SNP molecular marker related to low temperature tolerance of rice and its application in rice breeding

Abstract

The application discloses a SNP molecular marker related to low-temperature resistance of rice and application thereof in rice breeding, wherein the SNP molecular marker related to low-temperature resistance of rice is from an exon of a LOC_Os10g28120 gene, is located at a position of 14603265 bp of a 10th chromosome of rice, and has alleles of C and G, and can be used for predicting low-temperature germination resistance of rice, thereby being used for marker-assisted breeding of low-temperature resistance and direct seeding molecular breeding of rice. The application further provides a primer pair for detecting the above SNP molecular marker and a screening method of the above SNP molecular marker.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of molecular biology and crop breeding technology, and relates to a SNP molecular marker related to low-temperature tolerance of rice and application thereof in rice breeding. BACKGROUND

[0002] Rice is the most important food crop in China, and more than half of the population in China mainly eats rice. Direct seeding rice, which is labor-saving, time-saving and labor-saving, is attracting more and more attention and is being planted on a larger and larger area. Rice is a temperature-sensitive crop, and low-temperature cold damage can cause serious yield reduction of rice. Because the sowing season is often affected by low-temperature cold damage, seed germination is uneven, seedling is missing, and ridge is broken, etc. Therefore, it is required that the direct seeding rice variety still has a very high germination rate under low-temperature conditions. In South China, such as Guangdong, early rice sowing often encounters low-temperature weather, which requires that the rice seeds used for direct seeding have strong low-temperature germination ability. Cold tolerance during the germination period, also known as low-temperature germination ability, is an important cold tolerance trait that direct seeding rice should have. Therefore, it is of great significance to identify new cold-tolerant genes, develop molecular markers closely related to cold tolerance, and use new genes or known excellent cold-tolerant genes through molecular marker-assisted selection for breeding cold-tolerant rice varieties.

[0003] It is found by using DNA molecular markers to locate the rice cold tolerance that the rice cold tolerance is a complex trait controlled by quantitative trait loci (QTL). Liu et al. (2013a) identified 7 QTLs by using F2:3 population of hybridization between cold-tolerant variety IL112 and cold-sensitive variety guicha2. Then, they explored candidate genes related to cold tolerance by using microarray hybridization analysis, and reduced the number of candidate genes to 4. Transgenic rice overexpressing one of the candidate genes LOC_Os07g22494 (LTT7) showed strong low-temperature tolerance at early seedling stage. Ma et al. cloned the first rice cold tolerance gene COLD1 in the world and elucidated its working mechanism, providing a reference for cold tolerance research. With the development of whole genome sequencing technology, it is possible to compare gene variations in different germplasm resources at the whole genome level, and by combining phenotype identification data, using linkage analysis and association analysis (GWAS), etc. analysis method, new genes and favorable alleles contained in germplasm resources can be efficiently explored.

[0004] Chitinase is a kind of hydrolytic enzyme taking chitin as substrate, which plays an important role in plant defense system by degrading chitin to resist fungal pathogens. Recent studies have shown that chitinase also participates in the abiotic stress response of plants, helping plants to survive in adversity. LOC_Os10g28120 has the structural characteristics of class IIIb chitinase and belongs to GH18 family. In Arabidopsis, some chitinases, such as EVM0022783, EVM0020238 and EVM0003645, are strongly induced by low temperature and osmotic stress, which may drive the binding of MYC / ICE1 (CBF expression inducer 1) in the promoter region.

[0005] Single Nucleotide Polymorphisms (SNP) mainly refers to the DNA sequence polymorphism at the genome level caused by the variation of a single nucleotide. The distribution of SNP in rice genome is quite extensive. With the progress of high-throughput sequencing technology, SNP has become a new generation of molecular marker. Functional marker is a new type of molecular marker developed according to the polymorphic motif in functional gene causing variation of phenotypic traits. Due to the functional motif from the gene, such marker does not need further verification to determine the presence or absence of target allele in different genetic backgrounds or different rice germplasm resources. SUMMARY

[0006] The first object of the present application is to provide a SNP molecular marker related to low temperature tolerance of rice aiming at the deficiencies of the prior art.

[0007] The SNP molecular marker related to low temperature tolerance of rice is from the exon of LOC_Os10g28120 gene, which is located at the position of 14603265 bp on the 10th chromosome of rice, and the alleles are C and G. The SNP molecular marker is significantly related to the low temperature phenotype of rice, and the low temperature tolerance of rice varieties with C / C site genotype is significantly stronger than that of rice varieties with G / G site genotype.

