Bacteria detection method based on MIL( 53)-Fe nano-enzyme activity and application thereof

Abstract

The invention relates to a bacterial detection method based on MIL( 53)-Fe nano-enzyme activity. According to the bacterium detection method, an aptamer and an iron-based metal organic framework are combined to form a bacterium probe, the performance that MIL( 53)-Fe catalyzes TMB to generate TMB < + > in the presence of hydrogen peroxide is utilized, meanwhile, the generated TMB < + > is acidified to form TMB < 2 + >, the TMB < 2 + > is utilized to etch a gold nanorod, so that the color of the gold nanorod is changed, and then bacterium detection is achieved. The detection method is simple and rapid, the lowest detection limit of staphylococcus aureus is 1.16 CFU / mL, the lowest detection limit of escherichia coli is 1.02 CFU / mL, and the detection method has wide application prospects. In addition, the detection result is visible to naked eyes and can be used as a basis for qualitative detection.

Description

Technical Field

[0001] The present invention relates to the field of biological detection technology, and in particular to a bacterial detection method based on MIL(53)-Fe nanozyme activity and an application thereof. Background Art

[0002] In recent years, food safety problems have occurred frequently. According to reports, about 300 million people fall ill and about 5 million people die from foodborne pathogens every year. Foodborne pathogens have always been the main cause of foodborne diseases. Escherichia coli can cause diseases such as hemorrhagic enteritis and hemolytic uremic syndrome, and Staphylococcus aureus can cause staphylococcal food poisoning, skin and soft tissue infections, etc., which seriously endanger human health. At present, the plate count method is the most commonly used detection method. Its advantage is high accuracy, but it is time-consuming and requires a lot of manpower. Although methods such as polymerase chain reaction (PCR), gene sequencing, surface enhanced Raman scattering (SERS) and mass spectrometry have accurate analysis results, they rely on expensive reagents and instruments, are quite costly, and require professional personnel to operate. Some people predict that by 2050, 10 million people may die from antibiotic-resistant bacterial infections worldwide. At present, the method for determining Staphylococcus aureus and Escherichia coli specified in China's national standard GB 4789.2-2022 is still the plate count method, which takes a long time and is cumbersome to operate, and has many inconveniences in actual scenarios. Therefore, the development of timely and effective methods to identify foodborne pathogens is an urgent need for food security and public health.

[0003] Natural enzymes have unique biochemical properties and can efficiently catalyze a series of important reactions. As catalysts, natural enzymes have good specificity. Based on these advantages, natural enzymes have been widely studied in the fields of medicine, biotechnology, food processing and environmental analysis. However, biological enzymes are expensive, difficult to reuse, and easily inactivated by heat denaturation, so the preparation and storage conditions are harsh. Nanozymes are cheap, stable, easy to synthesize and functionalize, so the development of nanozymes to replace natural enzymes has broad application prospects in many fields. Compared with other nanozymes, MOF-based nanozymes have the advantages of large surface area, stable structure, and strong sensing ability. As a typical MOF, MIL(53)-Fe is simple to synthesize, easy to store, has good peroxidase activity, and can catalyze the oxidation of glucose, TMB, etc.

[0004] AuNRs are a kind of precious metal nanomaterials with unique optical properties, easy synthesis and preparation, and controllable shape. By adjusting its length and width, it is possible to achieve precise control of its absorption wavelength and color and establish a multicolor sensing system. Jia-MingLiu et al. 3+ The etching property of AuNRs has established a method to detect I -Highly sensitive non-polymeric colorimetric sensors. Taking advantage of the unique properties of AuNRs, Yuan Dan et al. developed a colorimetric sensor array for the recognition of 12 nucleotides based on chemical etching of AuNRs with controllable aspect ratios. AuNRs also have unique physical and chemical properties, such as surface enhanced Raman scattering (SERS), surface plasmon resonance (SPR), two-photon luminescence (TPL), enhanced penetration and retention (EPR) effect, photothermal effect, etc. According to literature reports, the selective shortening of AuNRs can produce a series of unique colors, covering almost the entire visible range from 400 to 760 nanometers, and these bright colors are easily distinguished by the human eye. In addition, the study of Ma et al. showed that TMB 2+ AuNRs can be etched quantitatively and efficiently. 2+ As the concentration increases, the aspect ratio of AuNRs decreases and the color of the solution changes. Therefore, TMB can be easily distinguished by the naked eye through the corresponding solution color. 2+ the exact concentration. Summary of the invention

[0005] Therefore, the technical problem to be solved by the present invention is to overcome the problem of lack of efficient and highly sensitive bacteria detection system in the prior art.

