse transcribing cDNA; step 3, using the cDNA as a template, using the primer and probe combination in the kit to perform a fluorescent PCR amplification reaction to obtain a fluorescent detection result; step 4, using the fluorescent detection result to determine the sample to be tested, and the determination method is as follows:

[0009] When the primer pair MAT1-1-1L / MAT1-1-1R and the probe P1-1-1 are used for fluorescence quantitative PCR, if there is an obvious amplification curve in the FAM channel, the sample can be judged as a positive result, indicating that the PCR result of the MAT1-1-1 genotype is positive; when the primer pair MAT1-2-1L / MAT1-2-1R and the probe P1-2-1 are used for PCR fluorescence quantitative PCR, if there is an obvious amplification curve in the VIC channel, the sample can be judged as a positive result, indicating that the PCR result of the MAT1-2-1 genotype is positive.

[0010] When the primer pair MAT1-1-1L / MAT1-1-1R and the probe P1-1-1 are used for fluorescence quantitative PCR, if there is no amplification curve in the FAM channel, it indicates that the PCR reaction result of the MAT1-1-1 genotype is negative; when the primer pair MAT1-2-1L / MAT1-2-1R and the probe P1-2-1 are used for PCR fluorescence quantitative PCR, if there is no amplification curve in the VIC channel, it indicates that the PCR reaction result of the MAT1-2-1 genotype is negative.

[0011] If the results of the MAT1-1-1 genotype and the MAT1-2-1 genotype tests are both positive, it means that the strain contains both genotypes, indicating that the strain has the potential to produce mushrooms. If the results of the MAT1-1-1 and MAT1-2-1 genotype tests are negative or both are negative, it means that one or all of the MAT genotypes are missing, and the strain has a poor potential to produce mushrooms or cannot produce mushrooms.

[0012] The kit for detecting the Morchella MAT gene provided by the present invention also has such a technical feature, wherein the reaction system used in the fluorescent PCR amplification reaction in step 3 includes: Universal Probe qPCR Master Mix 7.5μl, 2.5μM gene primers (upstream + downstream) 1.5μl, probe 0.75μl, reverse transcription product (cDNA) 2.0μl, WaterNuclease-Free 3.25μl.

[0013] The kit for detecting Morchella MAT gene provided by the present invention also has such technical characteristics, wherein the procedure of the fluorescence PCR amplification reaction in step 3 is: pre-denaturation at 95°C for 30s; denaturation at 95°C for 15s, annealing / extension at 60°C for 30s, and 40 cycles.

[0014] Functions and Effects of the Invention

[0015] Compared with the prior art, the technical advantages of the present invention are as follows:

[0016] (1) The primer and probe combination used in the kit of the present invention is used to detect the MAT gene, which is closely related to the development of Morchella fruiting body. The target gene region selected by the present invention is aimed at the exon region of the Morchella MAT gene, which improves the detection specificity relative to the detection of the intron variable region of the MAT gene.

[0017] (2) The primer and probe combination used in the kit of the present invention has improved detection efficiency and higher sensitivity and specificity due to the design of degenerate primers and the modification of probes with a non-fluorescent quencher MGB.

[0018] (3) The primer and probe combination used in the kit of the present invention does not require gel running, which simplifies the detection process, reduces human intervention, reduces operational complexity, and at the same time improves the consistency and reliability of the detection, ensures the stability and verifiability of the detection results, and provides high-quality detection results. These characteristics make the kit very suitable for application and promotion in production, and help to improve production efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 This is the MAT1-1-1 amplification curve for detecting M.eximia according to an embodiment of the present invention.

[0020] Figure 2 This is the MAT1-2-1 amplification curve for detecting M.eximia according to an embodiment of the present invention.

[0021] Figure 3 This is the amplification curve of MAT1-1-1 for detecting M. sextalata in the embodiment of the present invention.

[0022] Figure 4 This is the MAT1-2-1 amplification curve for detecting M. sextalata in an embodiment of the present invention. DETAILED DESCRIPTION

[0023] The terms used in the present invention, unless otherwise specified, generally have the meanings that are commonly understood by those of ordinary skill in the art.

[0024] In the following examples, various processes and methods not described in detail are conventional methods well known in the art.

[0025] The reagents used in the following examples were purchased from common commercial sources, and the experimental operations and experimental conditions not specified were referred to the conventional operations and conventional conditions in the art.

[0026] The specific implementation of the present invention is described below in conjunction with embodiments and drawings.

