Double stranded DNA compositions and related methods

Abstract

The present disclosure provides, for example, therapeutic double stranded constructs (TDSC). In some embodiments, the TDSC comprises a double stranded DNA region, an upstream blocking end, and a downstream blocking end. In some embodiments, the TDSC comprises a chemically modified nucleotide. In some embodiments, the TDSC is resistant to endonuclease digestion and / or to immunosensor recognition, and supports expression of a heterologous load encoded in the TDSC.

Description

[0001] Related Applications

[0002] This application claims priority to U.S. Serial No. 63 / 341,960, filed May 13, 2022, the entire contents of which are incorporated herein by reference.

[0003] Sequence Listing

[0004] This application contains a sequence listing, which has been submitted electronically in XML format and is hereby incorporated by reference in its entirety. The XML copy created on May 10, 2023 is named F2128-7002WO_SL.xml and is 183,436 bytes in size. Background Art

[0005] Novel therapeutic modalities are needed to address unmet medical needs. Summary of the invention

[0006] Described herein are pharmaceutical DNA compositions, constructs, formulations, methods of using such compositions, constructs and formulations, and methods of making the same.

[0007] In one aspect, the invention features a therapeutic double-stranded construct ("TDSC").

[0008] Examples of Examples

[0009] 1. A TDSC, comprising:

[0010] a) upstream exonuclease-resistant DNA end forms;

[0011] b) a double-stranded region; and

[0012] c) downstream exonuclease-resistant DNA end forms,

[0013] The TDSC comprises one or more chemically modified nucleotides.

[0014] 2. A TDSC comprising:

[0015] a) upstream DNA end form, which is a closed end;

[0016] b) double-stranded region;

[0017] c) downstream DNA end form, which is a closed end,

[0018] The TDSC comprises one or more chemically modified nucleotides.

[0019] 3. The TDSC of embodiment 1, wherein one or both of the upstream exonuclease-resistant DNA end form and the downstream exonuclease-resistant DNA end form are open ends.

[0020] 4. A TDSC comprising:

[0021] a) an upstream DNA end form comprising a Y-adapter configuration (e.g., an upstream exonuclease-resistant DNA end form);

[0022] b) a double-stranded region; and

[0023] c) a downstream DNA end form comprising a Y-adapter configuration (e.g., a downstream exonuclease-resistant DNA end form),

[0024] The TDSC comprises one or more chemically modified nucleotides.

[0025] 5. The TDSC of embodiment 1 or 3, wherein one or both of the upstream exonuclease-resistant DNA end form and the downstream exonuclease-resistant DNA end form are blunt ends or sticky ends.

[0026] 6. A TDSC comprising:

[0027] a) an upstream double-stranded blunt-ended DNA end form (e.g., an upstream exonuclease-resistant DNA end form that is a double-stranded blunt end) comprising a phosphorothioate modification on each strand;

[0028] b) a double-stranded region; and

[0029] c) a downstream double-stranded blunt-ended DNA end form (e.g., a downstream exonuclease-resistant DNA end form that is a double-stranded blunt end) comprising a phosphorothioate modification on each strand,

[0030] Optionally, the TDSC further comprises one or more chemically modified nucleotides.

[0031] 7. The TDSC of embodiment 1, wherein one or both of the upstream exonuclease-resistant DNA end form and the downstream exonuclease-resistant DNA end form are closed ends.

[0032] 8. The TDSC of any one of embodiments 1-3, 5 or 7, wherein one or both of the upstream exonuclease-resistant DNA end form and the downstream exonuclease-resistant DNA end form comprise a loop.

[0033] 9. A TDSC comprising:

[0034] a) an upstream DNA end form (e.g., an upstream exonuclease-resistant DNA end form) that is a closed end;

[0035] b) double-stranded region;

[0036] c) a downstream DNA end form (e.g., a downstream exonuclease-resistant DNA end form) that is a closed end,

[0037] The TDSC comprises one or more chemically modified nucleotides.

[0038] 10. The TDSC of any one of embodiments 1-9, wherein the upstream DNA end form (eg, the upstream exonuclease-resistant DNA end form) comprises one or more chemically modified nucleotides.

[0039] 11. The TDSC of any one of embodiments 1-10, wherein the downstream DNA end form (eg, downstream exonuclease-resistant DNA end form) comprises one or more chemically modified nucleotides.

[0040] 12. The TDSC of any one of embodiments 1-11, wherein the one or more chemically modified nucleotides comprise a modification in the backbone, sugar, or base.

[0041] 13. The TDSC of any one of embodiments 1-12, wherein the one or more chemically modified nucleotides are conjugated to a peptide or protein.

[0042] 14. The TDSC of any one of embodiments 1-13, wherein the one or more chemically modified nucleotides comprise chemically modified cytosine nucleotides and / or phosphorothioate bonds.

[0043] 15. The TDSC of any one of embodiments 1-14, wherein the one or more chemically modified nucleotides comprise a chemically modified cytosine nucleotide.

[0044] 16. The TDSC of embodiment 15, wherein the chemically modified cytosine nucleotide has a substitution other than hydrogen at carbon 5 of the cytosine.

[0045] 17. The TDSC of any one of embodiments 1-16, wherein the one or more chemically modified nucleotides comprise phosphorothioate bonds.

[0046] 18. The TDSC of any one of embodiments 1-17, wherein the first strand and the second strand of the TDSC each comprise one or more chemically modified nucleotides.

[0047] 19. The TDSC of any one of embodiments 1-18, wherein the first strand and the second strand of the TDSC each comprise one or more phosphorothioate bonds.

[0048] 20. The TDSC of any one of embodiments 1-19, wherein the upstream exonuclease-resistant DNA end form comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 phosphorothioate bonds (e.g., between 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 terminal nucleotides of the upstream exonuclease-resistant DNA end form, e.g., on the first strand, on the second strand, or on both the first strand and the second strand).

[0049] 21. The TDSC of any one of embodiments 1-20, wherein the upstream exonuclease-resistant DNA end form comprises at least 3 phosphorothioate bonds (e.g., between 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 terminal nucleotides of the upstream exonuclease-resistant DNA end form, e.g., on the first strand, on the second strand, or on both the first strand and the second strand).

[0050] 22. The TDSC of any one of embodiments 1-20, wherein the upstream exonuclease-resistant DNA end form comprises at least 6 phosphorothioate bonds (e.g., between 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 terminal nucleotides of the upstream exonuclease-resistant DNA end form, e.g., on the first strand, on the second strand, or on both the first strand and the second strand).

[0051] 23. The TDSC of any one of embodiments 1-22, wherein the downstream exonuclease-resistant DNA end form comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 phosphorothioate bonds (e.g., between 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 terminal nucleotides of the downstream exonuclease-resistant DNA end form, e.g., on the first strand, on the second strand, or on both the first strand and the second strand).

[0052] 24. The TDSC of any one of embodiments 1-23, wherein the downstream exonuclease-resistant DNA end form comprises at least 3 phosphorothioate bonds (e.g., between 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 terminal nucleotides of the downstream exonuclease-resistant DNA end form, e.g., on the first strand, on the second strand, or on both the first strand and the second strand).

[0053] 25. The TDSC of any one of embodiments 1-23, wherein the downstream exonuclease-resistant DNA end form comprises at least 6 phosphorothioate bonds (e.g., between 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 terminal nucleotides of the downstream exonuclease-resistant DNA end form, e.g., on the first strand, on the second strand, or on both the first strand and the second strand).

[0054] 26. The TDSC of any one of embodiments 1-20 or 23, wherein the upstream and downstream exonuclease-resistant DNA end forms each comprise at least 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 phosphorothioate bonds (e.g., between 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 terminal nucleotides of the upstream and downstream exonuclease-resistant DNA end forms, e.g., on the first strand, on the second strand, or on both the first strand and the second strand).

[0055] 27. The TDSC of any one of embodiments 1-21, 23, 24 or 26, wherein the upstream and downstream exonuclease-resistant DNA end forms each comprise at least 3 phosphorothioate bonds (e.g., between 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 terminal nucleotides of the upstream and downstream exonuclease-resistant DNA end forms, e.g., on the first strand, on the second strand, or on both the first strand and the second strand).

[0056] 28. A TDSC as described in any of embodiments 1-20, 22, 23, 25 or 26, wherein the upstream and downstream exonuclease-resistant DNA end forms each comprise at least 6 phosphorothioate bonds (e.g., between 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 terminal nucleotides of the upstream and downstream exonuclease-resistant DNA end forms, e.g., on the first strand, on the second strand, or on both the first strand and the second strand).

[0057] 29. The TDSC of any one of embodiments 1-28, wherein the one or more chemically modified nucleotides comprises a methyl group.

[0058] 30. A TDSC comprising:

[0059] a) upstream exonuclease-resistant DNA end forms;

[0060] b) double-stranded region;

[0061] c) downstream exonuclease-resistant DNA end forms,

[0062] Wherein one or both of the upstream exonuclease-resistant DNA end form and the downstream exonuclease-resistant DNA end form comprise a Y-adapter configuration.

[0063] 31. The TDSC of embodiment 30, wherein the Y-adapter is formed by cleavage with uracil DNA glycosylase (UDG) and DNA glycosylase-lyase endonuclease VIII (eg, USER enzyme mix).

[0064] 32. The TDSC of embodiment 30 or 31, wherein the Y-adapter comprises one or more chemically modified nucleotides (e.g., phosphorothioate-modified nucleotides, boranophosphate-modified nucleotides, 5-methylcytosine-modified nucleotides, 7-methylguanine-modified nucleotides and / or methylated nucleotides).

[0065] 33. The TDSC of any one of embodiments 30-32, wherein each nucleotide in the Y-adapter is a chemically modified nucleotide (e.g., phosphorothioate-modified nucleotides, boranophosphate-modified nucleotides, 5-methylcytosine-modified nucleotides, 7-methylguanine-modified nucleotides, and / or methylated nucleotides).

[0066] 34. A TDSC comprising:

[0067] a) upstream exonuclease-resistant DNA end forms;

[0068] b) double-stranded region;

[0069] c) downstream exonuclease-resistant DNA end forms,

[0070] One or both of the upstream exonuclease-resistant DNA end form and the downstream exonuclease-resistant DNA end form comprise one or more of the following: a nuclear targeting sequence, a maintenance sequence, or a sequence that binds to an endogenous polypeptide in a target cell.

[0071] 35. A TDSC comprising:

[0072] a) upstream exonuclease-resistant DNA end forms;

[0073] b) double-stranded region;

[0074] c) downstream exonuclease-resistant DNA end forms,

[0075] Wherein one or both of the upstream exonuclease-resistant DNA end form and the downstream exonuclease-resistant DNA end form have one or more of the following characteristics:

[0076] i) does not comprise the nucleic acid sequence TATCAGCACACAATTGCCCATTATACGC (SEQ ID NO:55) and GCGTATAATGGGCAATTGTGTGCTGATA (SEQ ID NO:56), or a nucleic acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity thereto; and / or the nucleic acid sequence TATCAGCACACAATAGTCCATTATACGC (SEQ ID NO:57) and GCGTATAATGGACTATTGTGTGCTGATA (SEQ ID NO:58);

[0077] ii) each nucleotide in the TDSC binds to another nucleotide in the TDSC;

[0078] iii) the upstream exonuclease-resistant DNA end form has a loop size of less than about 28 or 56 nucleotides in length or greater than about 28 or 56 nucleotides in length; or

[0079] iv) the downstream exonuclease-resistant DNA end form has a loop size of less than about 28 or 56 nucleotides in length or greater than about 28 or 56 nucleotides in length.

[0080] 36. The TDSC of any preceding embodiment, comprising one or more of the following:

[0081] i) a promoter sequence (wherein optionally, the promoter sequence is located in the double-stranded region);

[0082] ii) a payload sequence (e.g., a therapeutic payload sequence) operably linked to the promoter sequence (wherein optionally, the payload sequence is located in the double-stranded region);

[0083] iii) heterologous functional sequences, such as nuclear targeting sequences or regulatory sequences;

[0084] iv) maintaining the sequence; and / or

[0085] v) Origin of replication.

[0086] 37. The TDSC of embodiment 36, comprising:

[0087] i, ii and iii;

[0088] i, ii and iv;

[0089] i, ii and v;

[0090] i, ii, iii and iv;

[0091] i, ii, iii and v;

[0092] i, ii, iv and v; or

[0093] i, ii, iii, iv and v.

[0094] 38. The TDSC of embodiment 36 or 37, wherein the nuclear targeting sequence comprises a CT3 sequence (e.g., a sequence of AATTCTCCTCCCCACCTTCCCCACCCTCCCCA (SEQ ID NO: 59)), or a nucleic acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity thereto.

[0095] 39. The TDSC of any one of embodiments 36-38, wherein the nuclear targeting sequence binds to a hnRNPK protein (eg, a human hnRNPK protein).

[0096] 40. The TDSC of any one of embodiments 2, 7-29, or 36-39, wherein one or both of the closed ends comprise a loop, wherein one or both of the loops comprise a nuclear targeting sequence listed in Table 3, or a nucleic acid sequence at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical thereto.

[0097] 41. The TDSC of any one of embodiments 2, 7-29, or 36-40, wherein one or both of the closed ends comprise a loop, wherein one or both of the loops comprise a nuclear targeting sequence that binds to a nuclear import protein listed in Table 3.

[0098] 42. The TDSC of any one of embodiments 36-41, wherein the payload sequence encodes a polypeptide (eg, a protein).

[0099] 43. The TDSC of any one of embodiments 36-42, wherein the payload sequence encodes a functional RNA (eg, miRNA, siRNA, or tRNA).

[0100] 44. The TDSC of any one of embodiments 36-43, wherein the payload sequence is heterologous to the target cell.

[0101] 45. The TDSC of any one of embodiments 1-44, wherein the double-stranded region comprises a sense strand and an antisense strand.

[0102] 46. ​​The TDSC of embodiment 45, wherein the antisense strand comprises one or more chemically modified nucleotides.

[0103] 47. The TDSC of embodiment 45 or 46, wherein the sense strand does not comprise any chemically modified nucleotides.

[0104] 48. The TDSC of embodiment 45 or 46, wherein the sense strand comprises one or more chemically modified nucleotides.

[0105] 49. The TDSC of any preceding embodiment, wherein the TDSC is resistant to endonuclease digestion and / or resistant to immunosensor recognition.

[0106] 50. The TDSC of any preceding embodiment, wherein the upstream exonuclease-resistant DNA end forms are resistant to endonuclease digestion.

[0107] 51. The TDSC of any preceding embodiment, wherein the upstream exonuclease-resistant DNA end forms are resistant to immunosensor recognition.

[0108] 52. The TDSC of any preceding embodiment, wherein the downstream exonuclease-resistant DNA end forms are resistant to endonuclease digestion.

[0109] 53. The TDSC of any preceding embodiment, wherein the downstream exonuclease-resistant DNA end forms are resistant to immunosensor recognition.

[0110] 54. The TDSC of any preceding embodiment, wherein the double-stranded region is resistant to endonuclease digestion.

[0111] 55. The TDSC of any preceding embodiment, wherein the double-stranded region is resistant to immunosensor recognition.

[0112] 56. The TDSC of any preceding embodiment, wherein the upstream DNA terminal form and the downstream DNA terminal form have the same nucleotide sequence.

[0113] 57. The TDSC of any one of embodiments 1-55, wherein the upstream DNA terminal form and the downstream DNA terminal form have different nucleotide sequences.

[0114] 58. The TDSC of any preceding embodiment, wherein the upstream exonuclease-resistant DNA end form and the downstream exonuclease-resistant DNA end form have the same structure.

[0115] 59. The TDSC of any one of embodiments 1-57, wherein the upstream exonuclease-resistant DNA end form and the downstream exonuclease-resistant DNA end form have different structures.

[0116] 60. The TDSC of any one of embodiments 1, 7, 8, or 10-59, wherein one or both of the upstream exonuclease-resistant DNA end form and the downstream exonuclease-resistant DNA end form are open ends (e.g., blunt ends, sticky ends, or Y-adapters).

[0117] 61. The TDSC of any one of embodiments 1-3, 5, or 7-60, wherein one or both of the upstream exonuclease-resistant DNA end form and the downstream exonuclease-resistant DNA end form are closed ends (eg, hairpins).

[0118] 62. The TDSC of embodiment 61, wherein the blocked end comprises one or more (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, or 50) unhybridized (e.g., not part of a double-stranded region) nucleotides.

[0119] 63. The TDSC of embodiment 61, wherein the blocked end does not contain any unhybridized nucleotides (eg, wherein all nucleotides of the blocked end are hybridized to another nucleotide).

[0120] 64. The TDSC of any one of embodiments 30-63, wherein the upstream DNA end form, the downstream DNA end form, or both comprise at least one chemically modified nucleotide.

[0121] 65. The TDSC of any one of embodiments 30-64, wherein the upstream DNA end form and the downstream DNA end form both comprise at least one chemically modified nucleotide on the sense strand and at least one chemically modified nucleotide on the antisense strand.

[0122] 66. The TDSC of any one of embodiments 30-65, wherein the upstream DNA end form and the downstream DNA end form both comprise chemically modified nucleotides at each sense strand position and each antisense strand position.

[0123] 67. The TDSC of any one of embodiments 30, 31, 34-45, 47, or 49-63, wherein the upstream DNA end form, the downstream DNA end form, or both comprise inverted terminal repeats (ITRs), wherein optionally the dsDNA does not comprise chemically modified nucleotides.

[0124] 68. The TDSC of any one of embodiments 1-67, wherein the upstream DNA end form, the downstream DNA end form, or both do not comprise a protelomerase sequence.

[0125] 69. The TDSC of any one of embodiments 30, 31, 34-45, 47, 49-63, or 67, wherein the upstream DNA end form, the downstream DNA end form, or both comprise a protelomerase sequence, wherein optionally the dsDNA does not comprise chemically modified nucleotides.

[0126] 70. The TDSC of embodiment 69, wherein one or more of the protelomerases comprises (e.g., in 5' to 3' order) the nucleic acid sequences TATCAGCACACAATTGCCCATTATACGC (SEQ ID NO:55) and GCGTATAATGGGCAATTGTGTGCTGATA (SEQ ID NO:56), or a nucleic acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity thereto.

[0127] 71. The TDSC of embodiment 69 or 70, wherein one or more of the protelomerases comprises (e.g., in 5' to 3' order) the nucleic acid sequences TATCAGCACACAATAGTCCATTATACGC (SEQ ID NO:57) and GCGTATAATGGACTATTGTGTGCTGATA (SEQ ID NO:58), or a nucleic acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity thereto.

[0128] 72. The TDSC of any one of embodiments 69-71, wherein one or more of the protelomerases comprises (e.g., in 5' to 3' order) the nucleic acid sequences ACCTATTTCAGCATACTACGC (SEQ ID NO:60) and GCGTAGTATGCTGAAATAGGT (SEQ ID NO:61), or a nucleic acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity thereto.

[0129] 73. The TDSC of any one of embodiments 69-72, wherein one or more of the protelomerases comprises (e.g., in 5' to 3' order) the nucleic acid sequence CACACAATTGCCCATTATACGCGCGTATAATGGGCAATTGTGTG (SEQ ID NO:62), or a nucleic acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity thereto.

[0130] 74. The TDSC of any one of embodiments 69-73, wherein one or more of the protelomerase sequences comprises (eg, in 5' to 3' order) the following nucleic acid sequence:

[0131] (i)TAAATATAATTTAA (SEQ ID NO:63) and TTAAATTATATTTA (SEQ ID NO:64),

[0132] (ii) AATATATATCTAA (SEQ ID NO: 65) and TTAGATTATATATT (SEQ ID NO: 66),

[0133] (iii) TATTTATTATCTTT (SEQ ID NO: 67) and AAAGATAATAAATA (SEQ ID NO: 68),

[0134] (iv) ATATAATTTTTAATTAGTATAGAATATGTTAA (SEQ ID NO: 69) and TTAACATACTCTATACTAATTAAAAATTATAT (SEQ ID NO: 70),

[0135] (v) TATAATTTGATATTAGTACAAATCCC (SEQ ID NO:71) and GGGATTTGTACTAATATCAAATTATA (SEQ ID NO:72),

[0136] (vi) ATATAATATTTATTTAGTACAAAGTTC (SEQ ID NO:73) and GAACTTTGTACTAAATAAATATTATAT (SEQ ID NO:74),

[0137] (vii) ATATAATTTTTTATTAGTATAGAGTAT (SEQ ID NO:75) and ATACTCTATACTAATAAAAAATTATAT (SEQ ID NO:76),

[0138] (viii) TAAATATAATTTAA (SEQ ID NO:63) and TTAAATTATATTTA (SEQ ID NO:64); or nucleic acid sequences having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity thereto.

[0139] 75. The TDSC of any one of embodiments 69-74, wherein one or more of the protelomerase sequences further comprises (eg, in 5' to 3' order) the following nucleic acid sequence:

[0140] (i) TAGTATAAAAAACTGT (SEQ ID NO: 77) and ACAGTTTTTTATACTA (SEQ ID NO: 78),

[0141] (ii) TAGTATACAAAAGATT (SEQ ID NO: 79) and AATCTTTTGTATACTA (SEQ ID NO: 80),

[0142] (iii) TAGTATATATATCTCT (SEQ ID NO: 81) and AGAGATATATATACTA (SEQ ID NO: 82), or

[0143] (viii) TAGTATAAAAAAAATT (SEQ ID NO: 83) and AATTTTTTTTATACTA (SEQ ID NO: 84);

[0144] Or nucleic acid sequences having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity thereto.

[0145] 76. The TDSC of any one of embodiments 69-75, wherein the protelomerase sequence is generated by digestion with TelN protelomerase, ResT protelomerase, Tel PY54 protelomerase, or TelK protelomerase.

[0146] 77. The TDSC of any one of embodiments 69-75, wherein the protelomerase sequence is not generated by TelN protelomerase digestion.

[0147] 78. The TDSC of any one of embodiments 69-75 or 77, wherein the protelomerase sequence is not generated by Tel PY54 protelomerase digestion.

[0148] 79. The TDSC of any one of embodiments 69-75, 77 or 78, wherein the protelomerase sequence is not generated by TelK protelomerase digestion.

[0149] 80. The TDSC of any one of embodiments 69-75 or 77-79, wherein the protelomerase sequence is not generated by ResT protelomerase digestion.

[0150] 81. The TDSC of any one of embodiments 69-80, wherein the protelomerase sequence is about 28 or 56 nucleotides in length.

[0151] 82. The TDSC of any one of embodiments 69-81, wherein the protelomerase sequence is less than 28 (eg, less than 15, 20, 25, 26, 27, or 28) nucleotides in length.

[0152] 83. The TDSC of any one of embodiments 69-82, wherein the protelomerase sequence is between about 28 (e.g., 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, or 35) nucleotides and about 56 (e.g., 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60) nucleotides in length.

[0153] 84. The TDSC of any one of embodiments 69-83, wherein the protelomerase sequence is greater than about 56 (e.g., greater than 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 65, 70, 75, 80, 90, or 100) nucleotides in length.

[0154] 85. The TDSC of any one of embodiments 30-94, wherein the upstream DNA end form, the downstream DNA end form, or both comprise a Y-adapter.

[0155] 86. The TDSC of embodiment 85, wherein optionally the dsDNA does not comprise chemically modified nucleotides.

[0156] 87. The TDSC of embodiment 69, wherein the protelomerase sequence is generated from a first protelomerase recognition sequence (PRS) and a second PRS recognized by TelN protelomerase or ResT protelomerase.

[0157] 88. The TDSC of embodiment 69, wherein the protelomerase sequence is generated from a first protelomerase recognition sequence (PRS) and a second PRS recognized by Tel PY54 protelomerase or TelK protelomerase.

[0158] 89. The TDSC of any one of embodiments 1-85, 87 or 88, wherein one or both of the upstream exonuclease-resistant DNA end form and the downstream exonuclease-resistant DNA end form comprise at least one chemically modified nucleotide (e.g., comprising a chemical modification on each sense strand nucleotide and each antisense strand nucleotide).

[0159] 90. The TDSC of any one of embodiments 1-85 or 87-89, wherein one or both of the upstream exonuclease-resistant DNA end form and the downstream exonuclease-resistant DNA end form comprise one or more chemically modified nucleotides (e.g., phosphorothioate-modified nucleotides, boranophosphate-modified nucleotides, 5-methylcytosine-modified nucleotides, 7-methylguanine-modified nucleotides and / or methylated nucleotides).

[0160] 91. The TDSC of any one of embodiments 1-85 or 87-90, wherein the double-stranded region comprises one or more chemically modified nucleotides (e.g., phosphorothioate-modified nucleotides, boranophosphate-modified nucleotides, 5-methylcytosine-modified nucleotides, 7-methylguanine-modified nucleotides and / or methylated nucleotides).

[0161] 92. The TDSC of any one of embodiments 1-85 or 87-91, wherein the double-stranded region encodes a payload sequence, and wherein the antisense strand of the payload sequence comprises one or more chemically modified nucleotides (e.g., phosphorothioate-modified nucleotides, boranophosphate-modified nucleotides, 5-methylcytosine-modified nucleotides, 7-methylguanine-modified nucleotides, and / or methylated nucleotides).

[0162] 93. The TDSC of any one of embodiments 1-92, wherein the double-stranded region encodes a payload sequence, and wherein the sense strand of the payload sequence comprises one or more chemically modified nucleotides (e.g., phosphorothioate-modified nucleotides, boranophosphate-modified nucleotides, 5-methylcytosine-modified nucleotides, 7-methylguanine-modified nucleotides and / or methylated nucleotides).

[0163] 94. The TDSC of any preceding embodiment, wherein 80%, 85%, 90%, 95%, 98%, 99% or 100% of the sugars of the TDSC are deoxyribose.

[0164] 95. The TDSC of any preceding embodiment, wherein the TDSC comprises a sequence encoding an RNA (eg, an mRNA, a siRNA, or a miRNA).

[0165] 96. The TDSC of any one of embodiments 1-94, wherein the TDSC does not comprise a sequence encoding RNA.

[0166] 97. The TDSC of any preceding embodiment, wherein the TDSC is capable of being replicated (eg, by a DNA polymerase native to the cell comprising the TDSC).

[0167] 98. The TDSC of any one of embodiments 1-96, wherein the TDSC is not capable of being replicated.

[0168] 99. The TDSC of any preceding embodiment, wherein the TDSC is linear and capable of being cyclized.

[0169] 100. The TDSC of any one of embodiments 1-98, wherein the TDSC is linear and cannot be cyclized.

[0170] 101. The TDSC of any preceding embodiment, wherein the TDSC or a portion thereof is capable of integrating into the genome.

[0171] 102. The TDSC of any one of embodiments 1-100, wherein the TDSC or a portion thereof is incapable of integrating into the genome.