[0006] In order to solve the above technical problems, the present invention provides a bacterial detection method based on the activity of MIL(53)-Fe nanozyme. The present invention firstly synthesizes iron-based metal organic framework (MIL(53)-Fe) nanoparticles with peroxidase-like activity by solvothermal method, and then combines the bacterial specific aptamer (apt) with MIL(53)-Fe through π-π bond adsorption to form apt-MIL(53)-Fe bacterial probe. Since MIL(53)-Fe has peroxidase activity, it can catalyze the oxidation of 3,3',5,5'-tetramethylbenzidine (TMB) to blue TMB in the presence of H2O2. + When the target bacteria are present, the apt-MIL(53)-Fe bacterial probe specifically binds to the target bacteria, reducing the peroxidase activity of MIL(53)-Fe and thus reducing TMB. + Acidify TMB with a small amount of H2SO4 + After solution, TMB + Transformed into yellow TMB capable of etching AuNRs 2+ solution, the length of AuNRs decreased after etching. In the same time, with the increase of TMB + The reduction of TMB 2+As the concentration decreases, the etching effect weakens, causing the color of AuNRs to change slowly, which in turn causes the longitudinal displacement of the AuNRs UV peak to decrease. Based on this principle, a correlation curve between the bacterial concentration and the AuNRs UV peak displacement can be established, thereby realizing the concentration detection of bacteria.

[0007] The first object of the present invention is to provide a method for detecting bacteria, comprising the following steps:

[0008] S1, connecting the iron-based metal organic framework to the aptamer to form a bacterial probe;

[0009] S2, incubating bacterial samples of different concentrations with the bacterial probe, adding a substrate to the incubation solution for catalytic reaction, acidifying the solution after the catalytic reaction and adding gold nanorods for etching, and detecting the ultraviolet peak of the gold nanorods;

[0010] S3, establish a standard curve of the UV peak shift of gold nanorods and bacterial concentration;

[0011] S4, operating the sample to be tested according to S2, detecting the ultraviolet peak shift of the gold nanorods, and calculating the concentration of bacteria in the sample to be tested according to the standard curve in S3;

[0012] Wherein, the aptamer recognizes the bacterium.

[0013] Furthermore, the iron-based metal organic framework is covalently linked to the aptamer via a π-π bond.

[0014] Furthermore, the concentration of the iron-based metal organic framework in step S1 is (2-4) mg / mL.

[0015] Furthermore, the substrate in step S2 comprises hydrogen peroxide and 3,3',5,5'-tetramethylbenzidine (TMB). MIL(53)-Fe has peroxidase activity and can catalyze the oxidation of TMB into blue TMB in the presence of H2O2. + .

[0016] Furthermore, the acidification of the catalytic system in step S2 is achieved by adding an acid to the catalytic system. MIL(53)-Fe having peroxidase activity can catalyze the oxidation of TMB to blue TMB in the presence of H2O2. + , while adding acid to the catalytic system can make the blue TMB + TMB turns yellow when acidified and has etching ability 2+ , and then etch the gold nanorods.

[0017] Furthermore, the ratio of the length to the diameter of the gold nanorods is (3-5):1.

[0018] Furthermore, the acid includes hydrochloric acid or sulfuric acid. Preferably, sulfuric acid is used, wherein the concentration of sulfuric acid is 2M and the volume is 20-50uL. When the concentration of the acid is too low, it will lead to incomplete acidification, and when the concentration of the acid is too high, it will lead to TMB + It is easy to turn black, which is not conducive to color detection.

[0019] Furthermore, the co-incubation time in step S2 is not less than 12 minutes.

[0020] Furthermore, the co-incubation temperature in step S2 is 20-40°C. When the temperature is too high, H2O2 will decompose, thereby affecting the detection results.