[0008] The second object of the present application is to provide the application of the above-mentioned SNP molecular marker related to low temperature tolerance of rice in identifying the low temperature tolerance traits of rice.

[0009] The third object of the present application is to provide the application of the above-mentioned SNP molecular marker related to low temperature tolerance of rice in the genetic breeding of rice.

[0010] Further, in the application, the site genotype of the SNP molecular marker is C.

[0011] The SNP molecular marker in the application is located in an exon of LOC_Os10g28120 gene, and LOC_Os10g28120 belongs to chitinase, participates in the non-biological stress response of plants, helps plants survive in adversity, and can respond to low temperature stress.

[0012] Specifically, taking the breeding of a new rice variety with strong low-temperature resistance as an example, the LOC_Os10g28120 gene (the base type of the SNP molecular marker is C) with strong low-temperature resistance can be introduced into a rice variety by genetic engineering to improve the low-temperature resistance of the rice, or the SNP site of the LOC_Os10g28120 gene (the base type of the SNP molecular marker is G) in a low-temperature sensitive rice can be subjected to site-directed mutagenesis to transform the rice into a new variety with strong low-temperature resistance.

[0013] A fourth object of the application is to provide a primer pair for detecting the SNP molecular marker related to the low-temperature resistance of rice, comprising:

[0014] SEQ ID NO. 1: 5'-GTCGACTACGAGCACTTCAACG-3';

[0015] SEQ ID NO. 2: 5'-CTGGGCAAATATATCCGCTTATTCA-3'.

[0016] A fifth object of the application is to provide a method for identifying the low-temperature resistance of rice, comprising the following steps:

[0017] 1) extracting the genomic DNA of a rice sample to be tested;

[0018] 2) using the genomic DNA of the rice sample to be tested as a template, performing a PCR amplification reaction by using the primer pair for the SNP molecular marker related to the low-temperature resistance of rice, and obtaining an amplification product fragment;

[0019] 3) detecting the base type at the SNP molecular marker related to the low-temperature resistance of rice in the PCR amplification product fragment.

[0020] Further, step 3) is specifically:

[0021] detecting the base type at the 332nd bp of the PCR amplification product fragment, and the low-temperature resistance of rice with a C base type is stronger than that of rice with a G base type.

[0022] A sixth object of the application is to provide a screening method for the SNP molecular marker related to the low-temperature resistance of rice, which is specifically:

[0023] performing SNP detection on a plurality of rice samples;

[0024] The SNP molecular marker which is closely linked to the low temperature tolerance trait of rice is obtained by using the detected SNP to perform whole genome association analysis on rice samples, and the SNP molecular marker is from an exon of LOC_Os10g28120 gene, is located at the position of 14603265 bp of the 10th chromosome of rice, and is C or G.

[0025] Compared with the prior art, the application has the following beneficial effects:

[0026] The application provides a SNP molecular marker which is extremely significantly related to the low temperature tolerance of rice and is located at the position of 14603265 bp of the 10th chromosome of rice in the genome of rice. Experiments prove that the SNP site is significantly related to the germination rate of rice under the condition of low temperature stress. The SNP site can be used as a functional molecular marker to screen rice resources and varieties which are resistant to low temperature, plays an important role in the molecular breeding of direct seeding rice, and accelerates the breeding process. BRIEF DESCRIPTION OF DRAWINGS

[0027] Figure 1 is a frequency histogram of the low temperature germination potential trait of the rice test population identified in Example 1;

[0028] Figure 2 is a Manhattan plot of the whole genome association analysis of the low temperature germination potential trait of rice in Example 1;

[0029] Figure 3 is a box plot of the germination potential of samples with different genotypes at the site of LOC_Os10g28120 gene Chr10: 14603265 in Example 1;

[0030] Figure 4 is a base peak plot of the sequencing results of 10 rice materials collected in Example 2. DETAILED DESCRIPTION

[0031] The following examples further illustrate the content of the application, but should not be understood as limiting the application. Modifications or replacements of the methods, steps or conditions of the application without departing from the spirit and essence of the application all belong to the scope of the application. If not specifically indicated, the technical means used in the examples is the conventional means known by those skilled in the art. If not specifically indicated, the materials, reagents and the like used in the examples can be obtained from commercial channels.