[0172] 103. The TDSC of any preceding embodiment, wherein the TDSC is capable of multimerization.

[0173] 104. The TDSC of any one of embodiments 1-102, wherein the TDSC is incapable of multimerization.

[0174] 105. A pharmaceutical composition comprising a double-stranded DNA (dsDNA) comprising an effector sequence, wherein:

[0175] a. The dsDNA lacks a vector backbone or lacks a material portion of a vector backbone, or does not contain a non-human (eg, bacterial) origin of replication;

[0176] b. The dsDNA is unencapsidated, substantially free of viral proteins, does not contain a viral packaging signal, or does not contain a viral ITR;

[0177] c. the dsDNA comprises exonuclease-resistant ends; and

[0178] d. The dsDNA comprises at least one chemically modified nucleotide.

[0179] 106. A pharmaceutical composition comprising the TDSC according to any one of the preceding embodiments.

[0180] 107. The pharmaceutical composition of embodiment 105 or 106, wherein the dsDNA or TDSC is contained in lipid nanoparticles (LNP).

[0181] 108. The pharmaceutical composition of any one of embodiments 105-107, further comprising an electroporation buffer.

[0182] 109. The pharmaceutical composition of any one of embodiments 105-108, further comprising a transfection reagent.

[0183] 110. A proto-TDSC comprising:

[0184] a) upstream exonuclease-resistant DNA end forms;

[0185] b) double-stranded region;

[0186] c) downstream exonuclease-resistant DNA end forms,

[0187] Wherein the protoTDSC comprises one or more (eg, 1 or 2) uracil nucleotides.

[0188] 111. The protoTDSC of embodiment 110, wherein the upstream exonuclease-resistant DNA end form comprises one or more (eg, 1 or 2) uracil nucleotides.

[0189] 112. The proto-TDSC of embodiment 110 or 111, wherein the downstream exonuclease-resistant DNA end form comprises one or more (eg, 1 or 2) uracil nucleotides.

[0190] 113. The proto-TDSC of any one of embodiments 110-112, wherein the upstream exonuclease-resistant DNA end form comprises a loop structure.

[0191] 114. The proto-TDSC of any one of embodiments 110-113, wherein the downstream exonuclease-resistant DNA end form comprises a loop structure.

[0192] 115. The proto-TDSC as described in any one of embodiments 110-114, wherein the upstream exonuclease-resistant DNA end form comprises one or more chemically modified nucleotides (e.g., phosphorothioate-modified nucleotides, boranophosphate-modified nucleotides, 5-methylcytosine-modified nucleotides, 7-methylguanine-modified nucleotides and / or methylated nucleotides).

[0193] 116. The proto-TDSC of any one of embodiments 110-115, wherein each nucleotide in the upstream exonuclease-resistant DNA end form is a chemically modified nucleotide (e.g., phosphorothioate-modified nucleotides, boranophosphate-modified nucleotides, 5-methylcytosine-modified nucleotides, 7-methylguanine-modified nucleotides and / or methylated nucleotides).

[0194] 117. The proto-TDSC as described in any one of embodiments 110-116, wherein the downstream exonuclease-resistant DNA end form comprises one or more chemically modified nucleotides (e.g., phosphorothioate-modified nucleotides, boranophosphate-modified nucleotides, 5-methylcytosine-modified nucleotides, 7-methylguanine-modified nucleotides and / or methylated nucleotides).

[0195] 118. The proto-TDSC as described in any one of embodiments 110-117, wherein each nucleotide in the downstream exonuclease-resistant DNA end form is a chemically modified nucleotide (e.g., phosphorothioate-modified nucleotides, boranophosphate-modified nucleotides, 5-methylcytosine-modified nucleotides, 7-methylguanine-modified nucleotides and / or methylated nucleotides).

[0196] 119. A raw TDSC comprising:

[0197] a) upstream exonuclease-resistant DNA end forms;

[0198] b) double-stranded region;

[0199] c) downstream exonuclease-resistant DNA end forms,

[0200] wherein the upstream exonuclease-resistant DNA end form comprises a sticky end, and / or wherein the downstream exonuclease-resistant DNA end form comprises a sticky end.

[0201] 120. A method for expressing a heterologous cargo in a target cell, the method comprising:

[0202] (i) introducing the TDSC or the composition as described in any one of the preceding embodiments into a target cell, wherein the double-stranded region of the TDSC comprises a sequence encoding a heterologous cargo; and

[0203] (ii) maintaining (e.g., incubating) the cells under conditions suitable for expression of the heterologous cargo from the TDSCs;

[0204] The heterologous cargo is thereby expressed in the target cell.

[0205] 121. A method for expressing a heterologous cargo in a target cell, the method comprising:

[0206] (i) providing a target cell comprising a TDSC or a composition as described in any one of embodiments 1-119, wherein the double-stranded region of the TDSC comprises a sequence encoding a heterologous cargo; and

[0207] (ii) maintaining (e.g., incubating) the cells under conditions suitable for expression of the heterologous cargo from the TDSCs;

[0208] The heterologous cargo is thereby expressed in the target cell.

[0209] 122. The method of embodiment 120 or 121, which is performed ex vivo or in vivo.

[0210] 123. A method for delivering a heterologous cargo to a target cell, the method comprising:

[0211] introducing the TDSC or composition of any one of embodiments 1-119 into a target cell, wherein the double-stranded region of the TDSC comprises a sequence encoding a heterologous cargo;

[0212] The heterologous cargo is thereby delivered to the target cell.

[0213] 124. A method of modulating (e.g., increasing or decreasing) a biological activity in a target cell, the method comprising:

[0214] (i) introducing the TDSC or composition of any one of embodiments 1-119 into a target cell, wherein the double-stranded region of the TDSC comprises a sequence encoding a heterologous payload that modulates a biological activity in the target cell; and

[0215] (ii) maintaining (e.g., incubating) the cells under conditions suitable for expression of the heterologous cargo from the TDSCs;

[0216] Thereby modulating the biological activity in the target cell.

[0217] 125. A method of modulating (e.g., increasing or decreasing) a biological activity in a target cell, the method comprising:

[0218] (i) providing a target cell comprising a TDSC or composition as described in any one of embodiments 1-119, wherein the double-stranded region of the TDSC comprises a sequence encoding a heterologous payload that modulates a biological activity in the target cell; and

[0219] (ii) maintaining (e.g., incubating) the cells under conditions suitable for expression of the heterologous cargo from the TDSCs;

[0220] Thereby modulating the biological activity in the target cell.

[0221] 126. The method of embodiment 124 or 125, wherein the heterologous load increases biological activity in the target cell.

[0222] 127. The method of embodiment 124 or 125, wherein the heterologous load reduces biological activity in the target cell.

[0223] 128. The method of any one of embodiments 124-127, wherein the biological activity comprises cell growth, cell metabolism, cell signaling, cell movement, specialization, interaction, division, transport, homeostasis, osmosis, or diffusion.

[0224] 129. The method of any one of embodiments 120-128, wherein the cell is an animal cell, such as a mammalian cell, such as a human cell.

[0225] 130. A method of treating a cell, tissue or subject in need thereof, the method comprising:

[0226] Administering the TDSC or composition of any one of embodiments 1-119 to the cell, tissue or subject, wherein the double-stranded region of the TDSC comprises a sequence encoding a heterologous cargo;

[0227] The cell, tissue or subject is thereby treated.

[0228] 131. A method for preparing TDSC, the method comprising:

[0229] (i) Connection:

[0230] Double-stranded DNA molecules

[0231] A hairpin DNA molecule comprising: a loop region comprising one or more chemically modified nucleotides and a double-stranded region;

[0232] thereby generating ligated dsDNA; and

[0233] (ii) incubating the ligated dsDNA with an enzyme that cleaves the loop region from the ligated dsDNA;

[0234] Thus, TDSCs were prepared.

[0235] 132. The method of embodiment 131, further comprising incubating the dsDNA (eg, after step ii) with an enzyme that generates blunt ends (eg, mung bean nuclease).

[0236] 133. The method of embodiment 131 or 132, wherein the enzyme that cleaves the loop region from the ligated dsDNA is uracil DNA glycosylase (UDG) and DNA glycosylase-lyase endonuclease VIII (e.g., USER enzyme mixture).

[0237] 134. A method for preparing TDSC, the method comprising:

[0238] (i) Connection:

[0239] Double-stranded DNA molecules

[0240] A hairpin DNA molecule comprising:

[0241] Ring area, and

[0242] Double-stranded region,

[0243] wherein the hairpin DNA molecule comprises, for example, one or more chemically modified nucleotides in the loop region;

[0244] thereby generating ligated dsDNA; and

[0245] (ii) incubating the ligated dsDNA with an enzyme that opens or cleaves the loop region;

[0246] Thus, TDSCs were prepared.

[0247] 135. The method of embodiment 134, wherein the loop region comprises uracil nucleotides.

[0248] 136. The method of embodiment 134 or 135, wherein the enzyme that opens or cleaves the loop region is uracil DNA glycosylase (UDG) and DNA glycosylase-lyase endonuclease VIII (e.g., USER enzyme mixture).

[0249] 137. A method for preparing a TDSC, the method comprising connecting:

[0250] Double-stranded DNA molecules

[0251] a self-annealing DNA molecule comprising a first region and a second region, wherein the first region hybridizes to the second region;

[0252] Thus, TDSC is produced.

[0253] 138. A method as described in Example 137, wherein the self-annealing DNA molecule further comprises a loop between the first region and the second region.

[0254] 139. A method as described in Example 138, wherein the loop comprises a heterologous functional sequence, such as a nuclear targeting sequence (such as a CT3 sequence); or a regulatory sequence.

[0255] 140. A method as described in embodiment 138 or 139, wherein the loop comprises a nuclear targeting sequence as listed in Table 3, or a nucleic acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity thereto.

[0256] 141. The method of any one of embodiments 138-140, wherein the loop comprises a nuclear targeting sequence that binds to a nuclear import protein listed in Table 3.

[0257] 142. The method of any one of embodiments 137-141, wherein the self-annealing DNA molecule does not contain any unhybridized nucleotides (eg, wherein all nucleotides of the self-annealing DNA molecule are hybridized to another nucleotide).

[0258] 143. The method of any one of embodiments 131-142, further comprising connecting a second hairpin DNA molecule to the double-stranded DNA molecule, wherein the second hairpin DNA molecule comprises a loop region and a double-stranded region, wherein optionally the second hairpin DNA molecule comprises one or more chemically modified nucleotides in one or both of the loop region or the double-stranded region.

[0259] 144. A method of preparing or manufacturing a TDSC, the method comprising:

[0260] a) providing a TDSC comprising a closed end, such as a TDSC described herein;

[0261] b) incubating the TDSCs with a double-stranded DNA exonuclease, such as Exonuclease III, such as 1 μL of Exonuclease III / 5 μg DNA in 50 μL at 37° C. for 1 hour, for example, as described in Example 10;

[0262] c) optionally, purifying the TDSC treated in step b), for example by passing through a silica membrane column, for example, as described in Example 10,

[0263] The TDSC is thereby prepared or manufactured.

[0264] 145. A method of preparing or manufacturing a TDSC, the method comprising:

[0265] a) providing a proto-TDSC, for example a proto-TDSC that has been treated with exonuclease III, wherein the proto-TDSC comprises a closed DNA end form each comprising uracil;

[0266] b) incubating the pro-TDSC with a uracil excision enzyme, such as USER enzyme, for example, incubating 3 μL of USER enzyme with 5 μg of DNA in 100 μL, for example, at 37° C. for 1 hour, for example, as described in Example 12;

[0267] c) optionally, incubating the TDSC with a single-stranded DNA nuclease, such as mung bean nuclease, such as 10 U mung bean nuclease with 5 μg of DNA in about 100 μL, for example at 30° C. for 30 min, for example, as described in Example 12;

[0268] d) optionally, purifying the TDSC treated in step c), for example by passing through a silica membrane column, for example, as described in Example 12,

[0269] The TDSC is thereby prepared or manufactured.

[0270] 146. The method of embodiment 144 or 145, further comprising determining the degradation of TDSC, for example by agarose gel, for example, as described in embodiment 10.

[0271] 147. The method of embodiment 146, further comprising, in response to measuring degradation (e.g., in response to determining that the degradation is below a predetermined value), performing one or more of the following: releasing the TDSC, placing the TDSC in a container, formulating the TDSC, or adding one or more excipients to the TDSC.

[0272] 148. A method of preparing or manufacturing a TDSC, the method comprising:

[0273] a) providing a TDSC, for example, a TDSC as described in any one of embodiments 1-119;

[0274] b) determining whether the structure of the TDSC matches a reference structure;

[0275] The TDSC is thereby prepared or manufactured.

[0276] 149. The method of embodiment 148, wherein the determination of (b) comprises sequencing the TDSCs.

[0277] 150. The method of embodiment 148 or 149, wherein determining in (b) comprises digesting the TDSC with a restriction enzyme.

[0278] 151. The method of any one of embodiments 148-150, wherein the structure of the TDSC matched to the reference structure is the same as the reference structure.

[0279] 152. The method of any one of embodiments 148-151, wherein the structure of the TDSC that matches the reference structure has the same sequence as the reference structure.

[0280] 153. The method of any one of embodiments 148-152, wherein the structure of the TDSC that matches the reference structure has the same length as the reference structure.

[0281] In embodiments, the TDSC has at least 15 nucleotides, at least 30 nucleotides, at least 50 nucleotides, at least 75 nucleotides, 100 nucleotides, at least 200 nucleotides, at least 300 nucleotides, at least 500 nucleotides, at least 750 nucleotides, at least 1,000 nucleotides, at least 2,000 nucleotides, at least 3,000 nucleotides, at least 4,000 nucleotides, at least 5,000 nucleotides, at least 10,000 nucleotides, at least 15,000 nucleotides, at least 20,000 nucleotides, at least 25,000 nucleotides, at least 30,000 nucleotides, at least 35,000 nucleotides, at least 40,000 nucleotides, at least 45,000 nucleotides, at least 50,000 nucleotides, at least 60,000 nucleotides, or more.

[0282] In an embodiment, the TDSC has 20 to 1000 nucleotides, 20 to 50 nucleotides, 100 to 500 nucleotides, 500 to 50,000 nucleotides, 1,000 to 50,000 nucleotides, 2,000 to 40,000 nucleotides, 5,000 to 50,000 nucleotides, 500 to 50,000 nucleotides, 500 to 25,000 nucleotides, 1,000 to 20,000 nucleotides, 1,000 to 10,000 nucleotides, 10,000 to 60,000 nucleotides, 1,000 to 20,000 nucleotides, 1,000 to 40,000 nucleotides.

[0283] In an embodiment, the TDSC comprises at least one nucleotide modification, e.g., a covalent nucleotide modification, e.g., selected from: N6-methyladenosine (m6A, 6mA); 5-formylcytosine (5-formyl-2'-deoxycytosine, 5fC, f5C); 5-carboxycytosine (5-carboxy-2'-deoxycytosine, 5-carboxycytosine, ca5C, 5caC); 5-hydroxymethylcytosine (5-hydroxymethyl-2'- In some embodiments, the nucleotide modification is a base modification. In some embodiments, the nucleotide modification is a backbone modification. In some embodiments, the nucleotide modification is a sugar modification. In some embodiments, the nucleotide modification comprises a peptide conjugate. In some embodiments, the nucleotide modification comprises a protein conjugate.

[0284] In an embodiment, the effector sequence is a DNA sequence encoding a therapeutic RNA (e.g., mRNA or regulatory RNA) that is operably linked to a promoter. In an embodiment, the RNA can be, for example, mRNA, tRNA, lncRNA, miRNA, rRNA, snRNA, microRNA, siRNA, piRNA, snoRNA, snRNA, exRNA, scaRNA, Y RNA or hnRNA.

[0285] In an embodiment, the effector sequence is a DNA sequence encoding a therapeutic peptide or polypeptide that is operably linked to a promoter. The therapeutic peptide or polypeptide can be, for example, a DNA binding protein; an RNA binding protein; a transporter; a transcription factor; a translation factor; a ribosomal protein; a chromatin remodeling factor; an epigenetic modifier; an antigen; a hormone; an enzyme (e.g., a nuclease, such as an endonuclease, such as a nuclease element of a CRISPR system, such as Cas9, dCas9, Cas9 nickase, Cpf / Cas12a); a CRISPR-linked enzyme, such as a base editor or a prime editor; a mobile genetic element protein (e.g., a transposase, a reverse transcriptase, a recombinase, an integrase); a gene writer polypeptide; a polymerase; a methylase; a demethylase; an acetylase; a deacetylase; a kinase; a phosphatase; a ligase; a deubiquitinase; a protease; an integrase; a recombinase; a topoisomerase; a gyrase; a helicase; a lysosomal acid hydrolase); an antibody (e.g., a whole antibody, a fragment thereof, or a nanobody); a signaling peptide; a receptor ligand; a receptor; a clotting factor (clotting factor); factor); coagulation factor; structural protein; caspase; membrane protein; mitochondrial protein; nuclear protein; or an engineered binding agent, such as centyrin, darpin or fibronectin. In an embodiment, the effector sequence is a DNA sequence encoding a reporter protein.

[0286] In an embodiment, a TDSC may include multiple effector sequences. Multiple effector sequences may be of the same or different types, for example, a TDSC may include an effector sequence as a structural DNA and a second effector sequence as a DNA sequence encoding a functional RNA or polypeptide. A TDSC may include an effector sequence as a DNA sequence encoding a functional RNA and a second effector sequence as a DNA sequence encoding a functional polypeptide. Multiple effector sequences may be the same or different sequences of the same type.

[0287] In embodiments, the TDSC is not placed in a carrier, eg, it is formulated for naked administration.

[0288] In an embodiment, TDSCs are formulated with a carrier, such as a lipid-based carrier, such as LNPs.

[0289] In an embodiment, TDSC is formulated with a pharmaceutical excipient.

[0290] In an embodiment, the TDSCs are formulated for parenteral administration.

[0291] In embodiments, the pharmaceutical composition is formulated for topical administration.

[0292] In an embodiment, the pharmaceutical composition is substantially free of impurities or process byproducts selected from the group consisting of endotoxins, mononucleotides, chemically modified mononucleotides, DNA fragments or truncations, and proteins (e.g., enzymes, e.g., ligases, restriction enzymes). In some embodiments, the pharmaceutical composition is substantially free of circular DNA.

[0293] In another aspect, the invention includes methods of delivering an effector to a subject, such as a subject in need thereof. The method comprises administering to the subject a composition described herein, such as any of the compositions described in the Examples above. In embodiments, the subject suffers from or has been diagnosed with a condition that can be treated with an effector.

[0294] In another aspect, the invention includes methods of regulating (e.g., increasing or decreasing) a biological parameter in a cell, tissue, or subject. The method comprises administering to the subject a composition as described herein, e.g., any of the compositions described in the embodiments above. In embodiments, the biological parameter is an increase or decrease in gene expression of a subject gene in a target cell, tissue, or subject, the increase or decrease being achieved by an effector sequence as described herein. In embodiments, the subject suffers from or has been diagnosed with a condition that can be treated with an effector.

[0295] In another aspect, the invention includes methods of treating cells, tissues or subjects. The methods include administering to cells, tissues or subjects in need thereof a TDSC or construct as described herein, e.g., as described in any of the above embodiments. In embodiments, the subject suffers from or has been diagnosed with a disorder that can be treated with an effector.

[0296] The present disclosure also provides methods of preparing the TDSC and dsDNA compositions described herein. In an embodiment, the method comprises performing a golden gate assembly.

[0297] In embodiments, the method further comprises enriching or purifying TDSCs.

[0298] In embodiments, enriching or purifying comprises substantially removing one or more impurities selected from endotoxins, mononucleotides, chemically modified mononucleotides, single-stranded DNA, DNA fragments or truncations, and proteins (eg, enzymes such as ligases, restriction enzymes) from TDSCs.

[0299] In embodiments, the method further comprises formulating the enriched or purified TDSCs for pharmaceutical use, such as formulating the TDSCs with a pharmaceutically acceptable excipient and / or with a carrier such as LNP.

[0300] definition

[0301] As used herein, the term "antibody" refers to a molecule that specifically binds to or reacts with a specific antigen, and includes at least the variable domain of the heavy chain, and generally includes at least the variable domain of the heavy chain and light chain of an immunoglobulin. Antibodies and their antigen-binding fragments, variants or derivatives include, but are not limited to, polyclonal antibodies, monoclonal antibodies, multispecific antibodies, human antibodies, humanized antibodies, primatized antibodies or chimeric antibodies, heterologous conjugated antibodies (e.g., bi-, tri- and tetra-specific antibodies, bi-antibodies, tri-antibodies and tetra-antibodies), single domain antibodies (sdAb), epitope binding fragments (e.g., Fab, Fab' and F(ab')2, Fd, Fv, single-chain Fv (scFv), rIgG, single-chain antibodies, disulfide-linked Fv (sdFv), nanobodies, fragments including VL or VH domains, fragments expressed by Fab Fragments produced by the library, and anti-idiotype (anti-Id) antibodies. Antibodies described herein can be any type (e.g., IgG, IgE, IgM, IgD, IgA and IgY), category (e.g., IgG1, IgG2, IgG3, IgG4, IgA1 and IgA2) or subclass of immunoglobulin molecules. In addition, unless otherwise indicated, the term "clonal antibody" (mAb) is intended to include intact molecules and antibody fragments (e.g., Fab and F (ab') 2 fragments) that can specifically bind to a target protein. Fab and F (ab') 2 fragments lack the Fc fragment of a complete antibody.

[0302] As used herein, the term "carrier" means a compound, composition, agent or molecule that facilitates or promotes the transport or delivery of a composition (e.g., a TDSC or nucleic acid encoding a dsDNA described herein) into a cell. For example, a carrier can be a partial or complete encapsulating agent.

[0303] As used herein, the term "chemically modified nucleotides", as used herein with respect to DNA, refers to nucleotides that contain one or more structural differences relative to canonical deoxyribonucleotides (i.e., G, T, C, and A). Chemically modified nucleotides can have (relative to canonical nucleotides) chemically modified nucleobases, chemically modified sugars, chemically modified phosphodiester linkages, or a combination thereof. No particular preparation process is implied; for example, chemically modified nucleotides can be produced directly by chemical synthesis, or by covalent modification of canonical nucleotides.

[0304] As used herein, the term "chemically modified cytosine nucleotide", as used herein with respect to DNA, refers to a chemically modified nucleotide wherein the nucleobase comprises a monocyclic 6-membered ring wherein carbon 4 is covalently bonded to a nitrogen that is not one of the six members of the ring, wherein the nucleobase of the chemically modified cytosine nucleotide comprises one or more structural differences relative to a canonical cytosine nucleobase. In some embodiments, the C-5 position of the nucleobase may have a substitution other than H. No particular preparation process is implied.

[0305] As used herein, the term "closed end" refers to a portion of a DNA molecule located at one end of a double-stranded region, wherein all nucleotides within the portion of the DNA molecule are covalently attached to adjacent nucleotides on either side. In some embodiments, a closed end may include a loop comprising one or more nucleotides that are not hybridized to another nucleotide. In some embodiments, each nucleotide at a closed end hybridizes to another nucleotide. In some embodiments, a TDSC comprises a first closed end (e.g., upstream of a heterologous target sequence) and a second closed end (e.g., downstream of a heterologous target sequence).

[0306] As used herein, the term "open end" refers to a portion of a DNA molecule located at one end of a double-stranded region, wherein at least one nucleotide ("terminal nucleotide") is covalently attached to only one other nucleotide. In some embodiments, the terminal nucleotide comprises a free 5' phosphate. In some embodiments, the terminal nucleotide comprises a free 3' OH. In some embodiments, in a TDSC comprising a first DNA strand and a second DNA strand, the open end comprises a first terminal nucleotide on the first DNA strand and a second terminal nucleotide on the second DNA strand. In some embodiments, the TDSC comprises a first open end (e.g., upstream of a heterologous target sequence) and a second open end (e.g., downstream of a heterologous target sequence). In some embodiments, the open ends comprise blunt ends, sticky ends, or Y-adapters.

[0307] As used herein, the term "DNA" refers to any compound and / or substance comprising at least two (e.g., at least 10, at least 20, at least 50, at least 100) covalently linked deoxyribonucleotides. In some embodiments, DNA is a single oligonucleotide chain, while in other embodiments, DNA comprises multiple oligonucleotide chains, and in yet other embodiments, DNA is a part of an oligonucleotide chain. In some embodiments, DNA is a compound and / or substance that is or can be incorporated into an oligonucleotide chain via a phosphodiester bond. In some embodiments, DNA comprises only canonical nucleotides. In some embodiments, DNA comprises one or more chemically modified nucleotides. In some embodiments, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% of the sugar of DNA is deoxyribose. In some embodiments, DNA is prepared by one or more of the following: separation from a natural source, enzymatic synthesis (in vivo or in vitro) based on polymerization of a complementary template, replication in a recombinant cell or system, and chemical synthesis.

[0308] As used herein, the term "DNA end form" refers to a structure comprising DNA located at the end of a TDSC. In some embodiments, the DNA end form comprises a closed end. In other embodiments, the DNA end form comprises an open end. In some embodiments, the DNA end form comprises a hairpin, a loop, a Y-adapter, a blunt end, or a sticky end. The DNA end form may comprise one or both of a single-stranded region and a double-stranded region. The DNA end form may comprise a canonical nucleotide, a chemically modified nucleotide, or a combination thereof. In some embodiments, the DNA end form comprises 3-100 nucleotides. In some embodiments, the TDSC comprises a first DNA end form at the first end and a second DNA end form at the second end. In some embodiments, the first DNA end form and the second DNA end form of the TDSC are of the same type. In some embodiments, the first DNA end form and the second DNA end form of the TDSC are of different types.

[0309] As used herein, the term "exonuclease resistance" when used to describe DNA means that the DNA is resistant to the exonuclease assay described in Example 10 if it comprises closed ends, and is resistant to the exonuclease assay described in Example 11 if it comprises open ends (e.g., two open ends).