[0021] Furthermore, the etching time in step S2 is not less than 30 minutes.

[0022] The second object of the present invention is to provide an application of the above-mentioned bacteria detection method in detecting Staphylococcus aureus, wherein the gene sequence of the aptamer is shown in SEQ ID NO.1.

[0023] The third object of the present invention is to provide an application of the above-mentioned bacteria detection method in detecting Escherichia coli, and the gene sequence of the aptamer is shown in SEQ ID NO.2.

[0024] Beneficial effects of the present invention:

[0025] (1) The present invention uses aptamers as specific recognition molecules, and uses the π-π bond adsorption method to conjugate bacterial aptamers with MIL(53)-Fe in large quantities, thereby obtaining a bacterial probe with high sensitivity to target bacteria. Compared with antibodies in traditional immunoassays, the bacterial probe of the present invention has the advantages of low cost, stable performance, and easy labeling, and has high affinity and high specificity;

[0026] (2) The present invention utilizes a solvothermal method to synthesize MIL(53)-Fe. The synthesized MIL(53)-Fe has excellent peroxidase activity. Meanwhile, the synthesis process is simple, convenient and low-cost. Meanwhile, the present invention utilizes the catalytic performance of apt-MIL(53)-Fe. The aptamer preferentially binds to the target bacteria. The target bacteria shield the catalytic site of apt-MIL(53)-Fe. The enzyme catalytic ability of the nanomaterial is weakened, the colorimetric signal is reduced, the amount of oxTMB produced is reduced, and the etching of AuNRs is reduced. The ultraviolet peak shift of the etched AuNRs is proportional to the concentration of the target bacteria, thereby realizing quantitative detection of bacteria. This detection mode is simple and fast, shortens the detection time, and has broad application prospects.

[0027] (3) The present invention adopts a silver ion-assisted seed-mediated method to synthesize AuNRs. The synthesized AuNRs have an aspect ratio of about (3-5):1, good morphology, and uniform dispersion, which provides a basis for etching experiments. The etched AuNRs show a multicolor change from pink-brown to gray and then to yellow, which is visible to the naked eye and can be used as a basis for qualitative detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] In order to make the content of the present invention more clearly understood, the present invention is further described in detail below according to specific embodiments of the present invention in conjunction with the accompanying drawings, wherein

[0029] Figure 1 is a schematic diagram of the application of the colorimetric detection method of Staphylococcus aureus and Escherichia coli based on the peroxidase activity of MIL(53)-Fe and the etching effect of AuNRs in the present invention;

[0030] Figure 2 are characterization images of MIL(53)-Fe, apt-MIL(53)-Fe and AuNRs; wherein, A is the scanning electron microscope (SEM) image of MIL(53)-Fe; B is the transmission electron microscope (TEM) image of MIL(53)-Fe; C is the transmission electron microscope (TEM) image of apt-MIL(53)-Fe; D is the transmission electron microscope (TEM) image of AuNRs; E is the infrared spectrum of MIL(53)-Fe; F is the XRD pattern of MIL(53)-Fe; G is the Zeta potential image of MIL(53)-Fe and apt-MIL(53)-Fe; H is the UV spectrum of AuNRs;

[0031] Figure 3 is the result diagram of nanozyme catalytic activity; A is the UV-visible absorption spectra of different reaction systems; B is the Michaelis-Menten curve when the reaction system is H2O2; C is the double reciprocal plotting method when the reaction system is H2O2; D is the Michaelis-Menten curve when the reaction system is TMB; E is the double reciprocal plotting method when the reaction system is TMB;

[0032] Figure 4 is the result diagram of the optimization experiment; A is the optimization of MIL(53)-Fe nanoparticle concentration; B is the optimization of nanozyme reaction time; C is the optimization of nanozyme reaction temperature; D is the optimization of sulfuric acid acidification conditions; E is the optimization of hydrochloric acid acidification conditions; F is the optimization of etching solution conditions; G is the optimization of etching time; H is the UV spectrum of etching time;