[0027] Example 1: Primers and probes used in the present invention

[0028] The primers and probes used in the present invention are as follows:

[0029] MAT1-1-1 primer sequence:

[0030] Forward Primer S 5′GTGAGAACCCRCCTTCTGAGT 3′

[0031] Reverse Primer A 5′GCCTCGGTCTTGCATTAAAAG 3′

[0032] Probe P1-1-1: FAM-TTATGCTCATGGACGCTAT-NFQ-MGB 3′

[0033] MAT1-2-1 primer sequence:

[0034] Forward Primer S 5′TGCGTCCGAAGAATAGCTCTACT 3′

[0035] Reverse Primer A 5′AGGGTCACGGCGRGGTTTRA 3′

[0036] Probe P1-2-1: 5′VIC-TCGGCCAGAACAGATG-NFQ-MGB 3′

[0037] Example 2: Method for detecting MAT gene

[0038] (1) Total RNA extraction:

[0039] 1) Preheat the CTAB extract in a 65°C water bath and add 2% β-mercaptoethanol before use.

[0040] 2) Collect the fungal samples to be tested in a centrifuge tube.

[0041] 3) Pipette 1 mL of preheated CTAB extract into the centrifuge tube from the previous step, vortex vigorously for 30 seconds, and return to the 65°C water bath for a short period of time (4 to 5 minutes).

[0042] 4) Add an equal volume of chloroform / isoamyl alcohol (24:1, v / v) and vortex mix, and centrifuge at 12000 rpm for 20 min at room temperature.

[0043] 5) Transfer the supernatant to a new centrifuge tube and repeat the extraction once.

[0044] 6) Transfer the supernatant to a new centrifuge tube and add 10 mol / L LiCl 2 , that is, add 1 / 3 volume of LiCl 2 , and precipitate at 4°C overnight (maximum 16 h).

[0045] 7) Centrifuge at 4°C, 12000 rpm for 20 min, discard the supernatant, wash the precipitate with 500 μL 70% ethanol, and then wash the precipitate with 500 μL 100% ethanol.

[0046] 8) Dissolve the precipitate with 500 μL SSTE, transfer to a 1.5 mL centrifuge tube, and add an equal volume of chloroform / isoamyl alcohol (24:1, v / v) to extract once.

[0047] 9) Add 2 volumes of anhydrous ethanol and precipitate at -70°C for 30 min or -20°C for 2 h.

[0048] 10) Centrifuge at 12000 rpm at 4°C for 20 min to precipitate RNA.

[0049] 11) Wash the precipitate with 400 μL 70% ethanol first, then wash the precipitate with 400 μL 100% ethanol. Centrifuge at 4°C, 12000 rpm for 5 min, pour off the liquid, blow dry, and add 15 μL RNA dissolving solution to dissolve the RNA.

[0050] 12) Use Nanodrop 2000 to detect RNA concentration and purity: After the instrument is blanked and zeroed, take 2.5 μl of the RNA solution to be tested on the detection base, put down the sample arm, and use the software on the computer to start absorbance detection.

[0051] 13) Dilute the RNA with too high concentration in an appropriate ratio to make the final concentration 200 ng / μl.

[0052] Note: Use sterile and enzyme-free pipette tips and centrifuge tubes.

[0053] (2) Reverse transcription:

[0054] Reverse transcription was completed on a common PCR instrument using a reverse transcription kit suitable for qPCR. Reverse transcription reaction system: 5×SweScript All-in-One SuperMix for qPCR, 4μL; gDNA Remover, 1μL; Total RNA, 10μL; RNase free water, Add to 20μL. Reverse transcription program: 25℃, 5min; 42℃, 30min; 85℃, 5sec.

[0055] (3) Quantitative PCR

[0056] 1) Take 0.1ml PCR reaction plate and prepare the following reaction system: 2×Universal Blue Probe qPCR Master Mix, 7.5μl; 2.5μM MAT1-1-1 or MAT1-2-1 gene primers (upstream + downstream), 1.5μl; probe 0.75μl; MAT1-1-1 or MAT1-2-1 gene reverse transcription product (cDNA), 2.0μl; Water Nuclease-Free, 3.25μl. Prepare 3 tubes for each reverse transcription product. After spotting, use PCR plate sealing film with a sealing instrument to complete the film sealing, and centrifuge with a microplate centrifuge.

[0057] 2) Complete PCR amplification on a fluorescent quantitative PCR instrument. Amplification program: pre-denaturation at 95°C for 30 seconds; denaturation at 95°C for 15 seconds; annealing / extension at 60°C for 30 seconds.

[0058] Example 3: Detection results of the present invention on the test sample M.eximia

[0059] The primers and probes shown in Example 1 were used to perform PCR detection on the MAT gene of M. eximia on a fluorescent quantitative PCR instrument according to the method of Example 2. The detection results are as follows: Figure 1 and Figure 2 As shown. Figure 1 and Figure 2 It can be seen that the present invention has obvious amplification curves for MAT1-1-1 and MAT1-2-1 in the FAM channel and the VIC channel, respectively, and can perform good detection.