[0310] As used herein, when used to describe a first element with reference to a second element, the term "heterologous" means that the first element and the second element do not exist in the arrangement as described in nature. For example, a heterologous polypeptide, nucleic acid molecule, construct or sequence refers to a polypeptide, nucleic acid molecule or a part of a polypeptide or nucleic acid molecule sequence that is not natural to the cell expressing it, (b) a polypeptide or nucleic acid molecule or a part of a polypeptide or nucleic acid molecule that has been changed or mutated relative to its natural state, or (c) a polypeptide or nucleic acid molecule with expression that is changed compared to the natural expression level under similar conditions. For example, a heterologous regulatory sequence (e.g., a promoter, an enhancer) can be used to regulate the expression of a gene or nucleic acid molecule in a manner different from the manner in which a gene or nucleic acid molecule is usually expressed in nature. In another example, a heterologous domain of a polypeptide or nucleic acid sequence (e.g., a DNA binding domain of a polypeptide or a nucleic acid encoding a DNA binding domain of a polypeptide) can be arranged relative to other domains, or can be a different sequence or relative to other domains or parts of a polypeptide or its encoding nucleic acid from different sources. In certain embodiments, the heterologous nucleic acid molecule may be present in the native host cell genome, but may have an altered expression level or have a different sequence or both. In other embodiments, the heterologous nucleic acid molecule may not be endogenous to the host cell or host genome, but is introduced into the host cell by transformation (e.g., transfection, electroporation), wherein the added molecule may be integrated into the host genome, or may exist transiently (e.g., mRNA) or semi-stably for more than one generation (e.g., episomal viral vectors, plasmids or other self-replicating vectors) as extrachromosomal genetic material.

[0311] As used herein, the term "heterologous functional sequence" refers to a nucleic acid sequence that is heterologous to an adjacent (e.g., directly adjacent) nucleic acid sequence and has one or more biological functions. In some embodiments, the biological function includes targeting to an organelle, such as nuclear targeting. In some embodiments, the heterologous functional sequence comprises a nuclear targeting sequence or a regulatory sequence.

[0312] As used herein, the terms "increase" and "reduce" refer to relative to a reference, regulating the function, expression or activity of an indicator to be produced respectively. For example, after applying TDSC in the method described herein, the amount of the indicator described herein (for example, the level of gene expression or a marker of innate immunity) can be increased or decreased by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 98% or more in a subject, which is relative to the amount of the marker before application, or relative to the application of control TDSC, such as TDSC containing chemically modified nucleotides compared to unmodified TDSC. Typically, the time of the effect is reached when applying, for example, at least one day, one week, one month, 3 months, or 6 months after starting a treatment regimen, the index after application is measured.

[0313] As used herein, the term "linear" with respect to the TDSCs described herein or nucleic acids comprising dsDNA refers to nucleic acids comprising two DNA chains or partial chains that hybridize to each other (thereby forming a double-stranded region), wherein the structure includes two ends. The ends may be closed ends or open ends. The two chains that hybridize to each other may be partially or completely complementary. In some embodiments, the linear TDSC is composed of a single strand of DNA that is circular under denaturing conditions, wherein under physiological conditions, the first portion of the chain hybridizes with the second portion of the chain (thereby forming a double-stranded region), and the linear TDSC comprises a first closed end comprising a first loop and a second closed end comprising a second loop.

[0314] As used herein, the term "loop" refers to a single-stranded nucleic acid sequence. The two ends of the loop are connected by a double-stranded region called a "stem", forming a "stem loop".

[0315] As used herein, the term "maintenance sequence" is a DNA sequence or motif that enables or promotes the retention of a DNA molecule in the nucleus by cell division. The maintenance sequence typically interacts with proteins that promote chromatin looping to achieve replication and / or transcription of DNA in the nucleus. An example of a maintenance sequence is a scaffold / matrix attachment region (S / MAR element).

[0316] As used herein, a "nuclear targeting sequence" is a DNA sequence that enables or promotes the entry of DNA into the nucleus of a target cell. In some embodiments, the nuclear targeting sequence is a DNA sequence of Table 3.

[0317] As used herein, "pharmaceutical composition" or "pharmaceutical preparation" refers to a composition or preparation for animal (e.g., human) or veterinary drug use, such as for the prevention, diagnosis or treatment of non-human animals or humans. The pharmaceutical preparation comprises an active agent that has a biological effect (e.g., pharmacological activity or an effect of alleviating, treating or preventing a disease) on the cells or tissues of a subject in combination with a pharmaceutically acceptable excipient or diluent. A pharmaceutical composition also means a finished dosage form or formulation of a preventive, diagnostic or therapeutic composition.

[0318] As used herein, the terms "peptide", "polypeptide" and "protein" are used interchangeably and refer to compounds comprising amino acid residues covalently linked by peptide bonds or other means than peptide bonds. A protein or peptide must contain at least two amino acids, and there is no limit to the maximum number of amino acids that can comprise a sequence of a protein or peptide. A polypeptide includes any peptide or protein comprising two or more amino acids linked to each other by peptide bonds or by means other than peptide bonds. As used herein, the term refers to both short chains, which are also commonly referred to in the art as peptides, oligopeptides and oligomers, and long chains, which are commonly referred to in the art as proteins, which have many types. In some embodiments, a polypeptide comprises non-canonical amino acid residues. As used herein, the term "protelomerase sequence" refers to a nucleotide sequence that can be produced by a protelomerase that connects a first protelomerase recognition sequence (PRS) to a second PRS. In some embodiments, the protelomerase sequence is produced by a method involving a protelomerase, and in other embodiments, the protelomerase sequence is produced by a method that does not involve a protelomerase (e.g., by solid phase synthesis).

[0319] As used herein, the "sense strand" of dsDNA is a strand that has the same sequence as an mRNA or precursor mRNA (pre-mRNA) encoding a functional protein and is not used as a transcription template. The "antisense strand" of dsDNA is a strand that has a sequence complementary to an mRNA or precursor mRNA encoding a functional protein and / or can be used as a transcription template.

[0320] As used herein, the term "double-stranded DNA" or dsDNA refers to a DNA composition comprising two complementary deoxyribonucleotide chains that are base paired with each other. The two complementary chains can have complete complementarity, or can have one or more mispairings, such as forming a protrusion. In certain embodiments, any one of the two chains can have a paired self-complementary region, which forms an intramolecular / intrachain double-stranded motif with a folded configuration, such as a hairpin loop, connection, protrusion or inner loop. In certain embodiments, dsDNA comprises one or two closed ends. In certain embodiments, the dsDNA molecule is circular or linear. In certain embodiments (for example, in a dsDNA molecule with a closed end), the two complementary chains of deoxyribonucleotides are covalently linked.

[0321] As used herein, the term "therapeutic double-stranded construct" ("TDSC") refers to a linear construct comprising DNA, wherein the construct is at least partially double-stranded. The TDSC does not comprise a plasmid backbone sequence (e.g., does not comprise a bacterial origin of replication). The TDSC does not comprise a viral capsid or viral envelope. In some embodiments, the TDSC comprises a closed end or an open end (e.g., a blunt end or a sticky end). In some embodiments, the TDSC is suitable for administration to a human subject.

[0322] As used herein, the term "original TDSC" refers to a construct that can be converted into a TDSC. In some embodiments, the original TDSC is a manufacturing intermediate that can undergo one or more steps (e.g., a cleavage step) to be converted into a TDSC. In some embodiments, the original TDSC falls within the definition of a TDSC, e.g., the original TDSC is a first TDSC and can undergo one or more steps to be converted into a second TDSC.

[0323] As used herein, the term "terminal nucleotide" refers to a nucleotide that is covalently attached to only one other nucleotide. In some embodiments, the terminal nucleotide comprises a free 5' phosphate. In some embodiments, the terminal nucleotide comprises a free 3' OH.

[0324] As used herein, "treatment" and "treating" refer to medical management of a subject that is intended to improve, alleviate, stabilize (i.e., not worsen), prevent, or cure a disease, pathological condition, or disorder. The term includes active treatment (treatment intended to improve a disease, pathological condition, or disorder), etiological treatment (treatment directed at the cause of the relevant disease, pathological condition, or disorder), palliative treatment (treatment intended to relieve symptoms), preventive treatment (treatment intended to minimize or partially or completely inhibit the development of the relevant disease, pathological condition, or disorder); and supportive treatment (treatment to supplement another therapy). Treatment also includes reducing the extent of a disease or condition; preventing the spread of a disease or condition; delaying or slowing the progression of a disease or condition; improving or alleviating a disease or condition; and relief (whether partial or complete relief), whether detectable or undetectable. Improving or alleviating a disease or condition means that the extent and / or adverse clinical manifestations of the disease, disorder, or condition are reduced and / or the time course of progression is slowed or prolonged compared to the extent or time course in the absence of treatment. "Treatment" can also mean prolonged survival compared to the expected survival without treatment. Those in need of treatment include those already with the condition or disorder as well as those prone to having the condition or disorder or those in which the condition or disorder is to be prevented.

[0325] As used herein, the term "Y-adapter" refers to a nucleic acid structure comprising a first nucleic acid region and a second nucleic acid region that are complementary to each other (e.g., completely complementary); the first and second regions can hybridize to form a double-stranded region. The first nucleic acid region is covalently linked to the third nucleic acid region, the second nucleic acid region is covalently linked to the fourth nucleic acid region, and the third and fourth nucleic acid regions are substantially non-complementary to each other; the third and fourth regions can be single-stranded. The first nucleic acid region is 3' of the third nucleic acid region and the second nucleic acid region is 5' of the fourth nucleic acid region. As a result, the third and fourth regions can be located on the same side of the double-stranded region. The Y-adapter can be part of a TDSC. BRIEF DESCRIPTION OF THE DRAWINGS

[0326] Figure 1A-1B The series of figures show exemplary covalently blocked DNA end patterns that can be included in a therapeutic double-stranded construct (TDSC) as described herein (eg, at one or both ends of the TDSC). Figure 1A Shown are exemplary TDSCs that do not include loop ends (e.g., protelomerase sequences), inverted terminal repeats (ITRs), or terminal hairpins, which may be composed of unmodified nucleotides (white symbols) or may include chemically modified nucleotides (grey symbols). Chemically modified nucleotides may include, for example, nucleotides modified in the backbone, sugar, or base, or nucleotides conjugated to a peptide or protein. In some cases, both DNA strands are unmodified. In some cases, both DNA strands are chemically modified. In some cases, the antisense strand is chemically modified. In some cases, the sense strand is chemically modified. Figure 1A The solid line box in represents a dsDNA molecule whose ends are covalently blocked with a hairpin, such as a linear covalently blocked dsDNA molecule having an end form comprising a phosphorothioate modification. Figure 1A The dashed box in represents a covalently closed dsDNA molecule without a loop end, such as a linear covalently closed dsDNA molecule with a TelN-terminal form.

[0327] Figure 2A series of figures show double-stranded DNA constructs, including exemplary TDSCs, which include exemplary DNA end forms (e.g., at one or both ends) that are non-covalently closed. Such exemplary TDSCs may include Y ends (e.g., Y adaptors, e.g., as described herein). In some cases, the DNA end forms may be composed of unmodified nucleotides (white symbols). In some cases, the DNA end forms include chemically modified nucleotides (gray symbols). Chemically modified nucleotides may include, for example, nucleotides modified in the backbone, sugar, or base, or nucleotides conjugated to a peptide or protein. In some cases, both DNA chains are unmodified. In some cases, both DNA chains are chemically modified. In some cases, the antisense strand is chemically modified. In some cases, the sense strand is chemically modified. The upper right corner also shows exemplary DNA constructs (i.e., unmodified double-stranded DNA molecules) lacking DNA end forms or chemical modifications.

[0328] Figure 3 A series of figures show the generation of exemplary TDSCs comprising flat-end DNA end forms, which include three phosphorothioate modifications between the terminal nucleotides of each chain. In short, a hairpin structure comprising phosphorothioate-modified nucleotides at the stem end is connected to a double-stranded DNA with an A tail. The hairpin comprises a pair of uracil nucleotides (arrows). USER enzyme treatment subsequently results in cutting at the uracil position, producing an overhang, which is then trimmed back to phosphorothioate-modified nucleotides using a nuclease (e.g., a single-strand specific nuclease, such as mung bean nuclease). Figure 3 SEQ ID NOs 85 and 86 are disclosed in order of appearance, respectively.

[0329] Figure 4 A series of figures show the generation of exemplary TDSCs comprising flat-end DNA end forms, which include six phosphorothioate modifications between the terminal nucleotides of each chain. In short, a hairpin structure comprising phosphorothioate-modified nucleotides at the stem end is connected to a double-stranded DNA with an A tail. The hairpin comprises a pair of uracil nucleotides (arrows). USER enzyme treatment subsequently results in cutting at the uracil position, producing an overhang, which is then trimmed back to phosphorothioate-modified nucleotides using a nuclease (e.g., a single-strand specific nuclease, such as mung bean nuclease). Figure 4 SEQ ID NOs 87 and 88 are disclosed in order of appearance, respectively.

[0330] Figure 5A series of figures show the generation of exemplary TDSCs comprising a Y adapter DNA end form at each end. In short, a hairpin structure comprising uracil nucleotides in the loop region is connected to a double-stranded DNA with an A tail. In an embodiment, the loop region comprises a phosphorothioate modification between nucleotides. Subsequent treatment with USER enzyme results in cleavage of uracil in the loop, generating two non-hybridized strands that form a Y adapter structure at the end of the dsDNA. Figure 5 SEQ ID NOs 89-92, 92 and 91 are disclosed in order of appearance, respectively.

[0331] Figure 6 A series of figures show exemplary covalently blocked DNA end forms that may be included in a TDSC as described herein. The DNA forms include, for example, mini-loop adapters comprising hairpins, macro-loop adapters (e.g., comprising hairpins comprising one or more functional elements in their single-stranded loop regions, such as CT3 ssDNA sequences), and acyclic adapters, wherein each nucleotide of the DNA end form hybridizes with another nucleotide and wherein the end is covalently blocked. Each of these exemplary end forms can, for example, be connected to a double-stranded DNA to form one end of a TDSC as described herein. Figure 6 SEQ ID NOs 93-95 are disclosed in order of appearance, respectively.

[0332] Fig. 7A An agarose gel showing TDSCs after exonuclease treatment is depicted. Figure 7B TDSC designated 6a is shown, corresponding to lanes 3 and 4 of the agarose gel. Figure 7C TDSC designated 3a is shown, corresponding to lanes 5 and 6 of the agarose gel. Fig.7D One end of the TDSC, designated Ya, is shown, corresponding to lanes 7 and 8 of the agarose gel. Fig.7D SEQ ID NOs 96 and 97 are disclosed in order of appearance, respectively.

[0333] Figure 8 The figure depicts the generation of a covalently blocked TDSC having a terminal form containing six phosphorothioate modifications (P6 form). Figure 8 SEQ ID NOs 98 and 99 are disclosed in order of appearance, respectively.

[0334] Fig. 9 The figure depicts the generation of covalently blocked TDSCs with TelN-terminal form. Fig. 9 SEQ ID NOs 100, 100 and 101 are disclosed in order of appearance, respectively.

[0335] Fig.10The figure depicts an exemplary method for producing circular dsDNA molecules. Linear dsDNA molecules can be contacted with a restriction enzyme (e.g., KpnI) to generate compatible sticky ends, which can then be joined to each other by ligation to generate circular dsDNA. Fig.10 SEQ ID NOs 102-105 are disclosed in order of appearance, respectively.

[0336] Fig.11 Shown is a fragment analyzer trace of circular dsDNA produced in a reaction using 25% 5-formyl-dCTP.

[0337] Fig.12 Shown is a fragment analyzer trace of a covalently blocked TDSC with terminal forms containing phosphorothioate modifications produced in a reaction using 25% 5-formyl-dCTP.

[0338] Fig.13 Shown is a fragment analyzer trace of a covalently blocked TDSC with a Tel N-terminal form produced in a reaction using 25% 5-formyl-dCTP.

[0339] Fig.14A and 14B The figure shows the expression of the reporter protein mCherry in HEKa cells, which were transfected with covalently blocked TDSCs, the TDSCs comprising a TelN terminal form (TelN form), a covalently blocked TDSC comprising a terminal form with six phosphorothioate modifications in each terminal form (P6 form), or a circular dsDNA molecule (cdsDNA form). TDSCs and circular dsDNA molecules were generated in reactions using unmodified cytosine or 25% 5-formyl-dCTP. Fig.14A The percentage of cells expressing mCherry is shown, and Fig. 14B Total fluorescence, defined as the percentage of expressing cells multiplied by the mean fluorescence intensity, is shown.

[0340] Figures 15A-15C A series of figures showing the expression of IFNβ in HEKa cells after lipid transfection with covalently blocked TDSCs. Fig.15A )、CXCL10( Fig. 15B ) and IL6( Fig. 15C) mRNA levels of TDSCs comprising TelN terminal forms (TelN forms), covalently blocked TDSCs comprising six phosphorothioate-modified terminal forms (P6 forms) in each terminal form, or circular dsDNA molecules (cdsDNA forms). TDSCs and circular dsDNA molecules were generated in reactions using unmodified cytosine or 25% 5-formyl-dCTP. RNA expression was normalized to GAPDH and expressed as fold change relative to method control (no DNA transfection).

[0341] Figures 16A-16C A series of figures showing the expression of IFNβ in THP1 cells after lipid transfection with covalently blocked TDSCs. Fig.16A )、CXCL10( Fig. 16B ) and IL6( Fig. 16C ) mRNA levels of TDSCs comprising TelN terminal forms (TelN forms), covalently blocked TDSCs comprising six phosphorothioate-modified terminal forms (P6 forms) in each terminal form, or circular dsDNA molecules (cdsDNA forms). TDSCs and circular dsDNA molecules were generated in reactions using unmodified cytosine or 25% 5-formyl-dCTP. RNA expression was normalized to GAPDH and expressed as fold change relative to method control (no DNA transfection).

[0342] Fig.17 The scatter plot of shows the innate immune response of HEKa cells to TDSCs containing the following: thiophosphorylated terminal adapters and specified modifications at the C-5 position of cytosine (i.e., 5-formylcytosine, 5-hydroxycytosine, 5-methylcytosine, or 5-hydroxymethylcytosine). The X-axis represents the reduction of interferon signaling, defined as the average fold change reduction of markers IFNB and CXCL10 relative to TDSCs produced using unmodified cytosine. The Y-axis represents the reduction of inflammatory cytokine signaling, defined as the average fold change reduction of markers IL6 and TNFa relative to TDSCs produced using unmodified cytosine. DETAILED DESCRIPTION

[0343] The present disclosure relates to compositions and methods for providing effectors (e.g., therapeutic effectors) to cells, tissues, or subjects (e.g., in vivo or in vitro). The effector can be a DNA sequence, a polypeptide (e.g., a therapeutic protein), or an RNA (e.g., a regulatory RNA or mRNA).

[0344] Elements of DNA constructs

[0345] The TDSC or nucleic acid comprising dsDNA described herein contains elements sufficient to deliver the effector sequence to a target cell, tissue or subject. In some embodiments, the effector sequence is a DNA sequence. In some embodiments, the TDSC drives the expression of the effector, for example, a sequence comprising a promoter and encoding RNA or a polypeptide (e.g., a therapeutic RNA or polypeptide). In some embodiments, the DNA construct described herein further comprises one or both of the following: a nuclear targeting sequence and a maintenance sequence. Although many of the embodiments herein relate to TDSC, it should be understood that, if applicable, the embodiments relating to TDSC may also be applicable to nucleic acids comprising dsDNA.

[0346] Exonuclease-resistant DNA end forms

[0347] TDSC described herein or the nucleic acid comprising dsDNA comprises DNA end form at each end of double-stranded DNA molecule.In some cases, DNA end form described herein can comprise closed end, wherein each nucleotide of DNA end form is covalently attached to two other nucleotides of DNA end form.In other cases, DNA end form described herein comprises open end, and the open end comprises at least one nucleotide that is only covalently connected to one other nucleotide of DNA end form.DNA end form generally has exonuclease resistance.In some cases, the DNA end form comprising closed end (for example, covalently closed end) is resistant to the exonuclease assay described in Example 10.In some cases, the DNA end form comprising open end (for example, such as Y adaptor, flat end or sticky end, for example, as described herein) is resistant to the exonuclease assay described in Example 11.

[0348] Closed ends, such as hairpins

[0349] In some embodiments, the exonuclease-resistant DNA end form comprises a DNA hairpin. The hairpin generally comprises a single-stranded loop region covalently attached to the double-stranded stem region at the 5' and 3' ends. In certain embodiments, the single-stranded loop region comprises one or more nucleotides (e.g., 1-2, 2-5, 5-10, 10-15, 15-20, 20-25, 25-30, 30-35, or 35-40 nucleotides) that are not hybridized to another nucleotide. Exemplary hairpin structures and exemplary TDSCs comprising hairpins are shown in Figure 1A middle.

[0350] In certain embodiments, the single-stranded loop region comprises one or more functional elements (e.g., a nuclear import sequence (e.g., a CT3 ssDNA sequence) or a regulatory sequence. In embodiments, the functional elements comprised in the single-stranded loop region are heterologous to the DNA end form and / or one or more other elements of the TDSC comprising the DNA end form. In certain embodiments, the length of the single-stranded loop region of the hairpin loop is less than about 5, 10, 15, 20, 25, 26, 27, 28, 29, or 30 nucleotides.

[0351] In an embodiment, the hairpin is contained in a TDSC with a dog bone (doggybone) conformation. In an embodiment, the hairpin comprises a protelomerase sequence (e.g., as described herein). In an embodiment, the protelomerase sequence is produced by TelN protelomerase, ResT protelomerase, Tel PY54 protelomerase or TelK protelomerase digestion. In an embodiment, the length of the protelomerase sequence is less than about 15, 20, 25, 26, 27, 28, 29 or 30 nucleotides. In an embodiment, the length of the protelomerase sequence is between about 28 (e.g., 25, 26, 27, 28, 29, 30, 31, 32, 33, 34 or 35) nucleotides and about 56 (e.g., 50, 51, 52, 53, 54, 55, 56, 57, 58, 59 or 60) nucleotides. In embodiments, the protelomerase sequence is greater than about 56 (e.g., greater than 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 65, 70, 75, 80, 90, or 100) nucleotides in length.

[0352] The hairpin can be attached to one or both ends of a double-stranded DNA molecule (e.g., a proto-TDSC as described herein), for example, by ligation (e.g., as described herein). In some embodiments, the TDSC described herein comprises a DNA hairpin loop at one or both ends. In some embodiments, the upstream exonuclease-resistant DNA end form of the TDSC described herein comprises a DNA hairpin loop. In some embodiments, the downstream exonuclease-resistant DNA end form of the TDSC described herein comprises a DNA hairpin loop.

[0353] In certain embodiments, the DNA hairpin loop comprises one or more unmodified nucleotides. In embodiments, the DNA hairpin loop is composed entirely of unmodified nucleotides. In certain embodiments, the DNA hairpin loop comprises one or more chemically modified nucleotides (e.g., phosphorothioate-modified nucleotides, e.g., as described herein). In embodiments, the DNA hairpin loop is composed entirely of chemically modified nucleotides (e.g., phosphorothioate-modified nucleotides, e.g., as described herein).

[0354] In certain embodiments, the single-stranded loop region of the DNA hairpin loop comprises one or more chemically modified nucleotides (e.g., phosphorothioate-modified nucleotides, e.g., as described herein). In embodiments, at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97% or 99% of the nucleotides in the single-stranded loop region are chemically modified nucleotides (e.g., phosphorothioate-modified nucleotides, e.g., as described herein). In embodiments, the single-stranded loop region of the DNA hairpin loop is entirely composed of chemically modified nucleotides (e.g., phosphorothioate-modified nucleotides, e.g., as described herein). In certain embodiments, the single-stranded loop region of the DNA hairpin loop comprises one or more unmodified nucleotides. In embodiments, the single-stranded loop region of the DNA hairpin loop is entirely composed of unmodified nucleotides.

[0355] In certain embodiments, the double-stranded stem region of the DNA hairpin loop comprises one or more unmodified nucleotides. In embodiments, the double-stranded stem region of the DNA hairpin loop is composed entirely of unmodified nucleotides. In certain embodiments, the double-stranded stem region of the DNA hairpin loop comprises one or more chemically modified nucleotides (e.g., phosphorothioate-modified nucleotides, for example, as described herein). In embodiments, at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97% or 99% of the nucleotides in the double-stranded stem region are modified nucleotides (e.g., phosphorothioate-modified nucleotides, for example, as described herein). In embodiments, the double-stranded stem region of the DNA hairpin loop is composed entirely of chemically modified nucleotides (e.g., phosphorothioate-modified nucleotides, for example, as described herein).

[0356] In an embodiment, the single-stranded loop region of the DNA hairpin loop comprises one or more chemically modified nucleotides (e.g., phosphorothioate-modified nucleotides, e.g., as described herein) and the double-stranded stem region comprises one or more unmodified nucleotides. In an embodiment, at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97% or 99% of the nucleotides in the single-stranded loop region are chemically modified nucleotides (e.g., phosphorothioate-modified nucleotides, e.g., as described herein). In an embodiment, the single-stranded loop region of the DNA hairpin loop is entirely composed of chemically modified nucleotides (e.g., phosphorothioate-modified nucleotides, e.g., as described herein) and the double-stranded stem region is entirely composed of unmodified nucleotides.

[0357] Y-Adapter

[0358] In some embodiments, the exonuclease-resistant DNA end forms described herein comprise a Y-adapter. As described herein, a Y-adapter typically comprises a pair of single-stranded DNA regions, each of which is attached to a strand of a double-stranded DNA region at one end, thereby forming a "Y" shape (wherein the base of the "Y" represents the double-stranded DNA region, and each upper fork of the "Y" represents two single-stranded DNA regions). Exemplary Y-adapter structures and exemplary TDSCs comprising Y-adapters are shown in Figure 2 middle.

[0359] In some embodiments, the Y-adapter is produced by attaching a hairpin loop comprising a single-stranded region to the end of a double-stranded DNA region (e.g., by ligation), wherein the single-stranded region comprises a cleavable portion (e.g., a uracil nucleotide). The cleavable portion can then be cleaved (e.g., by treatment with an enzyme capable of cleaving the cleavable portion, such as a USER enzyme) to produce two single-stranded DNA regions of the Y-adapter.

[0360] In certain embodiments, the single-stranded DNA region (e.g., one or two single-stranded DNA regions) of the Y-adapter comprises one or more chemically modified nucleotides (e.g., phosphorothioate-modified nucleotides, e.g., as described herein). In embodiments, at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, or 99% of the nucleotides in the single-stranded DNA region are chemically modified nucleotides (e.g., phosphorothioate-modified nucleotides, e.g., as described herein). In embodiments, the single-stranded DNA region (e.g., one or two single-stranded DNA regions) of the Y-adapter consists entirely of chemically modified nucleotides (e.g., phosphorothioate-modified nucleotides, e.g., as described herein). In certain embodiments, the single-stranded DNA region (e.g., one or two single-stranded DNA regions) of the Y-adapter comprises one or more unmodified nucleotides.

[0361] In an embodiment, the single-stranded DNA region (e.g., one or two single-stranded DNA regions) of the Y-adapter comprises one or more chemically modified nucleotides (e.g., phosphorothioate-modified nucleotides, e.g., as described herein) and the double-stranded DNA region of the Y-adapter comprises one or more unmodified nucleotides. In an embodiment, at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97% or 99% of the nucleotides in one or more single-stranded DNA regions are chemically modified nucleotides (e.g., phosphorothioate-modified nucleotides, e.g., as described herein). In an embodiment, the single-stranded DNA region (e.g., one or two single-stranded DNA regions) of the Y-adapter is entirely composed of chemically modified nucleotides (e.g., phosphorothioate-modified nucleotides, e.g., as described herein) and the double-stranded DNA region of the Y-adapter is entirely composed of unmodified nucleotides.