[0033] Figure 5are the detection standard curve results of Staphylococcus aureus and Escherichia coli; (A) and (C) are the AuNRs images corresponding to different concentrations of Staphylococcus aureus and Escherichia coli, (B) and (D) are the linear fitting curves of the peak displacement of AuNRs and the logarithm of the bacterial concentration after adding different concentrations of Staphylococcus aureus and Escherichia coli, respectively, and the small figures in (B) and (D) are the color change images of AuNRs after adding different concentrations of Staphylococcus aureus and Escherichia coli, respectively;

[0034] Figure 6 is the specificity and repeatability of the sensor; (A) Peak shift of specificity evaluation in the presence of different bacteria (each bacterial concentration is 1×10 3 ), error bars represent the standard deviation of three parallel experiments, (B) repeatability experiment of Staphylococcus aureus, (C) repeatability experiment of Escherichia coli. DETAILED DESCRIPTION

[0035] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it, but the embodiments are not intended to limit the present invention.

[0036] Example 1: Preparation of MIL(53)-Fe

[0037] MIL(53)-Fe was synthesized by solvothermal method. First, 1.0812 g of FeCl3·6H2O was dissolved in 20 mL of DMF solution, and then 0.6646 g of terephthalic acid (H2BDC) was added. After strong stirring for 10 min, the solution was placed in a 50 mL reactor and then heated at 150 °C for 48 h. After natural cooling, the yellow precipitate was collected by centrifugation and washed with distilled water and ethanol. Finally, the product was placed in a 60 °C vacuum drying oven and dried overnight.

[0038] SEM and TEM images of MIL(53)-Fe at different magnifications ( Figure 2 A and Figure 2 B) shows that the microstructure of MIL(53)-Fe is a diamond-shaped metal framework with a longitudinal length of about 5.06 μm and a lateral length of about 3.86 μm. The synthesized sample has a uniform structure. Figure 2 E is characterized by its Fourier transform infrared spectrum. The spectrum of the MOF is 731 cm -1 The stretching vibration peak of ArCH pointing to the aromatic group appeared at 1110 cm -1 C=C stretching vibration appears at 1390cm -1 and 1680cm -1The two sharp peaks correspond to the symmetric vibration and asymmetric vibration of COO-, indicating the presence of dicarboxylic acid linkers in MIL(53)-Fe. Figure 2 F) shows that the obtained sample is crystalline, with characteristic peaks at 2θ of 9.3°, 12.7°, 17.6°, 18.5°, 25.5°, and 27.3°, which are consistent with previous reports, indicating that pure MIL(53)-Fe was successfully prepared under this condition.

[0039] Example 2: Preparation of apt-MIL(53)-Fe

[0040] The specific apt-MIL(53)-Fe probe was prepared by π-π bond adsorption. To prepare apt-MIL(53)-Fe, 1OD of aptamer was dissolved in 30μL of 100μM TE buffer, incubated at 95℃ for 10min, and then 10μL of aptamer was mixed with 10mL of MIL(53)-Fe dispersed in deionized water at a concentration of 3mg / mL, shaken in a shaker for 2h, and this process was repeated three times. The gene sequence of the Staphylococcus aureus aptamer chain is shown in SEQ ID NO.1, and the gene sequence of the Escherichia coli aptamer chain is shown in SEQ ID NO.2.

[0041] The gene sequence of SEQ ID NO.1 is:

[0042] GCAATGGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCTCGCTG GTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA.

[0043] The gene sequence of SEQ ID NO.2 is:

[0044] GCAATGGGTACGGTACTTCCGTTGCACTGTGCGGCCGAGCTGCCCCC TGGTTTGTGAATACCCTGGGCAAAAGTGCACGCTACTTTGCTAA.

[0045] Comparing the characterization of apt-MIL(53)-Fe with that of MIL(53)-Fe, it can be found that its Zeta potential changes significantly after binding with the aptamer ( Figure 2 G), from positive to negative, and the TEM image shows ( Figure 2C) Its size becomes larger, with a longitudinal length of about 6.4 microns and a lateral length of about 4.9 microns. This shows that the aptamer is tightly connected to the material and the apt-MIL(53)-Fe probe is successfully prepared. The above results prove that the synthesis result of apt-MIL(53)-Fe is consistent with expectations.