[0032] Example 1, obtaining and identifying of the SNP molecular marker which is closely linked to the low temperature germination of rice

[0033] I. Obtaining of the SNP molecular marker which is closely linked to the low temperature germination of rice

[0034] 1. In this test, 208 rice varieties from China Rice Research Institute are selected.

[0035] 2, 208 materials, each material was set 2 biological repeats, and 30 seeds were taken for each repeat (the empty, shriveled and moldy seeds were picked out, and the seeds were placed in an oven at 42°C for 3 days before the test). The seeds were surface sterilized by soaking in 5% NaClO for 15 minutes, and then washed thoroughly with distilled water. The seeds were spread on disposable petri dishes lined with qualitative filter paper, 5 ml of distilled water was added, the petri dish cover was covered, and they were placed in a constant temperature light incubator at 14°C, and the control was cultured at 30°C (light setting was light for 8h and dark for 16h). The number of seedlings was investigated every day, and the control and treatment were investigated after the germination was stable for 4d and 15d respectively, and the germination rate, relative germination rate, germination potential, relative germination potential and germination index were calculated for genome-wide association analysis (GWAS).

[0036] 3, Genome-wide association analysis was performed using GEMMA software (https: / / www.xzlab.org / software.html), a mixed linear model was used for analysis, and population structure and kinship matrix between materials were used as covariates, combined with genotype and phenotype values, to calculate the statistical test value P of SNP, and P<0.001 was used as the standard to screen genetic loci related to phenotypic traits. In order to further analyze the significant SNPs with a short distance, significant SNPs with a distance of ≤200kb were combined, and the most significant SNP marker in the interval was selected as QTL. Query the candidate genes within 200kb upstream and downstream of QTL. A SNP site significantly related to low temperature germination resistance of rice was discovered by genome-wide association analysis, which was located at position 14603265 of chromosome 10 of rice, i.e. position 332 of SEQ ID NO. 3. The base type of R at this position is C or G, which leads to different low temperature phenotypes of rice: when the SNP is C, the seedling germination potential is high, i.e. it has strong low temperature germination resistance, and when the SNP is G, the seedling germination potential is low, i.e. it has poor low temperature germination resistance.

[0037] SEQ ID NO. 3:

[0038] GTCGACTACGAGCACTTCAACGACGACGGCGGCGCCGGCGTCGACACGTTCGTGGAGTGCATCGGCCGCCTCCTCACCGAGCTCAAGGCGCGGCACCCGAACATCACCACCTCCATCGCGCCGTTCGAGGACGCCGTGGTGCAGCGCTACTACCAGCCGCTGTGGCGGCGCTACGCCGGCGTGATCGACCTCGTCAACTTCCAGTTCTACGGCTACGGCGACAACACCGACGTGCCGACGTACGTGATGTTCTACGACGAGCAGGCGGCGAACTACCCGGGCGGCAAGGTGCTCGCCAGCTTCAAGACCGGCGACGTCGCCGGGCTGCTCT R GCCGGAGCAGGGGATCGCCGGAGCGAAGGAGTTGCAGCGGCAGGGGAAGCTGCCGGGATTGTTCATCTGGTCGGCGGACAGCTCAAAGGTCAGCAGCTATGGCTTTGAGTACGAGATCAAGGCTCAGGAGATCATCGCCAACCACTGATCGCTGATCGGACGGTCGAGATATCGCTGTGGTTGGATTTGGTATGAATGAATGACTGAATAAGCGGATATATTTGCCCAG

[0039] 4. The primers for the SNP sites obtained in step 3 are designed, and the primer sequences are as follows:

[0040] SEQ ID NO. 1: 5'-GTCGACTACGAGCACTTCAACG-3';

[0041] SEQ ID NO. 2: 5'-CTGGGCAAATATATCCGCTTATTCA-3'

[0042] The frequency histogram of the low-temperature germination potential trait of the rice test population identified in Example 1 is as follows: Figure 1 The Manhattan plot of the whole genome association analysis of the low-temperature germination potential trait of rice is as follows: Figure 2 The box plot of the germination potential of samples with different genotypes at the Chr10: 14603265 site of LOC_Os10g28120 gene is as follows: Figure 3

[0043] II. Method for identifying low-temperature tolerance of rice based on SNP molecular markers ​

[0044] The method for identifying the low-temperature tolerance of the to-be-tested rice based on the SNP molecular marker is detecting whether the base type of the SNP site (position 14603265 of chromosome 10) in the to-be-tested rice is C or G: The low-temperature tolerance of the rice with the C base type is stronger than that of the rice with the G base type. The rice with the C base type is a homozygote in which the deoxyribonucleotide at position 14603265 of chromosome 10 of the rice genome is C; and the rice with the G base type is a homozygote in which the deoxyribonucleotide at position 14603265 of chromosome 10 of the rice genome is G.