[0362] Acyclic closed DNA end forms

[0363] In some embodiments, the TDSCs described herein comprise a covalently closed exonuclease-resistant DNA end form that does not include a hairpin loop. For example, in certain embodiments, each nucleotide of the covalently closed DNA end form hybridizes to another nucleotide (e.g., Figure 6 In certain embodiments, the covalently blocked DNA end form comprises a first region and a second region, wherein the first region is capable of hybridizing as a whole to the second region (e.g., wherein the first region is complementary to the second region) and wherein the 3' end of the first region is covalently attached to the 5' end of the second region. In embodiments, the covalently blocked DNA end form as described herein can be attached to one end of the original TDSC as described herein, for example by ligation.

[0364] Open DNA end form

[0365] In some embodiments, the TDSCs described herein comprise non-covalently blocked exonuclease-resistant DNA end forms. In certain embodiments, the DNA end forms comprise blunt ends (e.g., blunt ends comprising one or more chemical modifications as described herein) or sticky ends (e.g., sticky ends comprising one or more chemical modifications as described herein).

[0366] In certain embodiments, the open DNA end form is produced by nuclease digestion of a covalently closed DNA end form such as a DNA hairpin. In an embodiment, the DNA hairpin comprises a double-stranded stem region comprising a cleavable portion (e.g., a uracil nucleotide) on each strand, and then the DNA hairpin is contacted with an enzyme (e.g., a USER enzyme) capable of cleaving the cleavable portion. In an embodiment, this results in the formation of a sticky end comprising an overhang. In an embodiment, the overhang is digested with an enzyme (e.g., a single-stranded specific nuclease, such as mung bean nuclease) to form a blunt end.

[0367] In certain embodiments, the DNA end form comprising a blunt end comprises one or more chemically modified nucleotides (e.g., phosphorothioate-modified nucleotides, e.g., as described herein). In embodiments, at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, or 99% of the nucleotides in the DNA end form comprising a blunt end are chemically modified nucleotides (e.g., phosphorothioate-modified nucleotides, e.g., as described herein). In embodiments, the DNA end form comprising a blunt end is entirely composed of chemically modified nucleotides (e.g., phosphorothioate-modified nucleotides, e.g., as described herein). In embodiments, the terminal base pair of the DNA end form comprising a blunt end comprises a chemically modified nucleotide (e.g., one or two nucleotides of the base pair are chemically modified), such as a phosphorothioate-modified nucleotide, e.g., as described herein. In an embodiment, a plurality of base pairs (e.g., 2, 3, 4, 5, or 6 base pairs) at the end of a DNA terminal form comprises chemically modified nucleotides (e.g., one or two nucleotides of the base pair are chemically modified), such as phosphorothioate-modified nucleotides, e.g., as described herein. In an embodiment, three base pairs at the end of a DNA terminal form comprise chemically modified nucleotides (e.g., one or two nucleotides of the base pair are chemically modified), such as phosphorothioate-modified nucleotides, e.g., as described herein. In an embodiment, six base pairs at the end of a DNA terminal form comprise chemically modified nucleotides (e.g., one or two nucleotides of the base pair are chemically modified), such as phosphorothioate-modified nucleotides, e.g., as described herein.

[0368] In certain embodiments, the DNA end form comprising a sticky end comprises one or more chemically modified nucleotides (e.g., phosphorothioate-modified nucleotides, e.g., as described herein). In embodiments, at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, or 99% of the nucleotides in the DNA end form comprising a sticky end are chemically modified nucleotides (e.g., phosphorothioate-modified nucleotides, e.g., as described herein). In embodiments, the DNA end form comprising a sticky end is entirely composed of chemically modified nucleotides (e.g., phosphorothioate-modified nucleotides, e.g., as described herein). In embodiments, the terminal nucleotide of the DNA end form comprising a sticky end comprises a chemically modified nucleotide (e.g., one or both nucleotides of the base pair are chemically modified), e.g., phosphorothioate-modified nucleotides, e.g., as described herein. In embodiments, the overhang region of the sticky end of the DNA end form comprises one or more chemically modified nucleotides, e.g., phosphorothioate-modified nucleotides, e.g., as described herein.

[0369] Inverted terminal repeats (ITR)

[0370] In some embodiments, the TDSC as described herein comprises an exonuclease-resistant DNA end form containing an inverted terminal repeat sequence (ITR). In some embodiments, the ITR is an ITR from a virus such as an adenovirus or an adeno-associated virus (AAV). In some embodiments, the ITR comprises a nucleic acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity with an ITR sequence from a virus such as an adenovirus or an adeno-associated virus (AAV). In certain embodiments, the ITR comprises an origin of replication (e.g., a viral origin of replication). In an embodiment, the TDSC as described herein comprises an exonuclease-resistant DNA end form containing an ITR (e.g., as described herein) at each end. In some embodiments, the TDSC does not comprise an ITR.

[0371] Promoter and other regulatory sequences

[0372] The TDSCs described herein or nucleic acids comprising dsDNA may contain a promoter (a DNA sequence to which RNA polymerase and transcription factors bind directly or indirectly to initiate transcription) operably linked to an effector sequence. Promoters may be found in nature, operably linked to an effector sequence, or may be heterologous to an effector sequence. Promoters described herein may be native to the target cell or tissue, or heterologous to the target cell or tissue. Promoters may be constitutive, inducible, and / or tissue-specific.

[0373] Examples of constitutive promoters include the retroviral Rous sarcoma virus (RSV) LTR promoter (optionally with a RSV enhancer), the cytomegalovirus (CMV) promoter (optionally with a CMV enhancer) (see, e.g., Boshart et al., Cell, 41:521-530 (1985)), the SV40 promoter, the dihydrofolate reductase promoter, the β-actin promoter, the phosphoglycerol kinase (PGK) promoter, and the EF1α promoter.

[0374] Inducible promoters allow for regulation of expression and can be regulated by exogenously provided compounds, environmental factors (such as temperature), or the presence of a specific physiological state (e.g., the acute phase, a particular differentiation state of the cell, or only when the cell is replicating). Inducible promoters and inducible systems are available from a variety of sources. Examples of inducible promoters regulated by exogenously provided promoters include the zinc-inducible sheep metallothionein (MT) promoter, the dexamethasone (Dex)-inducible mouse mammary tumor virus (MMTV) promoter, the T7 polymerase promoter system (WO 98 / 10088); ecdysone insect promoter (No et al., Proc. Natl. Acad. Sci. USA, 93:3346-3351 (1996)), tetracycline repressible system (Gossen et al., Proc. Natl. Acad. Sci. USA, 89:5547-5551 (1992)), tetracycline inducible system (Gossen et al., Science, 268:1766-1769 (1995), see also Harvey et al., Curr. Opin. Chem. Biol., 2:512-518 (1998)), RU486 inducible system (Wang et al., Nat. Biotech., 15:239-243 (1997) and Wang et al., Gene Ther. [Gene Therapy], 4:432-441 (1997)) and the rapamycin-inducible system (Magari et al., J. Clin. Invest. [Journal of Clinical Research], 100:2865-2872 (1997)).

[0375] In some embodiments, the native promoter of the effector encoding sequence can be used.

[0376] In some embodiments, regulatory sequences confer tissue-specific gene expression capability. In some cases, tissue-specific regulatory sequences are combined with tissue-specific transcription factors that induce transcription in a tissue-specific manner. Such tissue-specific regulatory sequences (e.g., promoters, enhancers, etc.) are known in the art. Exemplary tissue-specific regulatory sequences include, but are not limited to, the following tissue-specific promoters: liver-specific thyroxine binding globulin (TBG) promoter, insulin promoter, glucagon promoter, somatostatin promoter, pancreatic polypeptide (PPY) promoter, synaptophysin-1 (Syn) promoter, creatine kinase (MCK) promoter, mammalian desmin (DES) promoter, alpha-myosin heavy chain (a-MHC) promoter or cardiac troponin T (cTnT) promoter. Other exemplary promoters include: β-actin promoter, hepatitis B virus core promoter, Sandig et al., Gene Ther. [Gene Ther.], 3:1002-9 (1996); alpha-fetoprotein (AFP) promoter, Arbuthnot et al., Hum. Gene Ther. [Human Gene Ther.], 7:1503-14 (1996)), osteocalcin promoter (Stein et al., Mol. Biol. Rep. [Molecular Biology Reports], 24:185-96 (1997)); bone sialoprotein promoter (Chen et al., J. Bone Miner. Res. [Journal of Bone and Mineral Research] 11:654-64 (1996)), CD2 promoter (Hansal et al., J. Immunol. [Journal of Immunology], 161:1063-8 (1998); immunoglobulin heavy chain promoter; T cell receptor alpha chain promoter, neurons such as the neuron-specific enolase (NSE) promoter (Andersen et al. Cell. Mol. Neurobiol. [Cellular and Molecular Neurobiology], 13:503-15 (1993)), neurofilament light chain gene promoter (Piccioli et al., Proc. Natl. Acad. Sci. USA [Proceedings of the National Academy of Sciences of the United States of America], 88:5611-5 (1991)), and neuron-specific vgf gene promoter (Piccioli et al., Neuron [Neuron], 15:373-84 (1995)), as well as others that will be known to those skilled in the art.

[0377] Table 1 lists examples of tissue / cell-specific promoters:

[0378] Table 1: Tissue or cell specific promoters

[0379]

[0380]

[0381] The constructs described herein may also include other native or heterologous expression control elements, such as enhancer elements, polyadenylation sites or Kozak consensus sequences.

[0382] Effector sequence

[0383] The effector sequence of the TDSC or dsDNA-containing nucleic acid described herein can be, for example, a functional DNA sequence, such as a therapeutic functional DNA sequence; a DNA sequence encoding a therapeutic peptide, polypeptide or protein; or a DNA sequence encoding a therapeutic RNA (e.g., noncoding RNA).

[0384] DNA effectors:

[0385] The therapeutic functional DNA sequence may be a DNA sequence that forms a functional structure, such as a DNA sequence comprising a DNA aptamer, a deoxyribozyme or an allele-specific oligonucleotide (DNA ASO). The therapeutic functional DNA sequence may not have an operably linked promoter. In an embodiment, the TDSC described herein or a nucleic acid comprising dsDNA may include one or more functional DNA sequences, such as 2, 3, 4, 5, 6 or more sequences, which may be the same or different.

[0386] Peptide effector:

[0387] The DNA sequence encoding the therapeutic polypeptide may be a DNA sequence encoding one or more effectors, which are peptides, proteins, or a combination thereof. For example, the DNA sequence encodes mRNA. The peptide or protein can be: a DNA binding protein; an RNA binding protein; a transporter; a transcription factor; a translation factor; a ribosomal protein; a chromatin remodeling factor; an epigenetic modifier; an antigen; a hormone; an enzyme (e.g., a nuclease, such as an endonuclease, such as a nuclease element of a CRISPR system, such as Cas9, dCas9, Cas9 nickase, Cpf / Cas12a); a CRISPR-linked enzyme, such as a base editor or a guide editor; a mobile genetic element protein (e.g., a transposase, a retrotransposase, a recombinase, an integrase); a gene writer; a polymerase; a methylase; a demethylase; an acetylase; a deacetylase; a kinase; a phosphatase; a ligase; a deubiquitinase; a protease; an integrase; a recombinase; a topoisomerase; a gyrase; a helicase; a lysosomal acid hydrolase); an antibody (e.g., a whole antibody, a fragment thereof, or a nanobody); a signaling peptide; a receptor ligand; a receptor; a clotting factor; a coagulation factor factor); structural protein; caspase; membrane protein; mitochondrial protein; nuclear protein; engineered binding agent, such as centyrin, darpin or fibronectin. See, e.g., Gebauer & Skerra. 2020. Annual Review of Pharmacology and Toxicology 60: 1, 391-415.

[0388] In an embodiment, the TDSCs or nucleic acids comprising dsDNA described herein may include one or more sequences encoding a polypeptide, such as 2, 3, 4, 5, 6 or more sequences encoding a polypeptide. Each of the multiple sequences may encode the same or different proteins. For example, the TDSCs or sequences described herein may include multiple sequences encoding multiple proteins (e.g., multiple proteins in a biological pathway).

[0389] In some embodiments, the TDSC or sequence described herein may include multiple sequences encoding polypeptides, such as 2, 3, 4, 5, 6 or more sequences encoding polypeptides, which are separated by self-cleaving peptides such as P2A, T2A, E2A or F2A. The self-cleaving peptide is 18-22 amino acids long and can induce ribosome jumping during protein translation, thereby encoding two polypeptides in the same transcript. Each polypeptide can encode the same or different proteins. In one embodiment, the TDSC or sequence described herein may include a promoter, followed by a sequence encoding a first polypeptide of interest, a sequence encoding a 2A self-cleaving peptide, a sequence encoding a second polypeptide of interest, and a poly-A site. In another embodiment, the TDSC or sequence described herein may include a promoter, followed by a sequence encoding a first polypeptide of interest, a sequence encoding a first 2A self-cleaving peptide, a sequence encoding a second polypeptide of interest, a sequence encoding a second 2A self-cleaving peptide, a sequence encoding a third polypeptide of interest, and a poly-A site.

[0390] In some embodiments, the effector comprises a cell penetrating polypeptide. In some embodiments, the effector is a fusion protein comprising a cell penetrating polypeptide and a second amino acid sequence.

[0391] RNA effectors:

[0392] The effector sequence can be a DNA sequence encoding a non-coding RNA (e.g., one or more of short interfering RNA (siRNA), micro RNA (miRNA), long non-coding RNA, piwi-interacting RNA (piRNA), small nucleolar RNA (snoRNA), small Cajal body-specific RNA (scaRNA), transfer RNA (tRNA), ribosomal RNA (rRNA), RNA aptamer, and small nuclear RNA (snRNA)).

[0393] In some embodiments, the TDSC disclosed herein or the nucleic acid comprising dsDNA comprises one or more expression sequences encoding regulatory RNA (e.g., RNA that modifies the expression of endogenous genes and / or exogenous genes). In some embodiments, the TDSC disclosed herein or the sequence may comprise a sequence antisense to regulatory nucleic acid (e.g., non-coding RNA, such as, but not limited to, tRNA, lncRNA, miRNA, rRNA, snRNA, microRNA, siRNA, piRNA, snoRNA, snRNA, exRNA, scaRNA, Y RNA, and hnRNA). In one embodiment, the nucleic acid targeting host gene is regulated. The regulatory nucleic acid may include, but is not limited to, nucleic acids (e.g., antisense RNA, guide RNA) hybridized with endogenous genes, nucleic acids hybridized with exogenous nucleic acids (e.g., viral DNA or RNA), nucleic acids hybridized with RNA, nucleic acids interfering with gene transcription, nucleic acids interfering with RNA translation, nucleic acids stabilizing RNA or destabilizing RNA (e.g., by targeted degradation), and nucleic acids regulating DNA or RNA binding factors. In one embodiment, the sequence is miRNA. In some embodiments, the sense strand of the regulatory nucleic acid targeting host gene. In some embodiments, the antisense strand of the regulatory nucleic acid targeting host gene.

[0394] In some embodiments, the TDSC or sequence disclosed herein encodes a guide RNA. The guide RNA sequence is generally designed to have a length complementary to the targeted nucleic acid sequence between 15-30 nucleotides (e.g., 17, 19, 20, 21, 24 nucleotides), and a region that promotes complex formation (e.g., using tracrRNA or nuclease). Custom gRNA generators and algorithms are commercially available for designing effective guide RNAs. Gene editing can also be achieved using chimeric "single guide RNA" ("sgRNA"), which is an engineered (synthesized) single RNA molecule that simulates naturally occurring crRNA-tracrRNA complexes and simultaneously contains tracrRNA (for binding nucleases) and at least one crRNA (to guide nucleases to the targeted sequence for editing). It has also been shown that chemically modified sgRNAs are effective in genome editing; see, for example, Hendel et al. (2015) Nature Biotechnol. [Nature-Biotechnology], 985-991. The gRNA can recognize a specific DNA sequence (e.g., a sequence adjacent to or within a promoter, enhancer, silencer, or repressor of a gene). In one embodiment, the gRNA is used as part of a CRISPR system for gene editing. For the purpose of gene editing, the TDSCs or sequences disclosed herein can be designed to include one or more sequences encoding a guide RNA sequence corresponding to a desired target DNA sequence; see, e.g., Cong et al. (2013) Science, 339: 819–823; Ran et al. (2013) Nature Protocols, 8: 2281-2308.

[0395] The disclosed TDSC or sequence can encode certain regulatory nucleic acids, which can inhibit gene expression through the biological process of RNA interference (RNAi). RNAi molecules include RNA or RNA-like structures, which typically contain 15-50 base pairs (such as about 18-25 base pairs) and have the same (complementary) or nearly the same (substantially complementary) nucleobase sequence as the coding sequence in the target gene expressed in the cell. Such RNAi molecules include, but are not limited to: short interfering RNA (siRNA), double-stranded RNA (dsRNA), microRNA (miRNA), short hairpin RNA (shRNA), partial double helix and dicer substrate (U.S. Patent Nos. 8,084,599, 8,349,809 and 8,513,207), RNA antisense oligonucleotides (RNA ASO).

[0396] In one embodiment, the TDSC or sequence disclosed herein comprises a sequence containing the sense strand of a lncRNA. In one embodiment, the TDSC or sequence disclosed herein comprises a sequence encoding the antisense strand of a lncRNA.

[0397] The TDSC or sequence disclosed herein can encode a regulatory nucleic acid that is substantially complementary or completely complementary to a fragment of an endogenous gene or gene product (e.g., mRNA). The regulatory nucleic acid can be complementary to the sequence of an inner or adjacent exon at the boundary between an intron and an exon, thereby preventing the newly generated nuclear RNA transcript of a specific gene from maturing into an mRNA for transcription. The regulatory nucleic acid complementary to a specific gene can hybridize with the mRNA of the gene and prevent its translation. Antisense regulatory nucleic acid can be DNA, RNA, or a derivative or hybrid thereof. In certain embodiments, the regulatory nucleic acid comprises a protein binding site that can be bound to a protein that participates in the regulation of endogenous gene or exogenous gene expression.

[0398] The length of the TDSC or sequence of the regulatory nucleic acid that can encode and hybridize with the target transcript disclosed herein can be, for example, about 5 to 30 nucleotides, about 10 to 30 nucleotides, or about 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or more nucleotides. The degree of identity of the regulatory nucleic acid to the targeted transcript should be at least 75%, at least 80%, at least 85%, at least 90% or at least 95%.

[0399] The TDSCs or sequences disclosed herein may encode a microRNA (miRNA) molecule that is identical to about 5 to about 30 consecutive nucleotides of a target gene. In some embodiments, the miRNA sequence targets mRNA and starts with the dinucleotide AA, has a GC content of about 30%-70% (about 30%-60%, about 40%-60%, or about 45%-55%), and does not have a high percentage identity to any nucleotide sequence other than the target in the mammalian genome to be introduced therein, as determined, for example, by a standard BLAST search. In some embodiments, the TDSCs or sequences disclosed herein encode at least one miRNA, such as 2, 3, 4, 5, 6 or more. In some embodiments, the TDSCs or sequences disclosed herein comprise sequences encoding miRNAs that have at least about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% nucleotide sequence identity to any of these nucleotide sequences or to a sequence complementary to the target sequence. Lists of known miRNA sequences can be found in databases maintained by research organizations such as the Wellcome Trust Sanger Institute, the Penn Center for Bioinformatics, the Memorial Sloan Kettering Cancer Center, and the European Molecular Biology Laboratory. Known effective siRNA sequences and homologous binding sites are also well presented in the literature. RNAi molecules are easily designed by techniques known in the art. In addition, there are some computational tools that can increase the chance of finding effective and specific sequence motifs (see, for example, Lagana et al., Methods Mol. Bio. [Molecular Biology Methods], 2015, 1269: 393-412).

[0400] TDSC or sequence disclosed herein can regulate the expression of RNA encoded by genes. Because multiple genes may share a certain degree of sequence homology with each other, in some embodiments, TDSC or sequence disclosed herein can be designed to target a class of genes with sufficient sequence homology. In certain embodiments, TDSC or sequence disclosed herein can include sequences shared between different gene targets or sequences that are unique to specific gene targets and have complementarity. In certain embodiments, TDSC or sequence disclosed herein can be designed to target RNA sequences with conserved regions of homology between several genes, thereby targeting several genes (e.g., different gene isoforms, splice variants, mutant genes, etc.) in gene families. In certain embodiments, TDSC or sequence disclosed herein can be designed to target sequences unique to specific RNA sequences of individual genes.

[0401] In embodiments, the effector sequence encoding the regulatory RNA has a length of less than 5000 bp (e.g., less than about 5000 bp, 4000 bp, 3000 bp, 2000 bp, 1000 bp, 900 bp, 800 bp, 700 bp, 600 bp, 500 bp, 400 bp, 300 bp, 200 bp, 100 bp, 50 bp, 40 bp, 30 bp, 20 bp, 10 bp or less). In some embodiments, the effector sequence independently or additionally has a length of greater than 10 bp (e.g., at least about 10 bp, 20 bp, 30 bp, 40 bp, 50 bp, 60 bp, 70 bp, 80 bp, 90 bp, 100 bp, 200 bp, 300 bp, 400 bp, 500 bp, 600 bp, 700 bp, 800 bp, 900 bp, 1000 kb, 1.1 kb, 1.2 kb, 1.3 kb, 1.4 kb, 1.5 kb, 1.6 kb, 1.7 kb, 1.8 kb). 4kb, 4.1kb, 4.2kb, 4.3kb, 4.4kb, 4.5kb, 4.6kb, 4.7kb, 4.8kb, 4.9kb, 5kb or larger).

[0402] In some embodiments, the TDSC or sequence disclosed herein comprises one or more features described above, such as one or more structural DNA sequences, sequences encoding one or more peptides or proteins, sequences encoding one or more regulatory elements, sequences encoding one or more regulatory nucleic acids (e.g., one or more non-coding RNAs), other expressed sequences, and any combination thereof. The constructs described herein may have one or more effector sequences, such as 2, 3, 4, 5 or more effector sequences. In the case of multiple effector sequences in a single construct, the effector sequences may be the same or different.

[0403] In one embodiment, the TDSC comprises a therapeutic functional structural DNA sequence. In one embodiment, the TDSC comprises a promoter and a sequence encoding a therapeutic peptide, polypeptide or protein as described herein. In one embodiment, the TDSC comprises a promoter and a sequence encoding a regulatory RNA as described herein.

[0404] In some embodiments, the effector sequence encoding the polypeptide or protein is codon optimized, for example, for expression in a mammal (e.g., a human). In general, codon optimization refers to modifying a nucleic acid sequence to enhance expression in a target host cell by replacing at least one codon (e.g., one or more, such as 1, 2, 3, 4, 5, 10, 15, 20, 25, 50 or more codons; e.g., at least 1%, 5%, 10%, 20%, 25%, 50%, 60%, 70%, 80%, 90% or 100%) of the original sequence with a more commonly used or most commonly used codon in the genes of the host cell while retaining the original amino acid sequence. Codon usage tables are available, for example, in the "Codon Usage Database" at http: / / www.kazusa.or.jp / codon / . These tables can be modified in a variety of ways, for example, see Nakamura et al., 2000, Nucl. Acids Res. [Nucleic Acids Research] 28: 292. Computer algorithms are also available for codon-optimizing specific sequences for expression in specific host cells, such as Gene Forge.

[0405] Nuclear targeting sequence (NTS)

[0406] TDSC or nucleic acid comprising dsDNA (e.g., as disclosed herein) may include a nuclear targeting sequence (NTS) that promotes DNA transport from the cytoplasm to the nucleus. NTS includes sites that bind to proteins (e.g., transcription factors, chaperones, etc.), which bind to nuclear import proteins that transport cargo to the nucleus through the nuclear pore complex. In an embodiment, NTS can play a role in general (e.g., SV40 enhancer NTS). In other embodiments, NTS can be cell or tissue specific, for example, containing binding sites for transcription factors expressed in unique cell types, and these transcription factors (e.g., SRF, Nkx3) can target the TDSC described herein to the nucleus in a cell-specific manner. NTS can function at multiple positions in the TDSC described herein, for example, before a promoter and / or after an effector sequence.

[0407] NTS can be virally derived or non-virally derived. For example, NTS is described in Le Guen et al. 2021. Nucleic Acids [Nucleic Acids] Vol. 24: 477-486. Examples of NTS are disclosed in Table 2:

[0408] Table 2: Exemplary nuclear targeting sequences Viral / non-viral name Sequence Viral SV40 5'-cccaagaagaagaggaaagtc-3' (SEQ ID NO: 1)

[0409] Non-viral 3NF 5'-ctggggactttccagcctggggactttccagctgggactttccagg-3'

[0410] (SEQ ID NO: 106)

[0411] In some embodiments, the NTS has a sequence according to Table 2, or a functional sequence at least 80%, 90%, 95%, 96%, 97%, 98% or 99% identical thereto.

[0412] Nuclear import protein

[0413] In some embodiments, the TDSC or nucleic acid comprising dsDNA (e.g., as described herein) is capable of being imported into the nucleus of a cell, for example, by a nuclear import protein (e.g., a nuclear import protein as listed in Table 3). In some embodiments, the TDSC or nucleic acid comprising dsDNA (e.g., as described herein) can bind to a nuclear import protein (e.g., a nuclear import protein as listed in Table 3). In some embodiments, the TDSC or nucleic acid comprising dsDNA (e.g., as described herein) comprises a recognition sequence of a nuclear import protein (e.g., as listed in any row of Table 3). In some embodiments, the TDSC or nucleic acid comprising dsDNA (e.g., as described herein) comprises a recognition sequence as listed in Table 3, or a nucleic acid sequence having at least 75%, 80%, 90%, 95%, 96%, 97%, 98% or 99% identity thereto. In some embodiments, the exonuclease-resistant DNA end form (e.g., contained in a TDSC or a nucleic acid containing dsDNA, e.g., as described herein) comprises a recognition sequence as listed in Table 3, or a nucleic acid sequence having at least 75%, 80%, 90%, 95%, 96%, 97%, 98% or 99% identity thereto.