[0060] Example 4: Detection results of the present invention on the test sample M. sextalata

[0061] The primers and probes shown in Example 1 were used to perform PCR detection on the MAT gene of M. sextalata using a fluorescent quantitative PCR instrument according to the method of Example 2. The detection results are as follows: Figure 3 and Figure 4 As shown. Figure 3 and Figure 4 It can be seen that the present invention has obvious amplification curves for MAT1-1-1 and MAT1-2-1 in the FAM channel and the VIC channel, respectively, and can perform good detection.

Claims

1. A specific primer pair MAT1-1-1L / MAT1-1-1R and probe P1-1-1 combination and a specific primer pair MAT1-2-1L / MAT1-2-1R and probe P1-2-1 combination for detecting the MAT gene of Morchella, characterized in that: The primer and probe combination includes: MAT1-1-1L forward primer S 5′GTGAGAACCCRCCTTCTGAGT 3′ MAT1-1-1R reverse primer A5′GCCTCGGTCTTGCATTAAAAG 3′ Probe P1-1-1: 5′FAM-TTATGCTCATGGACGCTAT-NFQ-MGB 3′ MAT1-2-1L forward primer S 5′TGCGTCCGAAGAATAGCTCTACT 3′ MAT1-2-1R reverse primer A 5′AGGGTCACGGCGRGGTTTRA3′ Probe P1-2-1: 5′VIC-TCGGCCAGAACAGATG-NFQ-MGB 3′.

2. The primer combination for MAT gene detection according to claim 1, characterized in that: in, The forward primer of the gene MAT1-1-1L contains one degenerate base R, and the reverse primer MAT1-2-1R contains two degenerate bases R.

3. The probe for MAT gene detection according to claim 1, characterized in that: in, The 5′ end of probe P1-1-1 was modified with a fluorescent reporter group FAM, and the 3′ end was modified with a non-fluorescent quencher group MGB; the 5′ end of probe P1-2-1 was modified with a fluorescent reporter group VIC, and the 3′ end was modified with a non-fluorescent quencher group MGB.

4. A kit for detecting Morchella MAT gene, characterized in that: The kit comprises the primer and probe combination as claimed in claim 1.

5. The kit for detecting Morchella MAT gene according to claim 4, characterized in that: The kit also includes Universal Probe qPCR Master Mix, Water Nuclease-Free, MAT1-1-1L / MAT1-1-1R primers and probe P1-1-1, and MAT1-2-1L / MAT1-2-1R primers and probe P1-2-1.

6. The kit for detecting Morchella MAT gene according to claim 5, characterized in that: The method for using the kit comprises the following steps: Step 1, extracting RNA from the sample to be tested; Step 2, reverse transcription of cDNA; Step 3, using the cDNA as a template, and using the primer and probe combination in the kit to perform a fluorescent PCR amplification reaction to obtain a fluorescent detection result; Step 4: using the fluorescence detection result, determine the sample to be tested, and the determination method is as follows: When the primer pair MAT1-1-1L / MAT1-1-1R and the probe P1-1-1 are used for fluorescence quantitative PCR, if there is an obvious amplification curve in the FAM channel, the sample can be judged as a positive result, indicating that the PCR result of the MAT1-1-1 genotype is positive; when the primer pair MAT1-2-1L / MAT1-2-1R and the probe P1-2-1 are used for PCR fluorescence quantitative PCR, if there is an obvious amplification curve in the VIC channel, the sample can be judged as a positive result, indicating that the PCR result of the MAT1-2-1 genotype is positive. When the primer pair MAT1-1-1L / MAT1-1-1R and the probe P1-1-1 are used for fluorescence quantitative PCR, if there is no amplification curve in the FAM channel, it indicates that the PCR reaction result of the MAT1-1-1 genotype is negative; when the primer pair MAT1-2-1L / MAT1-2-1R and the probe P1-2-1 are used for PCR fluorescence quantitative PCR, if there is no amplification curve in the VIC channel, it indicates that the PCR reaction result of the MAT1-2-1 genotype is negative. If the results of the MAT1-1-1 genotype and the MAT1-2-1 genotype tests are both positive, it means that the strain contains both genotypes, indicating that the strain has the potential to produce mushrooms. If the results of the MAT1-1-1 and MAT1-2-1 genotype tests are negative or both are negative, it means that one or all of the MAT genotypes are missing, and the strain has a poor potential to produce mushrooms or cannot produce mushrooms.

7. The kit for detecting Morchella MAT gene according to claim 6, characterized in that: in, The reaction system used in the fluorescent PCR amplification reaction in step 3 includes: Universal ProbeqPCR Master Mix 7.5μl, 2.5μM gene primers (upstream + downstream) 1.5μl, probe 0.75μl, reverse transcription product (cDNA) 2.0μl, Water Nuclease-Free 3.25μl.

8. The kit for detecting Morchella MAT gene according to claim 6, characterized in that: in, The procedure of the fluorescent PCR amplification reaction in step 3 is: pre-denaturation at 95°C for 30s; denaturation at 95°C for 15s, annealing / extension at 60°C for 30s, and 40 cycles.

Images