[0046] Example 3: Nanozyme catalytic activity verification

[0047] In this study, the catalytic activity of MIL(53)-Fe at different concentrations of H2O2 and TMB was monitored and a steady-state kinetic analysis was performed. Figure 3 The Vmax value of B and C) is 6.01 mg·ml -1 ·s -1 , Km value is 3.69mg·ml -1 , for TMB( Figure 3 The Vmax value of D and E is 2.61 mg·ml-1·s-1, and the Km value is 0.29 mg·ml -1 , which is lower than other nanozymes and HRP, indicating that it has good affinity and catalytic activity.

[0048] Example 4: Optimization of experimental conditions

[0049] The detection reaction of the present invention is divided into two steps: the first step is to catalyze the oxidation of TMB to generate blue TMB by using the nanozyme activity of MIL(53)-Fe nanoparticles in the presence of H2O2. + Solution; the second step is to acidify the blue TMB + The solution turns into yellow TMB 2+ The solution was used to etch AuNRs and produce multicolor changes. In the first step of the reaction, the concentration of MIL(53)-Fe nanoparticles, nanozyme reaction time, and nanozyme reaction temperature were optimized. The experiment showed that Figure 4 As shown in A, when the concentration of MIL(53)-Fe nanoparticles is 3 mg / mL, the UV peak at 652 nm is the largest, so it is the optimal concentration; Figure 4 As shown in B, the absorbance at 652 nm at the beginning increased with time, and reached a plateau after 720 s, so 12 min was the optimal reaction time; Figure 4 As shown in Figure C, the absorbance at 652nm first increases and then decreases with the increase of temperature, reaching a peak at 30℃. This may be because the high temperature causes H2O2 to decompose, affecting the experimental results, so 30℃ is the best condition. In the second step, try acidification with different amounts of H2SO4 and HCl at a concentration of 0.2M, such as Figure 4D and 4E, the peak displacement of etching is greater after H2SO4 acidification, so the acidification effect of H2SO4 is better than that of HCl, and as shown in Figure 4 F shows that 20uL is the best addition amount. At the same time, the etching time was optimized, such as Figure 4 As shown in G and 4H, the results show that the peak displacement of AuNRs reaches a plateau after etching for 30 min, so 30 min is the optimal etching time.

[0050] Example 5: Establishment of detection standard curves for Staphylococcus aureus and Escherichia coli

[0051] In order to quantitatively analyze the target bacteria, the concentration of 1×10 0 , 1×10 1 , 1×10 2 , 1×10 3 , 1×10 4 , 1×10 5 The Staphylococcus aureus and Escherichia coli were tested, and the logarithm of the bacterial concentration (N) was used as the horizontal coordinate, and the peak displacement of the etched AuNRs (Δλ) was used as the vertical coordinate. Linear fitting was performed to make a standard curve. The standard curve of Staphylococcus aureus ( Figure 5 B) is Δλ=-5.9857lgN+46.381, R 2 =0.97; Standard curve of E. coli ( Figure 5 D) is Δλ=-6.8952lgN+53.683, R 2 =0.98. This shows that the established detection system has a good linear relationship.

[0052] like Figure 5 As shown in B and 5D, as the concentration of the target bacteria increases, the color of AuNRs changes from pink-brown to yellow and then to green, and the color is clear and visible to the naked eye. This shows that the detection system can also be well applied in qualitative analysis. The detection limit of the detection system is calculated by the following formula: 3STD / m (STD is the standard deviation of the negative control sample, and m is the slope of the standard curve). The results showed that the LOD of Staphylococcus aureus was 1.16CFU / mL and the LOD of Escherichia coli was 1.02CFU / mL.

[0053] Compared with previous detection methods, this detection method has higher sensitivity and wider detection range, indicating that this detection method has good application prospects in detecting foodborne pathogens.

[0054] Example 6: Repeatability and specificity analysis

[0055] In order to verify the specificity of the detection method, Salmonella typhimurium, Shigella leprosy, Staphylococcus xylosus and Pediococcus pentosaceus were selected as non-target bacteria for verification. Figure 6 It can be seen that the peak displacement (Δλ) of the target bacteria is significantly reduced compared to the non-target bacteria. At the same time, the photo shows that in the absence of target bacteria, the oxTMB produced by the test increases, the degree of etching of AuNRs increases, and the color is yellow, which is significantly different from the pink color in the presence of target bacteria. This shows that the bacterial probe has a strong recognition ability and specificity for the target bacteria.