[0414] Exemplary import proteins include, for example, basic helix-loop-helix (bHLH) proteins, heterogeneous nuclear ribonucleoprotein (hnRNP) isoforms, nuclear factor I (NFI) proteins, such as those listed in Table 3. In some embodiments, the bHLH protein comprises an acetylcholine receptor subunit, for example, an alpha subunit, for example, CHRNA1, CHRNA2, CHRNA3, CHRNA4, CHRNA5, or CHRNA7. In some embodiments, the acetylcholine receptor subunit comprises a gamma or epsilon subunit. In some embodiments, the import protein comprises desmin. In some embodiments, the import protein comprises a hnRNP, for example, hnRNP A1, hnRNP C, hnRNP K, and hnRNP U. In some embodiments, the import protein comprises a nuclear import protein. In some embodiments, the import protein comprises a myosin light chain. In some embodiments, the import protein comprises NFI. In some embodiments, the import protein comprises NFKB. In some embodiments, the import protein comprises a nucleoside diphosphate kinase, for example, NM23-H2. In some embodiments, the import protein comprises Oct1. In some embodiments, the import protein comprises Oct2.

[0415] In some embodiments, the importin comprises SRF. In some embodiments, the importin comprises TEF-1. In some embodiments, the importin comprises AP2. In some embodiments, the importin comprises a troponin, e.g., troponin I, e.g., troponin I 2. In some embodiments, the importin comprises TTF-1. In some embodiments, the importin comprises a Ran binding protein, e.g., RanBP3 or RanBP1. In some embodiments, the importin comprises a homeobox transcription factor, e.g., Chx10.

[0416] In some embodiments, the import factor specifically binds to an E-box, a DTS (e.g., SV40 DTS or SMGA DTS), a promoter (e.g., SP-C promoter or htk promoter), a telomere, an ATTT motif, a cell cycle regulatory unit (CCRU), a CT3 sequence, S / MAR, a topoisomerase II consensus sequence, an ARS consensus sequence, 3NF, a viral ori (e.g., an EBV oriP site).

[0417]

[0418]

[0419]

[0420]

[0421]

[0422]

[0423]

[0424]

[0425]

[0426]

[0427]

[0428]

[0429]

[0430]

[0431]

[0432]

[0433]

[0434]

[0435]

[0436]

[0437]

[0438]

[0439]

[0440]

[0441]

[0442]

[0443]

[0444]

[0445]

[0446]

[0447]

[0448]

[0449]

[0450]

[0451] Maintain sequence

[0452] The TDSC disclosed herein or the nucleic acid comprising dsDNA may include a maintenance sequence that supports or enables the TDSC of the present invention to continue gene expression in a host cell by continuous rounds of cell division and / or differentiation of progenitor cells. In an embodiment, the maintenance sequence is a nuclear scaffold / matrix attachment region (S / MAR). The S / MAR element is a diverse, AT-rich sequence ranging from 60-500bp, which is conserved between species and is believed to anchor chromatin to nuclear matrix proteins during interphase (Bode et al. 2003. Chromosome Res [Chromosome Research] 11, 435–445). S / MAR can be incorporated into the TDSC described herein to promote long-term transgenic expression and extrachromosomal maintenance. In one embodiment, the maintenance sequence is human interferon-β MAR (5'tataattcactggaatttttttgtgtgtatggtatgacatatgggttcccttttattttttacatataaatatatttccctgtttttctaaaaa agaaaaagatcatcattttcccattgtaaaatgccatatttttttcataggtcacttacata-3' (SEQ ID NO: 39)), or a functional sequence having at least 80%, 90%, 95% or 98% identity thereto. In an embodiment, S / MARs that can be used in constructs described herein can be found by searching MARome at http: / / bioinfo.net.in / MARome, which is also described in Narwade et al. 2019. Nucleic Acids Research. [Nucleic Acids Research] Vol. 47, No. 14: 7247–7261.

[0453] In embodiments, the TDSCs described herein are capable of replicating in mammalian cells, such as human cells. In some embodiments, the TDSCs described herein are maintained in a host cell, tissue, or subject by at least one cell division. For example, the TDSCs described herein are maintained in a host cell, tissue, or subject by at least 2, 3, 4, 5, 6, 7, 8, 10, 15, 20, 40, 50, or more cell divisions. In vitro, cell division can be tracked by flow cytometry or microscopy. In vivo, cell division can be tracked by intravital microscopy.

[0454] Other components

[0455] The TDSC disclosed herein or the nucleic acid comprising dsDNA may also include other control elements that are operably connected to the effector sequence (e.g., the sequence encoding the effector) in a manner that allows it to be transported, positioned, transcribed, translated, and / or expressed in a target cell, or that promotes its degradation or inhibition of expression in a non-target cell. As used herein, "operably connected" sequences include expression control sequences adjacent to the sequence encoding the effector and trans or at a distance that act to control the expression control sequence of the sequence encoding the effector. The exact nature of the regulatory sequence required for gene expression in the host cell may vary depending on species, tissue, or cell type, but as required, it may generally include 5' non-transcribed and 5' non-translated sequences, such as TATA boxes, capping sequences, CAAT sequences, enhancer elements, etc., respectively, that are relevant to transcription and translation initiation. As required, the regulatory sequence may also include an enhancer sequence or an upstream activator sequence. The construct described herein may optionally include a 5' leader sequence or a signal sequence.

[0456] Chemically modified nucleotides

[0457] TDSCs or nucleic acids comprising dsDNA and compositions described herein may have chemical modifications of the nucleobases, sugars and / or phosphate backbones (e.g., Figure 1A-2 ). Although not wishing to be bound by theory, such modifications can be used to protect DNA from degradation (e.g., from exonuclease degradation) or from degradation by host tissues or the immune system of a subject. In general, chemically modified nucleotides have the same base pairing specificity as unmodified nucleotides, for example, a chemically modified adenine "A" can be base paired with thymine "T". One or more atoms of a pyrimidine nucleobase can be replaced or substituted by an optionally substituted amino group, an optionally substituted thiol, an optionally substituted alkyl group (e.g., methyl or ethyl) or a halo group (e.g., chloro or fluoro). In certain embodiments, a chemical modification (e.g., one or more modifications) is present in each sugar and internucleoside linkage.

[0458] In some embodiments, the TDSC comprises at least one chemical modification. Suitable modifications are described in Sood et al. 2019. DNAmod: the DNA modification database. [DNA modification: DNA modification database] J Cheminform [Cheminformatics] 11, 30. DNAmod is an open source database (https: / / dnamod.hoffmanlab.org) that catalogs chemically modified nucleotides and provides a single source for understanding their properties. DNAmod provides a web interface to easily browse and search these modifications. The database annotates the chemical properties and structures of all selected chemically modified DNA bases, as well as a larger list of candidate chemical entities. DNAmod includes manual annotations of available sequencing methods, descriptions of their occurrence in nature, and provides existing and suggested nomenclature. Examples of chemical modifications of DNA that can be used in the methods described herein include, for example, N6-methyladenosine (m6A, 6mA); 5-formylcytosine (5-formyl-2'-deoxycytosine, 5fC, f5C); 5-carboxycytosine (5-carboxy-2'-deoxycytosine, 5-carboxycytosine, ca5C, 5caC); 5-hydroxymethylcytosine (5-hydroxymethyl-2'-deoxycytosine, 5hmC, hm5C); 5-methyldeoxycytosine (5-methyl cytosine; 5-methyl-2'-deoxycytosine; m5dC; 5mC, m5C); 5'-methylcytosine; 3-methylcytosine (m3C); 2'-fluoro-2'deoxynucleoside; 5-glucosylmethylcytosine; 5-methylpyrimidine; 8-oxoguanine (8-oxoG); phosphorothioate; S and R phosphorothioate linkages; methylthymine; N3'-P5' phosphoramidate (NP); cyclohexane nucleic acid (CeNA); tricyclic DNA (tcDNA).For example, see Pu et al. 2020. An in-vitro DNA phosphorothioate modification reaction. Mol Microbiol. 113:452–463; Zheng & Sheng. 2021. Synthesis of N4-methylcytidine(m4C)and N4,N4-dimethylcytidine(m42C)modified RNA. Current Protocols, 1, e248; Ohkubo et al. 2021. Chemical synthesis of modified oligonucleotides containing 5′-amino-5′-deoxy-5′-hydroxymethylthymidine residues. Current Protocols, 1, e248. Protocols, 1, e70; Bao and Xu. 2021. Observation of Z-DNA structure via the synthesis of oligonucleotide DNA containing 8-trifluoromethyl-2-deoxyguanosine. Current Protocols, 1, e28; Skakuj et al. 2020. Automated synthesis and purification of guanidine-backbone oligonucleotides. Current Protocols in Nucleic Acid Chemistry, 81, e110.

[0459] In some embodiments, the TDSC described herein may include nucleotides modified by phosphorothioate. In some embodiments, the DNA end forms described herein (e.g., exonuclease-resistant DNA end forms) may include nucleotides modified by phosphorothioate. In some embodiments, the TDSC described herein may include S and R phosphorothioate-modified nucleotide linkages. In one embodiment, phosphorothioate linkages are according to Iwamoto et al., 2017, Nature Biotechnology [Natural Biotechnology], Vol. 35: 845-851 production. In short, the monomers of nucleoside 3'-oxazolidinone derivatives are synthesized by iterative capping and sulfurized oligonucleotides to produce stereo-controlled phosphorothioate linkages. The final sample is analyzed by reversed-phase high performance liquid chromatography (RP-HPLC) and ultra-high performance liquid chromatography mass spectrometry (UPLC / MS) to determine the modified stereochemistry. Nucleic acids containing phosphorothioate linkages are also commercially available.

[0460] In some embodiments, the TDSC described herein may include boranophosphate-modified nucleotides, for example, according to the method of Sergueev and Shaw, 1998, J Am Chem Soc [Journal of the American Chemical Society], Vol. 120, No. 37: 9417-9427. In short, the H-phosphonate chain is elongated followed by borylation to replace the non-bridging oxygen in the phosphate backbone with a borane group. The final sample is purified and analyzed by RP-HPLC to determine the stereochemistry of the modification. Boranophosphate-modified nucleotides are also commercially available.

[0461] In some embodiments, the TDSCs described herein may include 5-methylcytosine modified nucleotides, for example, prepared according to the method of Lin et al., 2002, Mol Cell Biol [Molecular and Cell Biology], Vol. 22, No. 3: 704-723. In short, cytosine or cytosine-containing sequences are incubated with a glutathione S-transferase fusion of a wild-type Dnmt3a (GST-3a) protein using unlabeled S-adenosylmethionine (AdoMet). The nucleotides are purified and analyzed by HPLC to determine that the nucleotides are methylated at the correct position. 5-methylcytosine modified nucleotides are also commercially available.

[0462] In some embodiments, the TDSCs described herein may include 7-methylguanine modified nucleotides. In one embodiment, 7-methylguanine modified nucleotides are prepared according to the method of Jones and Robins, 1963, Purinenucleosides.III.Methylation studies of certain naturally occurring purinenucleosides, J Am Chem Soc, Vol. 85: 193. In short, 2'-deoxyguanosine in dimethyl sulfoxide is treated with iodomethane. The nucleotides are purified and analyzed by HPLC to determine that the nucleotides are methylated in the correct position. In another embodiment, 7-methylguanine modified nucleotides are prepared according to the method described in Hendler et al., 1970, Vol. 9, No. 21: 4141: 4153, and Kore and Parmar, 2006, Biochemistry, Vol. 25, No. 3: 337-340. Briefly, guanine 5'-diphosphate in water is added to dimethyl sulfate instead of guanosine 5'-diphosphate to produce 7-methyl GDP. The nucleotides are purified and analyzed by HPLC to confirm that the nucleotides are methylated at the correct position. 7-methylguanine modified nucleotides are also commercially available.

[0463] In some embodiments, the TDSC described herein comprises methylation at one or more CpG or GpC dinucleotides. In some embodiments, the TDSC described herein comprises methylation introduced by AluI methyltransferase. In some embodiments, the TDSC described herein comprises methylation introduced by BamHI methyltransferase. In some embodiments, the TDSC described herein comprises methylation introduced by CpG methyltransferase (M.Sssl). In some embodiments, the TDSC described herein comprises methylation introduced by dam methyltransferase. In some embodiments, the TDSC described herein comprises methylation introduced by EcoGII methyltransferase. In some embodiments, the TDSC described herein comprises methylation introduced by EcoRI methyltransferase. In some embodiments, the TDSC described herein comprises methylation introduced by GpC methyltransferase (M.CviPI). In some embodiments, the TDSC described herein comprises methylation introduced by HaeIII methyltransferase. In some embodiments, the TDSC described herein comprises methylation introduced by HhaI methyltransferase. In some embodiments, the TDSC described herein comprises methylation introduced by HpaII methyltransferase. In some embodiments, the TDSC described herein comprises methylation introduced by MspI methyltransferase. In some embodiments, the TDSCs described herein comprise methylation introduced by TaqI methyltransferase. In some embodiments, the methods described herein comprise contacting the dsDNA with AluI methyltransferase, BamHI methyltransferase, M.Sssl, dam methyltransferase, EcoGII methyltransferase, EcoRI methyltransferase, M.CviPI, HaeIII methyltransferase, Hhal methyltransferase, HpaII methyltransferase, MspI methyltransferase, or TaqI methyltransferase.

[0464] In some embodiments, the TDSC described herein comprises a carboxyl modification or a formyl modification.

[0465] In embodiments, a TDSC or one strand of a TDSC described herein (e.g., the sense strand or the antisense strand) comprises between 1%-100% chemically modified nucleotides, between 1%-90% chemically modified nucleotides, between 1%-80% chemically modified nucleotides, between 1%-70% chemically modified nucleotides, between 1%-60% chemically modified nucleotides, between 1%-50% chemically modified nucleotides, between 1%-40% chemically modified nucleotides, between 1%-30% chemically modified nucleotides, between 1%-20% chemically modified nucleotides, between 1%-15% chemically modified nucleotides, between 1%-10% chemically modified nucleotides, between 20%-90% chemically modified nucleotides, between 20%-80% chemically modified nucleotides. In embodiments, a TDSC or one strand of a TDSC described herein (e.g., the sense strand or the antisense strand) comprises at least 1% chemically modified nucleotides, at least 5% chemically modified nucleotides; at least 10% chemically modified nucleotides; at least 15% chemically modified nucleotides; at least 20% chemically modified nucleotides; at least 25% chemically modified nucleotides; at least 30% chemically modified nucleotides; at least 40% chemically modified nucleotides; at least 50% chemically modified nucleotides; at least 60% chemically modified nucleotides; at least 70% chemically modified nucleotides; at least 80% chemically modified nucleotides; at least 85% chemically modified nucleotides; at least 90% chemically modified nucleotides; at least 92% chemically modified nucleotides; at least 95% chemically modified nucleotides; at least 97% chemically modified nucleotides. In embodiments, a TDSC or one strand of a TDSC described herein (e.g., the sense strand or the antisense strand) comprises 0%-100% chemically modified nucleotides for each different nucleotide, e.g., 0%-100% chemically modified T nucleotides, 0%-100% chemically modified A nucleotides, 0%-100% chemically modified C nucleotides, and 0%-100% chemically modified G nucleotides for each construct.In embodiments, a TDSC or one strand of a TDSC described herein (e.g., the sense strand or the antisense strand) comprises 0%-100%, 10%-100%, 20%-100%, 30%-100%, 40%-100%, 50%-100%, 60%-100%, 10%-50% chemically modified nucleotides per different nucleotide, e.g., 0%-100%, 10%-100%, 20%-100%, 30%-100%, 40%-100%, 50%-100%, 60%-100%, 10%-50% chemically modified T nucleotides; , 20%-100%, 30%-100%, 40%-100%, 50%-100%, 60%-100%, 10%-50% chemically modified A nucleotides; 0%-100%, 10%-100%, 20%-100%, 30%-100%, 40%-100%, 50%-100%, 60%-100%, 10%-50% chemically modified C nucleotides; or 0%-100%, 10%-100%, 20%-100%, 30%-100%, 40%-100%, 50%-100%, 60%-100%, 10%-50% chemically modified G nucleotides. For example, a TDSC may contain 100% chemically modified T nucleotides, 50% chemically modified A nucleotides, 0% chemically modified C nucleotides, and 25% chemically modified G nucleotides.

[0466] In embodiments, chemically modified nucleotides, such as modifications described herein, can be introduced throughout the sequence of a TDSC described herein; within an element of the sequence, such as an element described herein; at the 5'- or 3'-end; and / or between the last 10, 8, 6, 5, 4, 3, or 2 nucleotides of the 5'- or 3'-end.

[0467] In some embodiments, the TDSCs described herein comprise chemically modified nucleotides on only one strand (e.g., Figure 1A In some embodiments, the TDSC described herein comprises chemically modified nucleotides on the antisense strand. In some embodiments, the TDSC described herein comprises chemically modified nucleotides on the sense strand.

[0468] In some embodiments, the TDSCs described herein comprise chemically modified nucleotides on both strands (e.g., Figure 1A and 2In certain embodiments, the two chains comprise chemical modifications at the same position (e.g., chemically modified nucleotides on one chain are paired with chemically modified nucleotide bases on the opposite chain, and / or unchemically modified nucleotide bases on one chain are paired with unchemically modified nucleotide bases on the opposite chain). In embodiments, the two chains are composed entirely of chemically modified nucleotides. In other embodiments, the two chains of the TDSC as described herein comprise different chemical modification patterns (e.g., one or more chemically modified nucleotides on one chain are paired with unchemically modified nucleotide bases on the other chain). In embodiments, the TDSC as described herein comprises one or more double-stranded regions in which both chains are chemically modified, and / or one or more double-stranded regions in which both chains are not chemically modified. In embodiments, the TDSC as described herein comprises one or more double-stranded regions in which one chain is chemically modified and the other chain is not chemically modified.

[0469] In embodiments, the TDSC described herein comprises one or more DNA end forms (e.g., exonuclease-resistant DNA end forms, e.g., covalently blocked DNA end forms or non-covalently blocked DNA end forms, e.g., as described herein), each of which comprises one or more chemically modified nucleotides (e.g., on one or both strands of the DNA end form). In embodiments, the TDSC molecule comprises a double-stranded region flanked by non-covalently blocked exonuclease-resistant DNA end forms comprising chemically modified nucleotides, e.g., as described herein (e.g., Figure 2 ).

[0470] In embodiments, the TDSC described herein has one or more chemical modifications that destroy the ability of a portion of the TDSC to form a double-stranded structure, such as a TDSC described herein having one or more chemical modifications on nucleotides present in a region of intramolecular complementarity. In embodiments, the TDSC described herein has one or more chemical modifications that destroy base pairing in a region of intramolecular complementarity relative to the unmodified sequence of the TDSC. In some embodiments, the chemically modified nucleotides used herein have a reduced tendency to base pair with chemically modified nucleotides compared to the tendency of unmodified nucleotides to base pair with unmodified nucleotides. In some embodiments, the chemically modified nucleotides used herein have an increased tendency to base pair with unmodified nucleotides compared to modified nucleotides.

[0471] Other modifications are also contemplated. For example, the ends of the linear DNA described herein can be chemically modified, for example, to protect them from exonucleases. For example, one or more dideoxynucleotide residues can be added to the 3' end of the linear molecule and / or a self-complementary oligonucleotide can be attached to one or both ends. For example, see Chang et al. (1987) Proc. Nail. Acad. Sci. USA [Proceedings of the National Academy of Sciences of the United States] 84: 4959-4963; Nehls et al. (1996) Science [Science] 272: 886-889.

[0472] In some embodiments, compared to an unmodified TDSC of the same sequence, the chemically modified TDSC described herein exhibits reduced recognition by a DNA sensor in a host tissue or subject, for example, compared to an unmodified TDSC of the same sequence, recognition by a DNA sensor in a host tissue or subject is reduced by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more. In some embodiments, compared to an unmodified TDSC of the same sequence, the chemically modified TDSC described herein exhibits reduced degradation by DNA nucleases, for example, compared to an unmodified TDSC, degradation by DNA nucleases in a host tissue or subject is reduced by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more. In some embodiments, the chemically modified TDSCs described herein exhibit reduced activation of the innate immune system in a target / host tissue or subject compared to an unmodified TDSC of the same sequence, for example, at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more reduced activation of the innate immune system in a target / host tissue or subject compared to an unmodified TDSC of the same sequence.

[0473] In some embodiments, compared to a dsDNA of the same sequence that does not contain chemically modified nucleotides (unmodified dsDNA), a TDSC comprising chemically modified nucleotides as described herein exhibits any of the following properties in a target / host tissue or subject: increased integration of an exogenous construct in the target cell genome; increased retention in the target cell by replication; reduced formation of secondary or tertiary structures; reduced interaction with innate immune sensors; reduced interaction with nucleases; enhanced stability; extended lifespan; reduced toxicity; enhanced delivery; increased expression; increased transmembrane transport; increased binding to a DNA binding moiety (e.g., nuclear DNA binding protein, transcription factor, chaperone, DNA polymerase). In an embodiment, any of the above listed properties is regulated in a target / host tissue or subject by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more compared to an unmodified dsDNA of the same sequence.

[0474] Structure of DNA constructs

[0475] In some embodiments, the TDSCs disclosed herein or comprising dsDNA nucleic acids have a length of at least about 20 nucleotides, at least about 30 nucleotides, at least about 40 nucleotides, at least about 50 nucleotides, at least about 75 nucleotides, at least about 100 nucleotides, at least about 200 nucleotides, at least about 300 nucleotides, at least about 500 nucleotides, at least about 1000 nucleotides, at least about 2000 nucleotides, at least about 3000 nucleotides, at least about 4000 nucleotides, at least about 5000 nucleotides, at least about 6000 nucleotides, at least about 7000 nucleotides, at least about 8000 nucleotides, at least about 9000 nucleotides, at least about 10,000 nucleotides, at least about 20,000 nucleotides, at least about 30,000 nucleotides, at least about 40,000 nucleotides, or at least about 50,000 nucleotides. In some embodiments, the TDSCs disclosed herein or comprising dsDNA nucleic acids are between 20-30, 30-40, 40-50, 50-75, 75-100, 100-200, 200-300, 300-500, 500-1000, 1000-2000, 2000-3000, 3000-4000, 4000-5000, 5000-6000, 6000-7000, 7000-8000, 8000-9000, 9000-10,000, 10,000-20,000, 20,000-30,000, 30,000-40,000, or 40,000-50,000 nucleotides in length. In some embodiments, the size of the TDSC disclosed herein is of sufficient length to encode a useful polypeptide or RNA.

[0476] In some embodiments, the TDSC or nucleic acid comprising dsDNA comprises an exonuclease-resistant DNA end form (e.g., as described herein). In some embodiments, the length of the DNA end form is at least 2, 3, 4, 5, 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides. In some embodiments, the length of the DNA end form is less than 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides. In some embodiments, the length of the DNA end form is 2-5, 5-10, 10-15, 15-20, 20-25, 25-30, 30-35, 35-40, 40-45, 45-50, 50-55, 55-60, 60-70, 70-80, 80-90, or 90-100 nucleotides.

[0477] In some embodiments, the TDSC or nucleic acid comprising dsDNA comprises a double-stranded region encoding an effector (e.g., a polypeptide or RNA, e.g., as described herein), e.g., between two exonuclease-resistant DNA end forms. In some embodiments, the double-stranded region is at least 10, 15, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10,000, 20,000, 30,000, 40,000, or 50,000 nucleotides in length. In some embodiments, the double stranded region form is less than 50, 60, 70, 80, 90, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10,000, 20,000, 30,000, 40,000, or 50,000 nucleotides in length. In some embodiments, the length of the double-stranded region is 10-15, 15-20, 20-25, 25-30, 30-35, 35-40, 40-45, 45-50, 50-55, 55-60, 60-70, 70-80, 80-90, 90-100, 100-200, 200-300, 300-400, 400-500, 500-600, 600-700, 700-800, 800-90 or 40,000 to 50,000 nucleotides.

[0478] The TDSC described herein may have a single-stranded structure below a threshold level. In one embodiment, the TDSC does not include more than 20, 18, 16, 14, 12, 10, 8, 7, 5, 4, 3, 2 or 1 single-stranded regions longer than 100, 80, 70, 60, 50, 40, 30, 20 or 10 bases, such as single-stranded regions longer than 100, 80, 70, 60, 50, 40, 30, 20 or 10 bases. In one embodiment, the double-stranded region formed by the TDSC described herein is determined as described below: Xayaphoummine et al. 2005. Kinefold web server for RNA / DNA folding path and structure prediction including pseudoknots and knots. [Kinefold web server for RNA / DNA folding path and structure prediction, including pseudoknots and knots] Nucleic Acids Research [nucleic acid research], Vol. 33: W605-610. In one embodiment, the Kinefold website (http: / / kinefold.curie.fr / cgi-bin / form.pl) is used to predict the double-stranded regions of the constructs described herein using the following parameters:

[0479] Sequence to be folded: Enter and select "DNA sequence"

[0480] Stochastic simulation: co-transcriptional folding, 3 ms

[0481] Simulate molecular time: default

[0482] False knot: Not allowed

[0483] Entanglement: No crossover

[0484] Random seed: 11453

[0485] Production

[0486] In some embodiments, the TDSC described herein or the nucleic acid comprising dsDNA is produced by assembling a plasmid containing the desired elements described herein. For example, a plasmid template can be assembled using Golden Gate cloning to assemble multiple DNA fragments in a defined linear order in an acceptor vector using a one-pot assembly procedure. Marillonnet & Grützner, 2020, Synthetic DNA assembly using golden gate cloning and the hierarchical modular cloning pipeline [assembly of synthetic DNA using Golden Gate cloning and hierarchical modular cloning pipeline], Current Protocols in Molecular Biology [current molecular biology program], 130: Golden Gate cloning is described in e115. In some embodiments, for example, by digestion with a nuclease (e.g., restriction endonuclease) or by PCR amplification of a linear nucleic acid sequence from a plasmid template to linearize the plasmid template (e.g., as described in Example 2). In certain embodiments, the linearization of the plasmid template produces the original TDSC as described herein (e.g., a linear nucleic acid comprising a dsDNA that does not comprise a nuclease-resistant DNA end form at one or both ends).

[0487] In some embodiments, a TDSC or proto-TDSC sequence comprising a chemical modification on one strand is generated by amplifying one strand (e.g., from a plasmid template) using a dNTP mixture comprising one or more chemically modified nucleotides and primers capable of amplifying one strand of the TDSC or proto-TDSC sequence (e.g., as described in Example 3). In certain embodiments, the opposite strand (e.g., an unmodified strand or a differently chemically modified strand, e.g., as described herein, e.g., Figure 1A-2 ) are generated in separate amplification reactions, for example using a dNTP mixture comprising unmodified nucleotides or different sets of chemically modified nucleotides, and primers capable of amplifying opposite strands of the TDSC or original TDSC sequence (for example, as described in Example 3).

[0488] In some embodiments, a TDSC or proto-TDSC comprising the same chemical modification on both strands is produced by amplifying the TDSC or proto-TDSC strands (e.g., from a plasmid template) using a dNTP mixture comprising one or more chemically modified nucleotides and primers capable of amplifying both strands of the TDSC or proto-TDSC sequence (e.g., as described in Example 4).