[0045] The specific steps of detecting whether the base type of the SNP site (position 14603265 of chromosome 10) in the to-be-tested rice is C or G are as follows: extracting the rice genome DNA, taking the genome DNA as a template, performing PCR amplification by using SEQ ID NO. 1 and SEQ ID NO. 2 to obtain a PCR amplification product, and performing sequencing on the PCR amplification product to determine whether the base type of the SNP site in the to-be-tested rice is C or G according to the sequencing result.

[0046] Example 2: Application of the SNP molecular marker closely linked to the low-temperature germination tolerance of rice

[0047] Alternatively, 10 rice materials are taken as to-be-tested rice, and the base type of the to-be-tested rice is detected by the method in step two in Example 1.

[0048] The results are shown in Table 1. Among the 10 rice materials, the base type of 5 materials at the SNP site is C, and the base type of 5 materials at the SNP site is G. It is found that the average low-temperature germination potential of the rice material with the C base type at the SNP site is 77.33%, and the average low-temperature germination potential of the rice material with the G base type at the SNP site is 0.67%, and the difference between them is extremely significant.

[0049] The results show that the survival rate of the rice material with the C base type at the SNP site is significantly higher than that of the rice material with the G base type, which indicates that the low-temperature germination tolerance of the rice material with the C base type is significantly stronger than that of the rice material with the G base type. The present application further proves that the SNP site can be used as an effective genetic marker for the molecular marker assisted selection of rice to improve the low-temperature germination characteristics of rice and accelerate the breeding process of direct-seeded rice.

[0050] Figure 4 is a base peak chart of the sequencing result of the 10 rice materials.

[0051] Table 1: Low-temperature germination potential phenotype of 10 rice materials

[0052] Material No. Low temperature germination potential Type of base QC76 76.67% C QC35 86.67% C QC50 76.67% C QC82 73.33% C QC68 73.33% C QC202 0.00% G QC146 3.33% G QC138 0.00% G QC15 0.00% G QC14 0.00% G

[0053] Embodiments of the present disclosure have been described above, with the understanding that these embodiments are exemplary only and are not exhaustive of overall disclosure. Many modifications and variations will be apparent to those of ordinary skill in the art. The scope of the disclosure, therefore, is to be determined from the following claims, which are to be accorded the full breadth of equivalents to which they are entitled under the law. The selection of the terms to be used in the description herein is intended to best explain the principles of the embodiments, the practical application of the embodiments, or the technical improvements over the prior art, or to enable other of ordinary skill in the art to understand the embodiments disclosed herein.

[0054] The above merely describes optional embodiments of the present disclosure, and is not intended to limit the present disclosure. The present disclosure can have various modifications and changes for those skilled in the art. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present disclosure shall be included in the protection scope of the present disclosure.

Claims

1. The application of a detection reagent for SNP molecular markers related to low-temperature tolerance in rice in identifying the low-temperature tolerance trait in rice, characterized in that, The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.

3. The molecular marker is located at 332 bp of SEQ ID NO.3, and the alleles are C and G. Rice with C base type has stronger low temperature resistance than rice with G base type.

2. A method for identifying the low-temperature tolerance trait of rice, characterized in that, The method includes the following steps: Step 1) Extract genomic DNA from the rice sample to be tested; Step 2) Using the genomic DNA of the rice sample to be tested as a template, PCR amplification reaction is performed using primer pairs to obtain PCR amplification product fragments; the primer pairs include: Upstream primer: 5'-GTCGACTACGAGCACTTCAACG-3'; Downstream primer: 5'-CTGGGCAAATATATCCGCTTATTCA-3'; The nucleotide sequence of the PCR amplification product fragment is shown in SEQ ID NO.3; Step 3) Detect the base type at the 332 bp of the PCR amplification product fragment. Rice with C base type has stronger low temperature resistance than rice with G base type.

Images