[0056] In addition, 9 groups with a concentration of 10 2 The experiment was repeated with Staphylococcus aureus and Escherichia coli. Figure 6 As shown in B and C, it can be seen that the peak displacement is basically the same. The relative standard deviation (RSD) of the Staphylococcus aureus group is 1.8%, and the RSD of the Escherichia coli group is 2.0%, indicating acceptable repeatability performance and stability of the sensor.

[0057] Example 7: Spike recovery experiment

[0058] In order to verify the feasibility of the bacterial detection system, this experiment selected water, milk, and pork as samples for testing. After pretreatment, water, milk, and pork were sterilized in an autoclave, and then milk was diluted 1000 times and pork was diluted 10 times, and 2×10 1 , 2×10 2 , 2×10 3 The Staphylococcus aureus and Escherichia coli were tested, and the plate count method in the national standard GB 4789.2-2022 was used for detection. The results are shown in Tables 1 and 2. The recovery rate of Staphylococcus aureus was 97.22-104.81%, and the RSD was 1.49-8.00%; the recovery rate of Escherichia coli was 90.83-108.89%, and the RSD was 1.29-8.21%. These test results show that the bacterial detection method has good accuracy and feasibility, can meet the detection needs, and has good application prospects.

[0059] Table 1 Recovery and RSD values ​​of Staphylococcus aureus added to three samples at different concentrations (n=3)

[0060]

[0061] Table 2 Recovery and RSD values ​​of three samples with different concentrations of Escherichia coli added (n=3)

[0062]

[0063]

[0064] Note: Recovery rate = measured concentration / added concentration × 100%, RSD means relative standard deviation

[0065] Obviously, the above embodiments are merely examples for clear explanation and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived from these are still within the protection scope of the invention.

Claims

1. A method for detecting bacteria, characterized in that: The following steps are involved: S1, connecting the iron-based metal organic framework to the aptamer to form a bacterial probe; S2, incubating bacterial samples of different concentrations with the bacterial probe, adding a substrate to the incubation solution for catalytic reaction, acidifying the solution after the catalytic reaction and adding gold nanorods for etching, and detecting the ultraviolet peak of the gold nanorods; S3, establish a standard curve of the UV peak shift of gold nanorods and bacterial concentration; S4, operating the sample to be tested according to S2, detecting the ultraviolet peak shift of the gold nanorods, and calculating the concentration of bacteria in the sample to be tested according to the standard curve in S3; Wherein, the aptamer recognizes the bacterium.

2. The bacteria detection method according to claim 1, characterized in that: The concentration of the iron-based metal organic framework in step S1 is (2-4) mg / mL.

3. The bacteria detection method according to claim 1, characterized in that: The substrate in step S2 comprises hydrogen peroxide and 3,3',5,5'-tetramethylbenzidine.

4. The bacteria detection method according to claim 1, characterized in that: The ratio of the length to the diameter of the gold nanorods in step S2 is (3-5):

1.

5. The bacteria detection method according to claim 1, characterized in that: In step S2, the acidification of the solution after the catalytic reaction is achieved by adding an acid to the solution after the catalytic reaction, wherein the acid includes hydrochloric acid or sulfuric acid; wherein the concentration of the added acid is 1-3M, and the added volume is 20-50uL.

6. The bacteria detection method according to claim 1, characterized in that: The co-incubation time in step S2 is not less than 12 minutes.

7. The bacteria detection method according to claim 1, characterized in that: The co-incubation temperature in step S2 is 20-40°C.

8. The bacteria detection method according to claim 1, characterized in that: The etching time in step S2 is not less than 30 minutes.

9. Use of the bacteria detection method according to any one of claims 1 to 8 in detecting Staphylococcus aureus, characterized in that: The gene sequence of the aptamer is shown in SEQ ID NO.

1.

10. Use of the bacteria detection method according to any one of claims 1 to 8 in detecting Escherichia coli, characterized in that: The gene sequence of the aptamer is shown in SEQ ID NO.2.

Images