[0489] In some embodiments, an exonuclease-resistant DNA end form (e.g., as described herein) is introduced (e.g., connected) to one end or both ends of the original TDSC. In certain embodiments, the DNA end form is attached to the end of the original TDSC by connection (e.g., as described in Example 5 or 6). In an embodiment, the attachment (e.g., connection) of the DNA end form (e.g., covalently blocked DNA end form) to the original TDSC produces a final TDSC. In certain embodiments, the exonuclease resistance of the attached DNA end form is confirmed, for example, by incubating the TDSC in the presence of an exonuclease (e.g., exonuclease III, USER enzyme and / or mung bean nuclease), for example, as described in Examples 10 and 11. In an embodiment, the exonuclease resistance of the attached DNA end form is confirmed, for example, by incubating the TDSC in the presence of an exonuclease III. In an embodiment, the DNA end form comprises a blunt end, a sticky end, or a Y-adapter (e.g., as described herein), and the exonuclease resistance of the attached DNA end form is confirmed by incubating the TDSCs in the presence of exonuclease III and (e.g., subsequently, prior to, or simultaneously with) mung bean nuclease and / or USER enzyme.

[0490] In certain embodiments, the DNA end form is attached to the end of the original TDSC in a nascent form (e.g., the non-covalently blocked DNA end form can be attached to the original TDSC as a hairpin, for example, as described in Examples 5 and Figure 3-4 In a subsequent step, the nascent form of the DNA end form can be further modified (e.g., cleaved) to produce the final DNA end form. For example, a non-covalently blocked DNA end form can be produced by, for example, cleaving the nascent form by a nuclease. In an embodiment, the nascent form comprises one or more uracil nucleotides. In an embodiment, the nascent form is cleaved at one or more uracil nucleotides using a USER enzyme. In some embodiments, the nascent form comprises an overhang or a sticky end (e.g., Figure 3-4 In some embodiments, a nascent form comprising a hairpin containing a cleavable moiety (e.g., a uracil nucleotide) in its single-stranded loop region is converted to a Y-adapter by cleavage of the cleavable moiety (e.g., by a USER enzyme), e.g., as described in Example 7.

[0491] TDSCs can be enriched or purified from impurities or byproducts selected from the group consisting of endotoxins, mononucleotides, chemically modified mononucleotides, single-stranded DNA, circular DNA, proteins (e.g., enzymes, such as ligases, restriction enzymes), DNA fragments or truncations. In some embodiments, the purified TDSCs are substantially free of process byproducts and impurities, such as process byproducts or impurities described herein.

[0492] In some embodiments, TDSCs are formulated with lipid-based carriers such as lipid nanoparticles (LNPs), e.g., as described in Example 8.

[0493] The TDSCs may be sequenced to confirm the desired designed sequence.In embodiments, additional structural analysis (eg, restriction enzyme analysis) of the TDSCs may be performed to confirm or verify their sequence.

[0494] Pharmaceutical composition

[0495] The present disclosure includes TDSCs or nucleic acids comprising dsDNA and related compositions in combination with one or more pharmaceutically acceptable excipients and / or carriers.

[0496] The pharmaceutical composition may optionally comprise one or more additional active substances, for example therapeutically and / or prophylactically active substances.The pharmaceutical compositions of the invention are generally sterile and / or pyrogen-free.

[0497] The TDSCs described herein may be formulated in the absence of a carrier, for example, the TDSCs described herein may be administered "naked" to a host cell, tissue, or subject. A naked formulation may comprise a pharmaceutical excipient or diluent but lack a carrier.

[0498] Pharmaceutically acceptable excipients or diluents may include inactive substances used as vehicles or media for compositions described herein, such as any of the inactive ingredients approved by the U.S. Food and Drug Administration (FDA) and listed in the inactive ingredient data, which are incorporated herein by reference. Non-limiting examples of pharmaceutically acceptable excipients or diluents include solvents, aqueous solvents, non-aqueous solvents, tonicity agents, dispersion media, cryoprotectants, diluents, suspension aids, surfactants, isotonic agents, thickeners, emulsifiers, preservatives, hyaluronidase, dispersants, preservatives, lubricants, granulating agents, disintegrants, binders, antioxidants, buffers (e.g., phosphate buffered saline (PBS)), lubricating agents, oils, and mixtures thereof.

[0499] General considerations in the formulation and / or manufacture of medicaments may be found in, for example, Remington: The Science and Practice of Pharmacy, 21st ed., Lippincott Williams & Wilkins, 2005 (incorporated herein by reference).

[0500] Carrier

[0501] The TDSCs or nucleic acids comprising dsDNA described herein may also be formulated with or contained within a carrier. General considerations for carrier and agent delivery may be found, for example, in the following: Delivery Technologies for Biopharmaceuticals:Peptides,Proteins,NucleicAcids and Vaccines [Delivery Technologies for Biopharmaceuticals: Peptides, Proteins, Nucleic Acids, and Vaccines] (Lene Jorgensen and Hanne Morck Nielson, eds.) Wiley; 1st edition (December 21, 2009); and Vargason et al. 2021. Nat Biomed Eng 5, 951–967.

[0502] Non-limiting examples of carriers include carbohydrate carriers (e.g., anhydride-modified phytoglycogen or glycogen-based materials, GalNAc), nanoparticles (e.g., nanoparticles encapsulating or covalently linked to TDSC, gold nanoparticles, silica nanoparticles), lipid particles (e.g., liposomes, lipid nanoparticles), cationic carriers (e.g., cationic lipid polymers or transfection agents), fusosomes, anucleated cells (e.g., reticulocytes differentiated in vitro), nucleated cells, exosomes, protein carriers (e.g., proteins covalently linked to TDSC), peptides (e.g., cell penetrating peptides), materials (e.g., graphene oxide), single pure lipids (e.g., cholesterol), DNA origami (e.g., DNA tetrahedron).

[0503] In one embodiment, the TDSC compositions, constructs and systems described herein can be formulated in liposomes or other similar vesicles. Liposomes are spherical vesicle structures that are composed of a monolayer or multilayer lipid bilayer surrounding an internal aqueous compartment and a relatively impermeable external lipophilic phospholipid bilayer. Liposomes can be anionic, neutral or cationic. Liposomes are biocompatible, nontoxic, can deliver hydrophilic and lipophilic drug molecules, protect their cargo from degradation by plasma enzymes, and transport their loads across biomembranes and blood-brain barriers (BBB) ​​(for review, see, e.g., Spuch and Navarro, Journal of Drug Delivery [Drug Delivery Magazine], Vol. 2011, Article ID 469679, p. 12, 2011. doi: 10.1155 / 2011 / 469679).

[0504] Vesicles can be made of several different types of lipids; however, phospholipids are most commonly used to generate liposomes as drug carriers. Methods for preparing multilamellar vesicle lipids are known in the art (see, e.g., U.S. Patent No. 6,693,086, which is incorporated herein by reference for its teachings on the preparation of multilamellar vesicle lipids). Although vesicle formation can be spontaneous when the lipid film is mixed with an aqueous solution, vesicle formation can also be accelerated by applying force in the form of oscillation using a homogenizer, sonicator or extrusion equipment (for review, see, e.g., Spuch and Navarro, Journal of Drug Delivery [Drug Delivery Magazine], Vol. 2011, Article ID 469679, p. 12, 2011.doi:10.1155 / 2011 / 469679). Extruded lipids can be prepared by extrusion through a filter of decreasing size as described in Templeton et al., Nature Biotech, 15:647-652, 1997, which is incorporated herein by reference for its teachings on the preparation of extruded lipids.

[0505] Exosomes can also be used as drug delivery vehicles for the compositions and systems described herein. For a review, see Ha et al., July 2016. Acta Pharmaceutica Sinica B, Vol. 6, No. 4, pp. 287-296; https: / / doi.org / 10.1016 / j.apsb.2016.02.001.

[0506] Ex vivo differentiated erythrocytes can also be used as carriers for the agents described herein (eg, TDSCs). See, e.g., WO 2015073587; WO 2017123646; WO 2017123644; WO 2018102740; WO 2016183482; WO2015153102; WO 2018151829; WO 2018009838; Shi et al. 2014. Proc Natl Acad Sci USA. 111(28):10131–10136; U.S. Patent 9,644,180; Huang et al. 2017. Nature Communications 8:423; Shi et al. 2014. Proc Natl Acad Sci USA. 111(28):10131–10136.

[0507] Fusion compositions, such as those described in WO 2018208728, can also be used as carriers to deliver the TDSCs described herein.

[0508] Lipid Nanoparticles:

[0509] Lipid nanoparticles (LNPs) are carriers made of ionizable lipids. LNPs are taken up by cells through endocytosis, and their properties allow endosome escape, thereby allowing cargo to be released into the cytoplasm of target cells. In addition to ionizable lipids, LNPs may also contain auxiliary lipids that promote cell binding, cholesterol that fills the gaps between lipids, and / or polyethylene glycol (PEG) that reduces serum protein opsonization and reticuloendothelial clearance. In certain embodiments, lipid nanoparticles include one or more ionic lipids, such as non-cationic lipids (e.g., neutral or anionic or zwitterionic lipids); one or more conjugated lipids (PEG conjugated lipids or lipids conjugated to polymers as described in Table 5 of WO 2019217941; it is incorporated herein by reference in its entirety); one or more sterols (e.g., cholesterol); and, optionally, one or more targeting molecules (e.g., conjugated receptors, receptor ligands, antibodies); or a combination of the foregoing.

[0510] Lipids that can be used to form nanoparticles (e.g., lipid nanoparticles) include, for example, those described in Table 4 of WO 2019217941, which is incorporated herein by reference - for example, the lipid-containing nanoparticles may comprise one or more lipids in Table 4 of WO 2019217941. The lipid nanoparticles may include additional elements, such as polymers, such as those described in Table 5 of WO 2019217941, which is incorporated by reference.

[0511] In some embodiments, the conjugated lipid, when present, may include one or more of: PEG-diacylglycerol (DAG) (such as 1-(monomethoxy-polyethylene glycol)-2,3-dimyristoylglycerol (PEG-DMG)), PEG-dialkoxypropyl (DAA), PEG-phospholipids, PEG-ceramide (Cer), pegylated phosphatidylethanolamine (PEG-PE), PEG succinic diacylglycerol (PEGS-DAG) (such as 4-0-(2',3'-di(tetradecanoyloxy)propyl-1-0-(w-methoxy(polyethoxy)ethyl)succinate (PEG-S-DMG)), PEG dialkoxypropyl carbamate, N-(carbonyl-methoxypolyethylene glycol 2000)-1,2-distearoyl-sn-glycero-3-phosphoethanolamine sodium salt, and those described in Table 2 of WO 2019051289 (incorporated by reference), and combinations of the foregoing.

[0512] In some embodiments, the sterol that can be incorporated into the lipid nanoparticle includes one or more of cholesterol or cholesterol derivatives, such as those in WO 2009 / 127060 or US2010 / 0130588 incorporated by reference. Additional exemplary sterols include plant sterols, including those described in Eygeris et al. (2020), dx.doi.org / 10.1021 / acs.nanolett.0c01386, incorporated herein by reference.

[0513] In some embodiments, lipid particles include ionizable lipids, non-cationic lipids, conjugated lipids and sterols that inhibit particle aggregation. The amounts of these components can be changed independently to obtain desired properties. For example, in some embodiments, lipid nanoparticles include: ionizable lipids, an amount of about 20mol% to about 90mol% of total lipids (in other embodiments, it can be 20-70% (mol), 30-60% (mol) or 40-50% (mol) of total lipids present in lipid nanoparticles; about 50mol% to about 90mol%); non-cationic lipids, an amount of about 5mol% to about 30mol% of total lipids; conjugated lipids, an amount of about 0.5mol% to about 20mol% of total lipids, and sterols, an amount of about 20mol% to about 50mol% of total lipids. The ratio of total lipids to nucleic acids can be varied as desired. For example, the ratio of total lipids to nucleic acids (mass or weight) can be about 10: 1 to about 30: 1.

[0514] In some embodiments, the ratio of lipid to nucleic acid (mass / mass ratio; w / w ratio) can be in the range of about 1:1 to about 25:1, about 10:1 to about 14:1, about 3:1 to about 15:1, about 4:1 to about 10:1, about 5:1 to about 9:1, or about 6:1 to about 9:1. The amounts of lipid and nucleic acid can be adjusted to provide a desired N / P ratio, such as 3, 4, 5, 6, 7, 8, 9, 10 or higher N / P ratios. Typically, the total lipid content of the lipid nanoparticle formulation can be in the range of about 5 mg / ml to about 30 mg / mL.

[0515] Some non-limiting examples of lipid compounds that can be used (e.g., in combination with other lipid components) to form lipid nanoparticles for delivering the compositions described herein, e.g., the nucleic acids described herein, include:

[0516]

[0517] In some embodiments, LNPs comprising formula (i) are used to deliver the DNA compositions described herein to the liver and / or hepatocytes.

[0518]

[0519] In some embodiments, LNPs comprising formula (ii) are used to deliver a DNA composition described herein to the liver and / or hepatocytes.

[0520]

[0521] In some embodiments, LNPs comprising formula (iii) are used to deliver the DNA compositions described herein to the liver and / or hepatocytes.

[0522]

[0523] In some embodiments, LNPs comprising formula (v) are used to deliver a DNA composition described herein to the liver and / or hepatocytes.

[0524]

[0525] In some embodiments, LNPs comprising formula (vi) are used to deliver a DNA composition described herein to the liver and / or hepatocytes.

[0526]

[0527]

[0528] In some embodiments, LNPs comprising formula vii or (viii) are used to deliver a DNA composition described herein to the liver and / or hepatocytes.

[0529]

[0530] In some embodiments, LNPs comprising formula (ix) are used to deliver the DNA compositions described herein to the liver and / or hepatocytes.

[0531] In some embodiments, LNPs comprising formula (x) are used to deliver the DNA compositions described herein to the liver and / or hepatocytes:

[0532]

[0533] in

[0534] X 1 Yes O, NR 1 Or direct key, X 2 is C2-5 alkylene, X 3 is C(=O) or a direct bond, R 1 is H or Me, R 3 is a Ci-3 alkyl group, R 2 is a C1-3 alkyl group, or R 2 The nitrogen atom to which it is attached and X 2 1-3 carbon atoms of X together form a 4-membered, 5-membered or 6-membered ring, or X 1 YesNR 1 , R 1 and R 2 Together with the nitrogen atom to which they are attached, they form a 5- or 6-membered ring, or R 2 With R 3 Together with the nitrogen atom to which they are attached, they form a 5-, 6- or 7-membered ring, Y 1 is C2-12 alkylene, Y 2 Selected from

[0535]

[0536] n is 0 to 3, R 4 is Ci-15 alkyl, Z 1 is a Ci-6 alkylene group or a direct bond,

[0537] Z 2 yes

[0538] (in either orientation) or not present, provided that if Z 1 is a direct key, then Z 2 does not exist;

[0539] R 5 is C5-9 alkyl or C6-10 alkoxy, R 6 is C5-9 alkyl or C6-10 alkoxy, W is methylene or a direct bond, and R7 is H or Me, or a salt thereof, provided that if R 3 and R 2 is a C2 alkyl group, X 1 It's O, X 2 is a straight chain C3 alkylene group, X 3 is C(=0), Y 1 is a straight chain Ce alkylene group, (Y 2 )nR 4 yes

[0540]

[0541] , R 4 is a straight chain C5 alkyl group, Z 1 is C2 alkylene, Z 2 does not exist, W is a methylene group, and R 7 is H, then R 5 and R 6 Not C x Alkoxy.

[0542]

[0543] In some embodiments, LNPs comprising formula (xi) are used to deliver the DNA compositions described herein to the liver and / or hepatocytes.

[0544] In some embodiments, LNPs comprising formula (xii) are used to deliver the DNA compositions described herein to the liver and / or hepatocytes.

[0545]

[0546]

[0547] In some embodiments, the LNP comprises a compound of formula (xiii) and a compound of formula (xiv).

[0548]

[0549] In some embodiments, LNPs comprising formula (xv) are used to deliver the DNA compositions described herein to the liver and / or hepatocytes.

[0550]

[0551] In some embodiments, LNPs comprising the formulation of formula (xvi) are used to deliver the DNA compositions described herein to lung endothelial cells.

[0552] In some embodiments, LNPs comprising a formulation of formula (xvii), (xviii), or (xix) are used to deliver a DNA composition described herein to lung endothelial cells.

[0553]

[0554]

[0555] In some embodiments, lipid compounds used to form lipid nanoparticles for delivery of compositions described herein (e.g., nucleic acids described herein) are prepared by one of the following reactions:

[0556]

[0557] In some embodiments, the compositions described herein (e.g., nucleic acids or proteins) are provided in LNPs comprising ionizable lipids. In some embodiments, the ionizable lipid is heptadecan-9-yl 8-((2-hydroxyethyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (SM-102); For example, as described in Example 1 of US 9,867,888 (incorporated herein in its entirety by reference). In some embodiments, the ionizable lipid is 9Z, 12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadecane-9,12-dienoate (LP01), for example, as synthesized in Example 13 of WO 2015 / 095340 (incorporated herein in its entirety by reference). In some embodiments, the ionizable lipid is di((Z)-non-2-en-1-yl) 9-((4-dimethylamino)butanoyl)oxy)heptadecanedioate (L319), for example, as synthesized in Example 7, Example 8, or Example 9 of US 2012 / 0027803, which is incorporated herein by reference in its entirety. In some embodiments, the ionizable lipid is 1,1'-((2-(4-(2-((2-(bis(2-hydroxydodecyl)amino)ethyl)(2-hydroxydodecyl)amino)ethyl)piperazin-1-yl)ethyl)azanediyl)bis(dodecan-2-ol) (C12-200), for example, as synthesized in Examples 14 and 16 of WO 2010 / 053572, which is incorporated herein by reference in its entirety. In some embodiments, the ionizable lipid is an imidazolyl cholesteryl ester (ICE) lipid (3S, 10R, 13R, 17R)-10,13-dimethyl-17-((R)-6-methylhept-2-yl)-2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthrene-3-yl 3-(1H-imidazol-4-yl)propanoate, such as structure (I) from WO 2020 / 106946 (incorporated herein by reference in its entirety).

[0558] In some embodiments, the ionizable lipid can be a cationic lipid, an ionizable cationic lipid, such as a cationic lipid that can exist in a positively charged form or a neutral form according to pH, or an amine-containing lipid that can be easily protonated. In some embodiments, the cationic lipid is, for example, a lipid that can be positively charged under physiological conditions. Exemplary cationic lipids include one or more positively charged amine groups. In some embodiments, the lipid particle includes a cationic lipid prepared with one or more of a neutral lipid, an ionizable amine-containing lipid, a biodegradable acetylenic lipid, a steroid, a phospholipid including a polyunsaturated lipid, a structural lipid (e.g., a sterol), PEG, cholesterol, and a polymer-conjugated lipid. In some embodiments, the cationic lipid can be an ionizable cationic lipid. Exemplary cationic lipids as disclosed herein can have an effective pKa exceeding 6.0. In an embodiment, the lipid nanoparticle can include a second cationic lipid having an effective pKa different from the first cationic lipid (e.g., greater than the first effective pKa). Lipid nanoparticles can include 40 mol % to 60 mol % of cationic lipids, neutral lipids, steroids, polymer-conjugated lipids and therapeutic agents (e.g., nucleic acids as described herein) encapsulated in lipid nanoparticles or associated with lipid nanoparticles. In certain embodiments, nucleic acids and cationic lipids are co-formulated. Nucleic acids can be adsorbed onto the surface of LNPs (e.g., LNPs comprising cationic lipids). In certain embodiments, nucleic acids can be encapsulated in LNPs (e.g., LNPs comprising cationic lipids). In certain embodiments, lipid nanoparticles can include targeting moieties, e.g., targeting moieties coated with targeting agents. In certain embodiments, LNP formulations are biodegradable. In some embodiments, lipid nanoparticles comprising one or more lipids described herein (e.g., formula (i), (ii), (vii), and / or (ix)) encapsulate at least 1%, at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 92%, at least 95%, at least 97%, at least 98%, or 100% of molecular TDSC.

[0559] Exemplary ionizable lipids that can be used in lipid nanoparticle formulations include, but are not limited to, those listed in Table 1 of WO 2019051289, which is incorporated herein by reference. Additional exemplary lipids include, but are not limited to, one or more of the following formulae: X of US2016 / 0311759; I of US20150376115 or US2016 / 0376224; I, II, or III of US20160151284; I, IA, II, or IIA of US20170210967; Ic of US20150140070; A of US2013 / 0178541; I of US2013 / 0303587 or US2013 / 0123338; ​​I of US 2015 / 0141678; II, III, IV, or V of US2015 / 0239926; I of US2017 / 0119904; I or II of US2017 / 117528; A of US2012 / 0149894; A of US2015 / 0057373; A of WO 2013 / 116126; A of US2013 / 0090372; A of US2013 / 0274523; A of US2013 / 0274504; A of US 2013 / 0053572; A of WO 2013 / 016058; WO A of US2012 / 162210; I of US2008 / 042973; I, II, III or IV of US2012 / 01287670; I or II of US2014 / 0200257; I, II or III of US2015 / 0203446; I or III of US2015 / 0005363; I, IA, IB, IC, ID, II, IIA, IIB, IIC, IID or III-XXIV of US2014 / 0308304; of US2013 / 0338210; W0 I, II, III or IV of US2009 / 132131; A of US2012 / 01011478; I or XXXV of US2012 / 0027796; XIV or XVII of US2012 / 0058144; of US2013 / 0323269; I of US2011 / 0117125; I, II or III of US2011 / 0256175; US2012 / 0202871 I, II, III, IV, V, VI, VII, VIII, IX, X, XI, XII of US2011 / 0076335; I or II of US2006 / 008378; I of US2013 / 0123338; ​​I or XAYZ of US2015 / 0064242;XVI, XVII or XVIII of US2013 / 0022649; I, II or III of US2013 / 0116307; I, II or III of US2013 / 0116307; I or II of US2010 / 0062967; IX of US2013 / 0189351; I of US2014 / 0039032; V of US2018 / 0028664; I of US2016 / 0317458; I of US2013 / 0195920; 5, 6 or 10 of US10,221,127; III-3 of WO 2018 / 081480; I-5 or I-8 of WO 2020 / 081938; US 9,867,888 18 or 25; US2019 / 0136231 A; WO 2020 / 219876 II; US 2012 / 0027803 1; US2019 / 0240349 OF-02; US10,086,013 23; Miao et al. (2020) cKK-E12 / A6; WO 2010 / 053572 C12-200; Dahlman et al. (2017) 7C1; Whitehead et al. 304-O13 or 503-O13; US 9,708,628 TS-P4C2; WO 2020 / 106946 I; WO2020 / 106946 I. ;

[0560] In some embodiments, the ionizable lipid is MC3 (6Z, 9Z, 28Z, 31Z) - heptathriacontane-6, 9, 28, 31-tetraen-19-yl-4- (dimethylamino) butyrate (DLin-MC3-DMA or MC3), for example, as described in Example 9 of WO 2019051289A9 (incorporated herein by reference in its entirety). In some embodiments, the ionizable lipid is lipid ATX-002, for example, as described in Example 10 of WO 2019051289A9 (incorporated herein by reference in its entirety). In some embodiments, the ionizable lipid is (13Z, 16Z) -A, A- dimethyl-3-nonyl docos-13, 16-dien-1-amine (compound 32), for example, as described in Example 11 of WO 2019051289A9 (incorporated herein by reference in its entirety). In some embodiments, the ionizable lipid is Compound 6 or Compound 22, for example, as described in Example 12 of WO 2019051289A9 (incorporated herein by reference in its entirety).

[0561] Exemplary non-cationic lipids include, but are not limited to, distearoyl-sn-glycero-phosphoethanolamine, distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylcholine (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoylphosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoylphosphatidylethanolamine (POPE), dioleoyl-phosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), distearoyl-phosphatidyl-ethanolamine (DSPE), monomethyl-phosphatidylethanolamine (such as 16-O-monomethyl PE), dimethyl-phosphatidylethanolamine (such as 16- O-dimethyl PE), l8-l-trans PE, l-stearoyl-2-oleoyl-phosphatidylethanolamine (SOPE), hydrogenated soybean phosphatidylcholine (HSPC), egg phosphatidylcholine (EPC), dioleoylphosphatidylserine (DOPS), sphingomyelin (SM), dimyristoylphosphatidylcholine (DMPC), dimyristoylphosphatidylglycerol (DMPG), distearoylphosphatidylglycerol (DSPG), dierucylphosphatidylcholine (DEPC), palmitoyloleoylphosphatidylglycerol (POPG), di-re-oleoyl-phosphatidylethanolamine (DEPE), lecithin, phosphatidylethanolamine, lysophosphatidylcholine, lysophosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, sphingomyelin, egg sphingomyelin (ESM), cephalin, cardiolipin, phosphatidic acid, cerebroside, dihexadecyl phosphate, lysophosphatidylcholine, dilinoleoylphosphatidylcholine or a mixture thereof. It should be understood that other diacylphosphatidylcholine and diacylphosphatidylethanolamine phospholipids may also be used. The acyl groups in these lipids are preferably acyl groups derived from fatty acids with C10-C24 carbon chains, such as lauroyl, myristoyl, palmitoyl, stearoyl or oleoyl. In certain embodiments, other exemplary lipids include but are not limited to those described in Kim et al. (2020) dx.doi.org / 10.1021 / acs.nanolett.0c01386 incorporated herein by reference. In certain embodiments, such lipids include plant lipids (e.g., DGTS) found to improve liver transfection with mRNA.

[0562] Other examples of non-cationic lipids suitable for use in lipid nanoparticles include, but are not limited to, non-phospholipids, such as stearylamine, dodecylamine, hexadecylamine, acetyl palmitate, ricinoleic acid glyceride, hexadecyl stearate, isopropyl myristate, amphoteric acrylic acid polymers, triethanolamine-lauryl sulfate, alkyl-aryl sulfate, polyethoxylated fatty acid amides, dioctadecyl dimethyl ammonium bromide, ceramide, sphingomyelin, etc. Other non-cationic lipids are described in WO2017 / 099823 or U.S. Patent Publication US2018 / 0028664, the contents of which are incorporated herein by reference in their entirety.

[0563] In some embodiments, the non-cationic lipid is oleic acid or a compound of formula I, II or IV of US 2018 / 0028664, which is incorporated by reference in its entirety. The non-cationic lipid can account for, for example, 0-30% (mol) of the total lipid present in the lipid nanoparticle. In some embodiments, the non-cationic lipid content is 5%-20% (mol) or 10%-15% (mol) of the total lipid present in the lipid nanoparticle. In an embodiment, the molar ratio of ionizable lipid to neutral lipid is about 2: 1 to about 8: 1 (e.g., about 2: 1, 3: 1, 4: 1, 5: 1, 6: 1, 7: 1 or 8: 1).

[0564] In some embodiments, the lipid nanoparticles do not comprise any phospholipids.

[0565] In some aspects, the lipid nanoparticles may further include components such as sterols to provide membrane integrity. An exemplary sterol that can be used in lipid nanoparticles is cholesterol and its derivatives. Non-limiting examples of cholesterol derivatives include polar analogs such as 5a-cholestanol, 53-coprostanol, cholesteryl-(2'-hydroxy)-ethyl ether, cholesteryl-(4'-hydroxy)-butyl ether and 6-ketocholestanol; non-polar analogs such as 5a-cholestanes, cholesterenone, 5a-cholestanone, 5p-cholestanone and cholesterol decanoate; and mixtures thereof. In certain embodiments, cholesterol derivatives are polar analogs, for example, cholesteryl-(4'-hydroxy)-butyl ether. Exemplary cholesterol derivatives are described in PCT Publication WO 2009 / 127060 and U.S. Patent Publication US2010 / 0130588, each of which is incorporated herein by reference in its entirety.

[0566] In some embodiments, components that provide membrane integrity, such as sterols, may account for 0-50% (mol) of the total lipid present in the lipid nanoparticle (e.g., 0-10%, 10%-20%, 20%-30%, 30%-40% or 40%-50%). In some embodiments, such components are 20%-50% (mol), 30%-40% (mol) of the total lipid content of the lipid nanoparticle.

[0567] In certain embodiments, lipid nanoparticles may include polyethylene glycol (PEG) or conjugated lipid molecules. Typically, these are used to suppress the aggregation of lipid nanoparticles and / or provide spatial stabilization. Exemplary conjugated lipids include but are not limited to PEG-lipid conjugates, polyoxazoline (POZ)-lipid conjugates, polyamide-lipid conjugates (such as ATTA-lipid conjugates), cationic polymer lipid (CPL) conjugates and mixtures thereof. In certain embodiments, the conjugated lipid molecule is a PEG-lipid conjugate, for example (methoxypolyethylene glycol) conjugated lipid.

[0568] Exemplary PEG-lipid conjugates include, but are not limited to, PEG-diacylglycerol (DAG) (such as 1-(monomethoxy-polyethylene glycol)-2,3-dimyristoylglycerol (PEG-DMG)), PEG-dialkoxypropyl (DAA), PEG-phospholipids, PEG-ceramide (Cer), PEGylated phosphatidylethanolamine (PEG-PE), PEG succinate diacylglycerol (PEGS-DAG) (such as 4-0-(2',3'-di(tetradecanoyloxy)propyl-1-0-(w-methoxy(polyethoxy)ethyl)succinate (PEG-S-DMG)), PEG dialkoxypropyl carbamate, N-(carbonyl-methoxypolyethylene glycol 2000)-1,2-distearoyl-sn-glycero-3-phosphoethanolamine sodium salt, or mixtures thereof. Additional exemplary PEG-lipid conjugates are described, for example, in US Pat. Nos. 5,885,613, 5,614, 5,621, 5,634, 5,643, 5,654, 5,665, 5,673, 5,683, 5,693, 5,694, 5,695, 5,696, 5,697, 5,698, 5,699, 5,699, 5,691, 5,699, 5,693, 5,694, 5,697, 5,698, 5,69 ... 6,287,59l、US2003 / 0077829、US2003 / 0077829、US2005 / 0175682、US2008 / 0020058、US2011 / 0117125、US2010 / 0130588、US 2016 / 0376224, US2017 / 0119904 and US / 099823, all of which are incorporated herein by reference in their entirety. In some embodiments, the PEG-lipid is a compound of formula III, III-aI, III-a-2, III-b-1, III-b-2 or V of US2018 / 0028664, the contents of which are incorporated herein by reference in their entirety. In some embodiments, the PEG-lipid has formula II of US20150376115 or US2016 / 0376224, the contents of both of which are incorporated herein by reference in their entirety. In some embodiments, the PEG-DAA conjugate can be, for example, PEG-dilauryloxypropyl, PEG-dimyristyloxypropyl, PEG-dipalmityloxypropyl Or PEG-distearyloxypropyl. PEG-lipid can be one or more of the following: PEG-DMG, PEG-dilaurylglycerol, PEG-dipalmitoylglycerol, PEG-distearylglycerol, PEG-dilaurylglycerol lipamide, PEG-dimyristylglycerol lipamide, PEG-dipalmitoylglycerol lipamide, PEG-distearylglycerol lipamide, PEG-cholesterol (l-[8'-(cholest-5-ene-3[β]-oxy)formamido-3',6'-dioxaoctyl]carbamoyl-[ω]-methyl-poly(ethylene glycol)), PEG-DMB (3,4-ditetradecyloxybenzyl-[ω]-methyl-poly(ethylene glycol) ether) and 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000].In some embodiments, the PEG-lipid comprises PEG-DMG, 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000]. In some embodiments, the PEG-lipid comprises a structure selected from the group consisting of:.

[0569]

[0570] In some embodiments, lipids conjugated to molecules other than PEG can also be used to replace PEG-lipids. For example, polyoxazoline (POZ)-lipid conjugates, polyamide-lipid conjugates (such as ATTA-lipid conjugates) and cationic polymer lipid (GPL) conjugates can be used to replace PEG-lipids or used together with PEG-lipids.

[0571] Exemplary conjugated lipids, i.e., PEG-lipids, (POZ)-lipid conjugates, ATTA-lipid conjugates, and cationic polymer-lipids are described in the PCT and LIS patent applications listed in Table 2 of WO 2019051289A9, the contents of all of which are incorporated herein by reference in their entirety.

[0572] In some embodiments, PEG or conjugated lipids can account for 0-20% (mol) of the total lipids present in the lipid nanoparticles. In some embodiments, the content of PEG or conjugated lipids is 0.5%-10% or 2%-5% (mol) of the total lipids present in the lipid nanoparticles. The molar ratio of ionizable lipids, non-cationic lipids, sterols and PEG / conjugated lipids can be changed as needed. For example, lipid particles can include 30%-70% ionizable lipids by mole or total weight of the composition, 0-60% cholesterol by mole or total weight of the composition, 0-30% non-cationic lipids by mole or total weight of the composition and 1%-10% conjugated lipids by mole or total weight of the composition. Preferably, the composition includes 30%-40% ionizable lipids by mole or total weight of the composition, 40%-50% cholesterol by mole or total weight of the composition, and 10%-20% non-cationic lipids by mole or total weight of the composition. In some other embodiments, the composition is 50%-75% ionizable lipids by mole or total weight of the composition, 20%-40% cholesterol by mole or total weight of the composition, and 5% to 10% non-cationic lipids by mole or total weight of the composition, and 1%-10% conjugated lipids by mole or total weight of the composition. The composition may contain 60%-70% ionizable lipids by mole or total weight of the composition, 25%-35% cholesterol by mole or total weight of the composition, and 5%-10% non-cationic lipids by mole or total weight of the composition. The composition may also contain up to 90% ionizable lipids by mole or total weight of the composition and 2% to 15% non-cationic lipids by mole or total weight of the composition.The formulation can also be a lipid nanoparticle formulation, for example comprising 8%-30% ionizable lipid by mole or total weight of the composition, 5%-30% non-cationic lipid by mole or total weight of the composition, and 0-20% cholesterol by mole or total weight of the composition; 4%-25% ionizable lipid by mole or total weight of the composition, 4%-25% non-cationic lipid by mole or total weight of the composition, 2% to 25% cholesterol by mole or total weight of the composition, 10% to 35% conjugated lipid by mole or total weight of the composition, and 0% to 20% cholesterol by mole or total weight of the composition; 5% cholesterol; or 2%-30% ionizable lipids by mole or total weight of the composition, 2%-30% non-cationic lipids by mole or total weight of the composition, 1% to 15% cholesterol by mole or total weight of the composition, 2% to 35% conjugated lipids by mole or total weight of the composition, and 1%-20% cholesterol by mole or total weight of the composition; or even up to 90% ionizable lipids by mole or total weight of the composition and 2%-10% non-cationic lipids by mole or total weight of the composition, or even 100% cationic lipids by mole or total weight of the composition. In some embodiments, the lipid particle formulation comprises ionizable lipids, phospholipids, cholesterol and PEGylated lipids in a molar ratio of 50:10:38.5:1.5. In some other embodiments, the lipid particle formulation comprises ionizable lipids, cholesterol and PEGylated lipids in a molar ratio of 60:38.5:1.5.

[0573] In some embodiments, the lipid particles comprise an ionizable lipid, a non-cationic lipid (e.g., a phospholipid), a sterol (e.g., cholesterol), and a PEGylated lipid, wherein the lipid molar ratio of the ionizable lipid is in the range of 20 to 70 mol%, with a target of 40-60 mol%, the molar percentage of the non-cationic lipid is in the range of 0 to 30 mol%, with a target of 0 to 15 mol%, the molar percentage of the sterol is in the range of 20 to 70 mol%, with a target of 30 to 50 mol%, and the molar percentage of the PEGylated lipid is in the range of 1 to 6 mol%, with a target of 2 to 5 mol%.

[0574] In some embodiments, the lipid particle comprises a molar ratio of ionizable lipid / non-cationic lipid / sterol / conjugated lipid of 50:10:38.5:1.5.

[0575] In one aspect, the present disclosure provides lipid nanoparticle formulations comprising phospholipids, phosphatidylcholine, phosphatidylcholine, and phosphatidylethanolamine.

[0576] In certain embodiments, one or more additional compounds may also be included. Those compounds may be administered alone, or additional compounds may be included in the lipid nanoparticles of the present invention. In other words, except nucleic acid or at least the second nucleic acid, the lipid nanoparticles may contain other compounds that are different from the first nucleic acid. In a non-limiting manner, other additional compounds may be selected from the group consisting of: small or large organic or inorganic molecules, monosaccharides, disaccharides, trisaccharides, oligosaccharides, polysaccharides, peptides, proteins, peptide analogs and derivatives thereof, peptide mimetics, nucleic acids, nucleic acid analogs and derivatives, extracts made from biomaterials, or any combination thereof.

[0577] In some embodiments, LNPs are directed to specific tissues by adding targeting domains. For example, biological ligands can be displayed on the surface of LNPs to enhance interaction with cells displaying cognate receptors, thereby promoting association with tissues where cells express the receptors and cargo delivery therein. In some embodiments, the biological ligand can be a ligand that drives delivery to the liver, for example, LNPs displaying GalNAc promote delivery of nucleic acid cargo to hepatocytes displaying the asialoglycoprotein receptor (ASGPR). The work of Akinc et al. Mol Ther [Molecular Therapy] 18(7): 1357-1364 (2010) teaches conjugating trivalent GalNAc ligands to PEG-lipids (GalNAc-PEG-DSG) to produce ASGPR-dependent LNPs to obtain observable LNP cargo effects (see, e.g., Akinc et al. 2010, supra). Figure 6Other LNP formulations displaying ligands, such as those incorporating folic acid, transferrin, or antibodies, are discussed in WO 2017223135, which is incorporated herein by reference in its entirety, along with the references used therein: namely, Kolhatkar et al., Curr Drug Discov Technol. 2011 8:197-206; Musacchio and Torchilin, Front Biosci. 2011 16:1388-1412; Yu et al., Mol Membr Biol. 2010 27:286-298; Patil et al., Crit Rev Ther Drug Carrier Syst. 2008 25:1-61; Benoit et al., Biomacromolecules. 2011 12:2708-2714; Zhao et al., Expert Opin Drug Deliv. 2008 5:309-319; Akinc et al., Mol Ther. 2010 18:1357-1364; Srinivasan et al., Methods Mol Biol. 2012 8 20:105-116; Ben-Arie et al., Methods Mol Biol. 2012 7 57:497-507; Peer 2010 J Control Release. 20:63-68; Peer et al., Proc Natl Acad Sci U SA. 2007 104:4095-4100; Kim et al., Methods Mol Biol. 2011 721:339-353; Subramanya et al., Mol Ther. 2010 18:2028-2037; Song et al., Nat Biotechnol. 2005 23:709-717; Peer et al., Science. 2008 319:627-630; and Peer and Lieberman, Gene Ther. 2011 18:1127-1133.

[0578] In some embodiments, LNPs are selected for tissue-specific activity by adding Selective ORgan Targeting (SORT) molecules to formulations containing traditional components such as ionizable cationic lipids, amphiphilic phospholipids, cholesterol, and poly(ethylene glycol) (PEG). The teachings of Cheng et al. Nat Nanotechnol 15(4):313-320 (2020) demonstrate that the addition of supplemental "SORT" components can precisely alter the in vivo RNA delivery profile and mediate tissue-specific (e.g., lung, liver, spleen) gene delivery and editing based on the percentage and biophysical properties of the SORT molecules.

[0579] In certain embodiments, LNP comprises biodegradable ionizable lipids. In certain embodiments, LNP comprises (9Z, 12Z)-3-((4,4-bis(octyloxy)butyryl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadecane-9,12-dienoate, also referred to as 3-((4,4-bis(octyloxy)butyryl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl (9Z, 12Z)-octadecane-9,12-dienoate) or another ionizable lipid. See, e.g., WO 2019 / 067992, WO / 2017 / 173054, WO 2015 / 095340, and WO 2014 / 136086, and the lipids of the references provided therein. In some embodiments, the terms cationic and ionizable are interchangeable in the context of LNP lipids, for example, where the ionizable lipid is cationic depending on pH.

[0580] In some embodiments, the average LNP diameter of the LNP formulation can be between tens of nm and hundreds of nm, for example, as measured by dynamic light scattering (DLS). In some embodiments, the average LNP diameter of the LNP formulation can be from about 40 nm to about 150 nm, such as about 40 nm, 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 105 nm, 110 nm, 115 nm, 120 nm, 125 nm, 130 nm, 135 nm, 140 nm, 145 nm, or 150 nm. In some embodiments, the average LNP diameter of LNP formulations may be about 50nm to about 100nm, about 50nm to about 90nm, about 50nm to about 80nm, about 50nm to about 70nm, about 50nm to about 60nm, about 60nm to about 100nm, about 60nm to about 90nm, about 60nm to about 80nm, about 60nm to about 70nm, about 70nm to about 100nm, about 70nm to about 90nm, about 70nm to about 80nm, about 80nm to about 100nm, about 80nm to about 90nm, or about 90nm to about 100nm. In some embodiments, the average LNP diameter of LNP formulations may be about 70nm to about 100nm. In specific embodiments, the average LNP diameter of LNP formulations may be about 80nm. In some embodiments, the average LNP diameter of LNP formulations may be about 100nm. In some embodiments, the LNP formulation has an average LNP diameter ranging from about 1 mm to about 500 mm, about 5 mm to about 200 mm, about 10 mm to about 100 mm, about 20 mm to about 80 mm, about 25 mm to about 60 mm, about 30 mm to about 55 mm, about 35 mm to about 50 mm, or about 38 mm to about 42 mm.

[0581] In some cases, LNP can be relatively homogeneous.Polydispersity index can be used for indicating the homogeneity of LNP, for example the size distribution of lipid nanoparticles.Small (for example, less than 0.3) polydispersity index usually indicates narrow size distribution.The polydispersity index of LNP can be about 0 to about 0.25, such as 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24 or 0.25.In certain embodiments, the polydispersity index of LNP can be about 0.10 to about 0.20.

[0582] The zeta potential of LNP can be used to indicate the electrokinetic potential of the composition. In certain embodiments, the zeta potential can describe the surface charge of LNP. Lipid nanoparticles with relatively low charge (positive or negative charge) are generally desirable because higher charged materials may not interact with cells, tissues and other elements in the body undesirably. In some embodiments, the zeta potential of the LNP may be from about -10 mV to about +20 mV, from about -10 mV to about +15 mV, from about -10 mV to about +10 mV, from about -10 mV to about +5 mV, from about -10 mV to about 0 mV, from about -10 mV to about -5 mV, from about -5 mV to about +20 mV, from about -5 mV to about +15 mV, from about -5 mV to about +10 mV, from about -5 mV to about +5 mV, from about -5 mV to about 0 mV, from about 0 mV to about +20 mV, from about 0 mV to about +15 mV, from about 0 mV to about +10 mV, from about 0 mV to about +5 mV, from about 0 mV to about +20 mV, from about 0 mV to about +15 mV, from about 0 mV to about +10 mV, from about 0 mV to about +5 mV, from about +5 mV to about +20 mV, from about +5 mV to about +15 mV, or from about +5 mV to about +10 mV.

[0583] The encapsulation efficiency of protein and / or nucleic acid describes the amount of protein and / or nucleic acid that is encapsulated or otherwise associated with LNP after preparation relative to the initial amount provided. Encapsulation efficiency is ideally higher (e.g., close to 100%). Encapsulation efficiency can be measured, for example, by comparing the amount of protein or nucleic acid in a solution containing lipid nanoparticles before and after the lipid nanoparticles are broken with one or more organic solvents or detergents. Anion exchange resins can be used to measure the amount of free protein or nucleic acid in the solution. Fluorescence can be used to measure the amount of free protein and / or nucleic acid in the solution. For lipid nanoparticles as described herein, the encapsulation efficiency of protein and / or nucleic acid can be at least 50%, such as 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%. In some embodiments, the encapsulation efficiency can be at least 80%. In some embodiments, the encapsulation efficiency can be at least 90%. In some embodiments, the encapsulation efficiency can be at least 95%.

[0584] The LNP may optionally include one or more layers of coating. In some embodiments, the LNP may be formulated in a capsule, film or tablet having a coating. The capsule, film or tablet comprising the composition described herein may have any available size, tensile strength, hardness or density.

[0585] Additional exemplary lipids, formulations, methods, and LNP characterizations are taught by WO 2020061457, which is incorporated herein by reference in its entirety. See also: Hou et al. Lipid nanoparticles for mRNA delivery. Nat Rev Mater (2021). https: / / doi.org / 10.1038 / s41578-021-00358-0.

[0586] In some embodiments, in vitro or ex vivo cell liposome transfection is performed using Lipofectamine MessengerMax (ThermoFisher) or TransIT-mRNA transfection reagent (Mirus Bio). In certain embodiments, LNPs are prepared using GenVoy_ILM ionizable lipid mixtures (Precision NanoSystems). In certain embodiments, LNPs are prepared using 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA) or dilinoleylmethyl-4-dimethylaminobutyrate (DLin-MC3-DMA or MC3), the preparation and in vivo use of which are taught in Jayaraman et al. Angew Chem Int Ed Engl [German Applied Chemistry] 51 (34): 8529-8533 (2012), which is incorporated herein by reference in its entirety.

[0587] LNP formulations optimized for delivery of CRISPR-Cas systems (e.g., Cas9-gRNA RNPs, gRNA, Cas9 mRNA) are described in WO 2019067992 and WO 2019067910, both of which are incorporated by reference.

[0588] Additional specific LNP formulations useful for delivery of nucleic acids are described in US 8,158,601 and US 8,168,775, both of which are incorporated by reference, including the formulation sold under the name ONPATTRO used in patisiran.

[0589] Exemplary dosing of the DNA and LNPs described herein can include about 0.1, 0.25, 0.3, 0.5, 1, 2, 3, 4, 5, 6, 8, 10, or 100 mg / kg (DNA).

[0590] The following embodiments are contemplated:

[0591] A. A lipid nanoparticle (LNP) comprising a TDSC construct, sequence or composition described herein.

[0592] B. The LNP as described in Example A, comprising a cationic lipid.

[0593] C. The LNP of Example B, wherein the cationic lipid has a structure according to:

[0594]

[0595] D. The LNP of any one of embodiments AC, further comprising one or more neutral lipids, e.g., DSPC, DPPC, DMPC, DOPC, POPC, DOPE, SM, a steroid, e.g., cholesterol, and / or one or more polymer-conjugated lipids, e.g., PEGylated lipids, e.g., PEG-DAG, PEG-PE, PEG-S-DAG, PEG-cer, or PEG dialkoxypropylcarbamate.

[0596] In an embodiment, LNP formulations comprising TDSCs described herein can be targeted to desired cell types by surface modification with targeting effectors. Such targeting effectors include, for example, cell-specific receptor ligands that bind to target cells; antibodies or other conjugates for target cells; centryins; cell-penetrating peptides; peptides that can achieve endosomal escape (e.g., GALA, KALA). For example, see Table 1 and Table 2 of Tai & Gao. 2017. Adv Drug Deliv Rev. [Advanced Drug Delivery Review] 110-111: 157-168 for a review.

[0597] In embodiments, LNP formulations comprising TDSCs described herein may be co-administered with an adjuvant, such as co-delivered with the adjuvant in the same formulation.

[0598] Route of administration

[0599] The TDSCs or nucleic acids comprising dsDNA described herein are introduced into a cell, tissue or subject by any suitable route.

[0600] Administration to target cells or tissues (e.g., ex vivo) can be by methods known in the art, such as transfection, transient or stable transfection using reagents (e.g., liposomes, calcium phosphate) or physical means (e.g., electroporation, gene guns, microinjection, microfluidic shearing, cell squeezing). Other methods are described in, for example, Rad et al. 2021. Adv. Mater. [Advanced Materials] 33: 2005363, which is incorporated herein by reference.

[0601] Can be administered to a subject (e.g., a mammal, such as a human subject) by parenteral (e.g., intravenous, intramuscular, intraperitoneal, subcutaneous or intracranial) routes; by topical, transdermal or transdermal administration. Other suitable routes include oral, rectal, transmucosal, intranasal, inhalation (e.g., by aerosol), oral (e.g., sublingual), vaginal, intrathecal, intraocular, transdermal, intraendothelial, intrauterine (or intraocular), intrapleural, intracerebral, intraarticular, topical, intralymphatic. Also included are direct tissue or organ injections (e.g., to the liver, eye, skeletal muscle, myocardium, diaphragm, muscle or brain).

[0602] application

[0603] The TDSCs described herein or nucleic acids comprising dsDNA can be used for treatment or health applications of subjects (e.g., humans or non-human animals). Although the description of the pharmaceutical compositions provided herein mainly relates to pharmaceutical compositions suitable for administration to humans, it will be understood by a skilled artisan that such compositions are generally suitable for administration to any other animal. The subject can be any animal, such as a mammal, such as a human or non-human mammal. In an embodiment, the subject is a vertebrate (e.g., a mammal, a bird, a fish, a reptile, or an amphibian). In an embodiment, the subject is a human. In an embodiment, the method subject is a non-human mammal. In an embodiment, the subject is a non-human mammal, such as a non-human primate (e.g., a monkey, an ape), an ungulate (e.g., a cattle, a buffalo, a sheep, a goat, a pig, a camel, a llama, an alpaca, a deer, a horse, a donkey), a carnivore (e.g., a dog, a cat), a rodent (e.g., a rat, a mouse), or a lagomorph (e.g., a rabbit). In an embodiment, the subject is a bird, such as a member of the following avian taxa: Galliformes (e.g., chicken, turkey, pheasant, quail), Anseriformes (e.g., duck, goose), Paleognathus (e.g., ostrich, emu), Columbiformes (e.g., pigeon, pigeon), or Psittaciformes (e.g., parrot). In an embodiment, the subject is an invertebrate, such as an arthropod (e.g., insect, spider, crustacean), nematode, annelid, worm, or mollusk.

[0604] In some embodiments, the DNA described herein is provided at a dose of about 0.1-100 mg / kg DNA.

[0605] In some embodiments, the TDSCs described herein confer an effector biological effect, such as expression of a therapeutic polypeptide, to a host cell, tissue, or subject over a period of at least 2, 3, 4, 5, 6 days, or a week; at least 8, 9, 10, 12, 14 days, or two weeks; at least 16, 18, 20 days, or 3 weeks; at least 22, 24, 25, 27, 28 days, or a month; at least 2 months, 3 months, 4 months, 5 months, 6 months, or more; between a week and 6 months, between 1 month and 6 months, between 3 months and 6 months.

[0606] In some embodiments, the TDSCs described herein confer an effector biological effect, such as expression of a therapeutic polypeptide, on a host cell, tissue, or subject for a period of at least one cell division of the host cell.

[0607] In embodiments, the TDSCs described herein can be used to deliver effectors, such as the effectors described herein, to a cell, tissue, or subject.

[0608] In embodiments, the TDSCs described herein can be used to modulate (eg, increase or decrease) a biological parameter in a cell, tissue, or subject. The biological parameter can be an increase or decrease in gene expression of a subject gene in a target cell, tissue, or subject.

[0609] In embodiments, the TDSCs described herein may be used to treat cells, tissues, or subjects in need thereof by administering the TDSCs described herein to such cells, tissues, or subjects.

[0610] In embodiments, the TDSC delivers the effector to a cell selected from a lymphocyte (eg, a T cell or a monocyte), a cancer cell (eg, an osteosarcoma cell), a HEK293 cell, a hepatocyte, or an epidermal cell (eg, a keratinocyte).

[0611] Examples

[0612] Example 1: Design and assembly of plasmid template for linear TDSC

[0613] This example describes how to create a plasmid template for a chemically modified linear TDSC construct. In this example, the construct template was designed using the following specific sequence components:

[0614] Promoter Ef1a:

[0615]

[0616] Effector sequence encoding model / marker protein (mCherry):

[0617] 5'atggtgagcaagggcgaggaggataacatggccatcatcaaggagttcatgcgcttcaaggtgcacatggagggctcc -3' (SEQ ID NO: 38)

[0618] Optionally, the construct may also include one or both of an NTS or maintenance sequence, for example:

[0619] NTS: SV40 enhancer: 5'-cccaagaagaagaggaaagtc-3' (SEQ ID NO: 1)

[0620] Maintenance sequence: human interferon-β MAR

[0621] 5’tataattcactggaatttttttgtgtgtatggtatgacatatgggttcccttttattttttacatataaatatatttccctgtttttctaaa aaagaaaaagatcatcattttcccattgtaaaatgccatatttttttcataggtcacttacata3’(SEQ ID NO:121)

[0622] · PolyA site:

[0623] 5’ctgtgccttctagttgccagccatctgttgtttgcccctcccccgtgccttccttgaccctggaaggtgccactcccactgtc ctttcctaataaaatgaggaaattgcatcgcattgtctgagtaggtgtcattctattctggggggtggggtggggcaggacagcaag ggggaggattgggaagacaatagcaggcatgctggggatgcggtgggctctatgg3’(SEQ ID NO:122)

[0624] These elements are used to design plasmid templates using standard DNA design software. Assembly was performed by Golden Gate assembly following published protocols and commercially available kits (Marillonnet & Grützner. 2020. Synthetic DNA assembly using golden gate cloning and the hierarchical modular cloning pipeline. Current Protocols in Molecular Biology. 130:e115; Golden Gate Assembly Protocol for Using NEB Golden Gate Assembly Mix (E1600) (New England Biolabs). Golden Gate assembly of the designed constructs was performed using a series of 120 bp long primers, where the first 30 bp matched the relevant adjacent fragment, the next 60 bp encoded the new sequence, and the last 30 bp annealed to the target sequence. The fragments were assembled into the final construct design (NEB Golden Gate Assembly Kit) and the sequence was confirmed by Sanger sequencing (Sigma Aldrich) according to the manufacturer's protocol.

[0625] Example 2: Transformation of plasmid DNA into unmodified TDSCs

[0626] This example describes the creation of TDSCs containing linear dsDNA and no chemically modified nucleotides. In this example, TDSCs were prepared according to the manufacturer's protocol (Takara, R045Q). Max DNA polymerase was used to prepare linear dsDNA from the plasmid in Example 1. dsDNA was purified by Gel and PCR Clean-Up and quantified by Qubit according to the manufacturer's protocol (Thermo Fisher, Q33265). TM 1X dsDNA Broad Range was used to measure the dsDNA concentration.

[0627] Example 3: Conversion of plasmid DNA into TDSCs with chemical modifications to only the sense strand or the antisense strand

[0628] This example describes the generation of TDSCs containing linear dsDNA, wherein only the sense strand or the antisense strand is chemically modified. According to Minev et al., 2019, Rapid in vitro production of singlestrandedDNA [rapid in vitro production of singlestrandedDNA], Nucleic Acids Research [Nucleic Acids Research], Vol. 47, No. 22: 11956-11962 (which is incorporated herein by reference), the plasmid construct in Example 1 is converted into linear ssDNA. In short, the chemically modified nucleotide 5-methylcytosine (5mC) is mixed with standard adenine (dATP), guanine (dGTP) and thymine (dTTP) to generate a dNTP mixture for PCR, thereby creating a chemically modified chain. PCR with a forward primer of a methanol-responsive polymer generates a labeled amplicon that is capable of selectively precipitating a chemically modified chain under denaturing conditions. The concentration of linear ssDNA (sense strand or antisense strand) is determined by Qubit TM The ssDNA assay kit was used according to the manufacturer's protocol (Thermo Fisher Scientific, Q10212).

[0629] Complementary strands were created by incubating ssDNA with the corresponding primers and a PCR mixture with unmodified nucleotides. The PCR products were used according to the manufacturer's protocol (Takara Bio, 740609). dsDNA was purified by Gel and PCR Clean-Up and quantified by Qubit according to the manufacturer's protocol (Thermo Fisher, Q33265). TM 1X dsDNA Broad Range was used to measure the dsDNA concentration.

[0630] Example 4: Conversion of plasmid DNA into TDSCs with chemically modified sense and antisense strands

[0631] This example describes the generation of TDSCs containing linear dsDNA that contains chemically modified nucleotides in both the sense and antisense strands. The plasmid construct in Example 1 was converted to chemically modified linear dsDNA by mixing 5-methylcytosine (5mC) with dATP, dGTP, and dTTP to create a dNTP mix for PCR. The dNTP mix was mixed with dNTPs according to the manufacturer's protocol (Takara Bio, R045Q). Max DNA polymerase was used according to the manufacturer's protocol (Takara Bio, 740609). dsDNA was purified by Gel and PCR Clean-Up and quantified by Qubit according to the manufacturer's protocol (Thermo Fisher, Q33265). TM 1X dsDNA Broad Range was used to measure the dsDNA concentration.

[0632] Example 5: Addition of exonuclease-resistant DNA end forms containing chemically modified nucleotides to TDSC ends end

[0633] This example describes the creation of a TDSC comprising the linear dsDNA of Examples 2-4, which comprises chemically modified nucleotides at both ends of the construct.

[0634] A custom adaptor with the following sequence was designed to contain chemically modified nucleotides: 5'-C*C*C*GAGGCGGUACGAGCCACACGTACTACGCTCGTACCGCCUC*G*G*GT-3' (SEQ ID NO: 85) (* indicates phosphorothioate bonds, complementary to the bold nucleotides). The adaptor was modified with a 5'-C*C*C*GAGGCGGUACGAGCCACACGTACTACGCTCGTACCGCCUC*G*G*GT-3' according to the manufacturer's protocol (New England Biolabs, E7546). Ultra TM The linear dsDNA from any of Examples 2-4 was treated with the II End Repair / dA Tailing Module. The kit was used to add non-templated adenine to the 3' end of both the sense and antisense strands in the linear dsDNA. Next, the PCR products were purified using the PCR product according to the manufacturer's protocol (New England Laboratories, E7595). Ultra TM The custom adapters were ligated to the A-tailed dsDNA using the II ligation module. To remove dsDNA constructs without adapter molecules at each end, the dsDNA was treated with exonuclease VIII and truncated according to the manufacturer's protocol (New England Laboratories, M0545S). To remove the remaining fragments of the adapter that did not contain phosphorothioate bonds, the dsDNA was ligated to the A-tailed dsDNA using the II ligation module. The dsDNA was then treated with mung bean nuclease to remove the single-stranded DNA overhangs on the adapters and create TDSCs containing blunt-ended dsDNA with phosphorothioate modifications at the ends (New England Laboratories, M0250).

[0635] Use according to the manufacturer's protocol (Takara Bio, 740609) dsDNA was purified by Gel and PCR Clean-Up and quantified by Qubit according to the manufacturer's protocol (Thermo Fisher, Q33265). TM 1X dsDNA Broad Range was used to measure the dsDNA concentration.

[0636] Example 6: Addition of exonuclease-resistant DNA end forms containing loop structures to the ends of TDSCs

[0637] This example describes the creation of a TDSC comprising the linear dsDNA of Examples 2-4, with loop structures at each end of the construct.

[0638] Custom adapters with the following sequences were designed to contain chemically modified nucleotides: (Bold nucleotides are complementary). Ultra TM The linear dsDNA from any of Examples 2-4 was treated with the II End Repair / dA Tailing Module. The kit was used to add non-templated adenine to the 3' end of both the sense and antisense strands in the linear dsDNA. Next, the PCR products were purified using the PCR product according to the manufacturer's protocol (New England Laboratories, E7595). Ultra TM The custom adaptors were ligated to the A-tailed dsDNA using the PCR amplification module. To remove dsDNA constructs without adaptor molecules at each end, the dsDNA was treated with exonuclease VIII and truncated according to the manufacturer's protocol (New England Laboratories, M0545S).

[0639] Use according to the manufacturer's protocol (Takara Bio, 740609) dsDNA was purified by Gel and PCR Clean-Up and quantified by Qubit according to the manufacturer's protocol (Thermo Fisher, Q33265). TM 1X dsDNA Broad Range was used to measure the dsDNA concentration.

[0640] Example 7: Addition of exonuclease-resistant DNA end forms containing Y-adapters to the ends of TDSCs

[0641] This example describes the creation of a TDSC comprising the linear dsDNA of any of Examples 2-4, with Y-adapters at each end of the construct.

[0642] A custom adaptor with the following sequence was designed to contain chemically modified nucleotides: 5'-CCCGGGCGGA*C*A*G*C*A*CUC*A*C*G*A*C*TCCGCCCGGGT-3' (SEQ ID NO: 89) (* indicates phosphorothioate bonds, bold nucleotides are complementary). The adaptor was modified with 5'-CCCGGGCGGA*C*A*G*C*A*CUC*A*C*G*A*C*TCCGCCCGGGT-3' according to the manufacturer's protocol (New England Biolabs, E7546). Ultra TM The linear dsDNA from any of Examples 2-4 was treated with the II End Repair / dA Tailing Module. The kit was used to add non-templated adenine to the 3' end of both the sense and antisense strands in the linear dsDNA. Next, the PCR products were purified using the PCR product according to the manufacturer's protocol (New England Laboratories, E7595). Ultra TM The custom adapters were ligated to the A-tailed dsDNA using the II ligation module. To remove dsDNA constructs without adapter molecules at each end, the dsDNA was treated with exonuclease VIII and truncated according to the manufacturer's protocol (New England Laboratories, M0545S). To convert the circles into linear ssDNA strands, the dsDNA was ligated to the A-tailed dsDNA using the II ligation module. The cells were incubated with 5% paraformaldehyde (PNA) enzyme to remove uracil nucleotides from the adapter (New England Laboratories, M5505).

[0643] Use according to the manufacturer's protocol (Takara Bio, 740609) dsDNA was purified by Gel and PCR Clean-Up and quantified by Qubit according to the manufacturer's protocol (Thermo Fisher, Q33265). TM 1X dsDNA Broad Range was used to measure the dsDNA concentration.

[0644] Example 8: Formulation of TDSC with LNP

[0645] This example describes how to formulate constructs prepared as described in the previous examples with lipid nanoparticles (LNPs).

[0646] According to Chen et al. 2012.J Am Chem Soc. [Journal of the American Chemical Society] Vol. 134, No. 16: 6948-6951, nucleic acid constructs are combined with lipid components by microfluidic devices. In short, microfluidic devices are manufactured in polydimethylsiloxane (PDMS) according to standard photolithography procedures (McDonald & Whitesides. 2002. Accounts Chem Res [Accounting Chemical Research] Vol. 35, No. 7: 491-499). Lipid components (usually containing cationic lipids, cholesterol, auxiliary lipids, polyethylene glycol-modified lipids and lipids (optional) that promote the conjugation of targeting moieties) are combined and dissolved in 90% ethanol. Nucleic acid constructs are dissolved in buffer. Nucleic acid solution, lipid solution and phosphate buffered saline (PBS) are injected into microfluidic devices. Freshly prepared LNPs are dialyzed with PBS buffer using a membrane with a MWCO of 3.5 kD to remove ethanol and exchange buffer.

[0647] The effective diameter, polydispersity, and zeta potential of the LNPs were characterized using dynamic light scattering (DLS) (ZetaPALS, Brookhaven Instruments, NY, 15 mW laser, incident beam 676 nm); and the LNPs were characterized by lysing the particles and using the high sensitivity (HS) and broad range (BR) Quant-iT according to the manufacturer's protocol (Thermo Fisher Scientific, Q33232). TM 1X dsDNA Assay Kit to determine total nucleic acid concentration.

[0648] Example 9: In vitro expression in cells and assessment of innate immune responses

[0649] This example describes how to test gene expression and determine the effects of TDSCs on the innate immune response of cultured cells.

[0650] Experimental TDSC constructs were prepared as in Examples 2-7 above. Constructs and controls were applied to cells selected from HEK, keratinocytes, macrophages, T cells and epithelial cells via electroporation at various concentrations. Untreated control samples can be run in parallel. After electroporation, cells were moved to the final culture vessel. Constructs prepared with LNP were applied directly to cells in the orifice plate.

[0651] To determine the expression of the construct encoding the fluorescent reporter gene mCherry, cells were first washed with PBS before flow cytometry analysis. All flow cytometry was performed on the MACSQuant VYB of Miltenyi. In order to detect the mCherry signal, a yellow laser (wavelength 561nm) was used for excitation, and a 615 / 620nm emission filter was used. 20,000 events were recorded for each sample, and the data were analyzed using Flowjo V.9.0 software. Cells were first gated on FSC-A and SSC-A graphs to remove cell debris. The population was further plotted on FSC-A and FSC-H graphs to limit single cell populations. Finally, the bivariate graph between fluorescent signal expressing cells and non-expressing cells was used to determine the percentage of expressing cells. The distribution of expressing cells was used to determine the expression level in each cell. Expression analysis was performed at multiple time points.

[0652] As described in Jakobsen et al. 2013. Proc Natl Acad Sci USA [Proceedings of the National Academy of Sciences of the United States] Vol. 110, No. 48: E4571-80, cells were subjected to qPCR to determine the RNA level of IFN-b in the test cells. In short, the probe primer set used in qPCR is human IFN-b (Thermo Fisher Scientific, Hs01077958_s1) and b-actin (Thermo Fisher Scientific, Hs00357333_g1). Prefabricated Taqman assay and RNA-to-Ct one-step kit (Applied Biosystems) were used for analysis. qPCR was carried out on MX3005 system (Stratagene). RNA expression was normalized for b-actin and related untreated controls. Data are expressed as mean ± SEM of biological repetitions.

[0653] The cell supernatants were subjected to ELISA according to the manufacturer's protocol to determine the secretion level of IFN-b.

[0654] Example 10. Determination of exonuclease resistance of TDSCs containing blocked ends

[0655] The example describes how to test whether TDSCs containing closed ends (e.g., linear dsDNA constructs connected by adapters) have resistance to exonuclease III (M0206, New England Biolabs Inc.). TDSCs are tested next to non-nuclease controls. The non-nuclease control contains DNA with the same sequence as the target TDSC, except that it has undergone an adapter connection scheme for adding exonuclease-resistant DNA end forms to the TDSC, but no adapter oligonucleotides are added to the mixture. 1 μL of exonuclease III (starting concentration of 100 units / uL) / 5 μg DNA is added to 50 μL. The tubes are thoroughly mixed and centrifuged. The tubes are run at 37°C for 1 hour on a thermal cycler and heat inactivated at 70°C for 30 minutes.

[0656] Use a vacuum manifold according to the manufacturer's protocol to The samples were purified using a gel and PCR cleanup kit (Catalog No. 740609, Macherey-Nagel). Briefly, the elution buffer was heated to 70°C. 2x volumes of NTI binding buffer were added to 1x volume of Exo III treated DNA. The sample was mixed until evenly distributed and allowed to stand at room temperature for 5 minutes. The columns on the vacuum manifold were secured, the valves opened and the vacuum turned on. 375 μL of the DNA-NTI mixture was added to the 2x columns and allowed to pass completely through each column. 700 μL of NTC wash buffer was added twice. The columns were removed from the vacuum manifold and placed in a collection tube. The assembly was centrifuged at 11,000 x g for 1 minute. The columns were placed in a new low binding microcentrifuge tube, 25 μL of preheated buffer was added, and the assembly was incubated at 70°C for 5 min. The assembly was centrifuged at 11,000 x g for 1 min. The incubation and elution steps were repeated a second time. The collected DNA was quantified by dsDNA BR Qubit (Q32850, Thermo Fisher Scientific) on a Qubit 4 Fluorometer (Q33226, Thermo Fisher Scientific) according to the manufacturer's protocol.

[0657] The sample is loaded into the E-Gel EX, 1% agarose gel (G402021, Thermo Fisher Scientific) in each well with the amount of 16ng DNA per well. The ladder (ladder) (10488090, Thermo Fisher Scientific) is loaded into the leftmost lane of the gel with 2 μl. The gel is run through the E-Gel Power Snap electrophoresis system according to the manufacturer's protocol (G8100, G8200, Thermo Fisher Scientific). After the gel is run, exonuclease-resistant TDSC can be seen, and its molecular weight corresponds to the full-length DNA plus the closed adapter sequence. If at least 95% of the products appearing in the gel in the lane correspond to the full-length TDSC, the TDSC will be considered to have exonuclease resistance in this assay.

[0658] Example 11. Determining the exonuclease resistance of TDSCs comprising open ends (eg, two open ends)

[0659] This example describes how to test whether TDSCs containing open ends (e.g., linear dsDNA constructs connected by adapters) have resistance to exonuclease III (M0206, New England Biolabs). TDSCs are tested next to non-nuclease controls. The non-nuclease control contains DNA with the same sequence as the target TDSC, except that it has undergone an adapter connection scheme for adding exonuclease-resistant DNA end forms to the TDSC, but no adapter oligonucleotides are added to the mixture. In a 20ul reaction, 2 units of exonuclease III are added for every 200ng DNA (10ng / ul). The tubes are mixed thoroughly and centrifuged. The tubes are run on a thermal cycler at 37°C for 30min.

[0660] The sample is loaded into the E-Gel EX, 1% agarose gel (G402021, Thermo Fisher Scientific) in each well with the amount of 20ng DNA per well. The ladder (ladder) (10488090, Thermo Fisher Scientific) is loaded into the leftmost lane of the gel with 2 μl. According to the manufacturer's scheme (G8100, G8200, Thermo Fisher Scientific), the gel is run by the E-GelPower Snap electrophoresis system. After the gel is run, exonuclease-resistant TDSC can be seen, and its molecular weight corresponds to the full-length DNA plus the closed adapter sequence. If at least 95% of the products appearing in the lane gel correspond to the full-length TDSC, then TDSC will be considered to have exonuclease resistance in this assay.

[0661] The Exonuclease III digestion protocol in this example was performed on four samples: a control (unmodified) TDSC, designated "Ct"; a TDSC designated "6a" that contains six phosphorothioate bonds at the 5' and 3' ends of each strand ( Figure 7B); TDSC designated as "3a", which contains three phosphorothioate bonds at the 5' and 3' ends of each strand ( Figure 7C ); and TDSCs designated as "Ya" that contain identical Y-adapters at each end, each Y-adapter containing six phosphorothioate bonds at the end of each strand ( Fig.7D ). Fig. 7A As shown, the control DNA "Ct" was digested, while the three phosphorothioate-modified TDSCs were resistant to exonuclease III digestion.

[0662] Example 12: Fabrication of TDSCs containing open ends

[0663] This example describes how to generate TDSCs containing open ends (e.g., containing phosphorothioate bonds) using USER (M5505, New England Biolabs) and Mung Bean Nuclease (M0250, New England Biolabs) treatment steps. The process starts with a raw TDSC containing closed ends. The raw TDSCs are treated alongside a non-nuclease control. The non-nuclease control contains DNA with the same sequence as the TDSCs, except that it has undergone an adapter ligation protocol for adding exonuclease-resistant DNA end forms to the TDSCs, but no adapter oligonucleotides have been added to the mixture.

[0664] These original TDSC samples were first treated according to the steps described in Example 10 to confirm exonuclease III resistance. 3 μL of USER enzyme was added to 5 μg of DNA from the purified sample of Example 10 in 100 μL. By removing uracil located in the loop, USER treatment opens the closed end to form a Y-adapter-like structure. The samples were incubated at 37°C for 1 hour. 1 μL of mung bean nuclease (10U / μL) was added to each tube. The samples were incubated at 30°C for 30 min. Mung bean nuclease degrades single-stranded DNA to produce flat-ended TDSCs.

[0665] Use a vacuum manifold according to the manufacturer's protocol to Samples were purified using a gel and PCR cleanup kit (740609, Macherey-Nagel). Briefly, the elution buffer was heated to 70°C. 2x volumes of NTI binding buffer were added to 1x volume of USER / MBN treated DNA. The sample was mixed until evenly distributed and allowed to stand at room temperature for 5 minutes. The columns were secured on a vacuum manifold, the valves were opened and the vacuum was turned on. The DNA-NTI mixture was added to the columns and passed completely through each column. 700 μL of NTC wash buffer was added twice. The columns were removed from the vacuum manifold and placed in a collection tube. The assembly was centrifuged at 11,000 x g for 1 minute. The columns were placed in a new low binding tube, 25 μL of preheated buffer was added, and the assembly was incubated at 70°C for 5 min. The assembly was centrifuged at 11,000 x g for 1 min. The incubation and elution steps were repeated a second time. The collected DNA was quantified by dsDNA BR Qubit (Q32850, Thermo Fisher Scientific) on a Qubit 4 Fluorometer (Q33226, Thermo Fisher Scientific) according to the manufacturer's protocol.

[0666] To confirm the generation of TDSC, the samples were loaded into E-GelEX, 1% agarose gel (G402021, Thermo Fisher Scientific) in each well at 16 ng DNA per well. The ladder (10488090, Thermo Fisher Scientific) was loaded into the leftmost lane of the gel at 2 μl. The gel was run through the E-Gel Power Snap electrophoresis system according to the manufacturer's protocol (G8100, G8200, Thermo Fisher Scientific). After the gel run, TDSC can be seen with a molecular weight corresponding to the full-length DNA plus the adapter sequence.

[0667] Example 13: Production of TDSCs containing Y-adapters

[0668] This example describes how to use USER (M5505, New England Laboratories) to create open end forms to generate TDSCs containing linear dsDNA constructs modified with Y-adapters. The process starts with an original TDSC containing closed ends. The original TDSC is tested next to a non-nuclease control. The non-nuclease control contains DNA with the same sequence as the TDSC, except that it has undergone an adaptor ligation protocol for adding exonuclease-resistant DNA end forms to the TDSC, but no adaptor oligonucleotides are added to the mixture.

[0669] These raw TDSC samples were first treated according to the steps described in Example 10 to confirm exonuclease III resistance. 3 μL of USER enzyme was added to 5 μg of DNA from the purified sample of Example 10 in 100 μL. The samples were incubated at 37° C. for 1 hour. By removing uracil located in the loop, USER treatment opens the closed end to form a Y-adapter, generating TDSCs containing a Y-adapter end form.

[0670] Use a vacuum manifold according to the manufacturer's protocol to Samples were purified using a gel and PCR cleanup kit (740609, Macherey-Nagel). Briefly, the elution buffer was heated to 70°C. 2x volumes of NTI binding buffer were added to 1x volume of USER / MBN treated DNA. The sample was mixed until evenly distributed and allowed to stand at room temperature for 5 minutes. The columns were secured on a vacuum manifold, the valves were opened and the vacuum was turned on. The DNA-NTI mixture was added to the columns and passed completely through each column. 700 μL of NTC wash buffer was added twice. The columns were removed from the vacuum manifold and placed in a collection tube. The assembly was centrifuged at 11,000 x g for 1 minute. The columns were placed in a new low binding tube, 25 μL of preheated buffer was added, and the assembly was incubated at 70°C for 5 min. The assembly was centrifuged at 11,000 x g for 1 min. The incubation and elution steps were repeated a second time. The collected DNA was quantified by dsDNA BR Qubit (Q32850, Thermo Fisher Scientific) on a Qubit 4 Fluorometer (Q33226, Thermo Fisher Scientific) according to the manufacturer's protocol.

[0671] To demonstrate that the final end form has been created, treat a small aliquot of USER treated DNA with 1 μL Exonuclease III / 5 μg DNA in a 50 μL reaction. If the final end form has been successfully created, Exonuclease III will degrade the TDSC in the aliquot.

[0672] The samples were loaded into E-Gel EX, 1% agarose gel (G402021, Thermo Fisher Scientific) in each well at 16 ng DNA per well. The ladder (10488090, Thermo Fisher Scientific) was loaded into the leftmost lane of the gel at 2 μl. The gel was run through the E-GelPower Snap electrophoresis system according to the manufacturer's protocol (G8100, G8200, Thermo Fisher Scientific). After the gel run, the molecular weight of the TDSC with Y-adapter corresponds to the full-length DNA plus the adaptor sequence, while the DNA form with Y-adapter treated with exonuclease III is not visible on the gel.

[0673] Example 14: Design and assembly of plasmid templates for production of double-stranded DNA (dsDNA) molecules

[0674] This example describes the generation of a plasmid template for a dsDNA molecule (eg, TDSC). In this example, a construct template was designed using the following specific sequence components.

[0675] Promoter Ef1a:

[0676]

[0677] · Effector sequence (mCherry) encoding the model / marker protein:

[0678] 5’atggtgagcaagggcgaggaggataacatggccatcatcaaggagttcatgcgcttcaaggtgcacatggagggctcc gtgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggtggccccctgcccttcgcctgggacatcctgtcccctcagttcatgtacggctccaaggcctacgtgaagcaccccgccgacatccccgactacttgaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccctgcaggacggcgagttcatctacaaggtgaagctgcgcggcaccaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctcctccgagcggatgtaccccgaggacggcgccctgaagggcgagatcaagcagaggctgaagctgaaggacggcggccactacgacgctgaggtcaagaccacctacaaggccaagaagcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcgtggaacagtacgaacgcgccgagggccgccactccaccggcggcatggacgagctgtacaagtaa-3’(SEQ ID NO:38)

[0679] Optional:

[0680] · NTS: SV40 enhancer: 5’-cccaagaagaagaggaaagtc-3’(SEQ ID NO:1)

[0681] · Maintenance sequence: human interferon-β MAR

[0682] 5'tataattcactggaattttttgtgtgtatggtatgacatatgggttccctttattttttacatataaatatatttccctgttttttctaaa aaagaaaaagatcatcattttcccattgtaaaatgccatatttttttcataggtcacttacata3' (SEQ ID NO: 39)

[0683] Second strand motif: AAV2 wild-type ITR

[0684] 5'aggaacccctagtgatggagttggccactccctctctgcgcgctcgctcgctcactgaggccgggcgaccaaaggtcg cccgacgcccgggctttgcccgggcggcctcagtgagcgagcgagcgcgcagctgcctgcagg-3' (SEQ ID NO: 26)

[0685] These elements were used to design plasmid templates using standard DNA design software. After design, plasmids were ordered from a commercial supplier (GenScript) and used as templates for PCR amplification.

[0686] Example 15: Production of TDSCs with chemical modifications

[0687] This example demonstrates the preparation of double-stranded DNA (dsDNA) molecules (eg, TDSC) containing cytosine with a chemical modification, such as 5-formyl-2'-deoxycytosine (5-formylcytosine).

[0688] Plasmid DNA (10 ng / 50 ul PCR reaction) was used as a template for PCR amplification using either KOD polymerase (710864, ​​Sigma-Aldrich) or KOD Xtreme (KODX) polymerase (719753, Sigma-Aldrich). Other commercially available polymerases can also be used. The product versions used were separated into their components rather than purchased as a master mix to ensure an accurate ratio of modified nucleotides to standard dNTPs. PCR reaction conditions for each enzyme included:

[0689] a. For KOD enzyme, final concentration is 2 mM MgSO4.

[0690] b. 100 mM dNTP solution group (N0446, New England Biolabs), the final concentration was 200 μM.

[0691] c. Modified deoxynucleoside triphosphates (e.g., 5-formyl-dCTP, N-2064, Trilink Biotechnologies) are added in varying ratios with their cognate dNTPs, totaling 200 μM (i.e., 200 μM dATP, 200 μM dCTP, 200 μM dTTP, and 200 μM dGTP). Thus, a reaction designed for 25% incorporation would be 50 μM modified nucleotides and 150 μM unmodified nucleotides.

[0692] d. The final concentration of forward and reverse primers was 300 μM.

[0693] For the synthesis of covalently blocked TDSCs, primers contained either a phosphate group or a TelN recognition sequence for increased ligation efficiency.

[0694] For the synthesis of circular double-stranded DNA forms, in addition to sequences complementary to the plasmid, the primers contain other sequences useful in downstream processes:

[0695] a. one or more recognition sequences for nickases;

[0696] b. a restriction enzyme recognition sequence (e.g., BsaI, KpnI, or NheI) for generating sticky ends in DNA after restriction enzyme digestion and promoting DNA circularization; and

[0697] c. Additional bases (eg, 5'-CCGTGGTCCTTC-3') (SEQ ID NO: 40) to improve restriction enzyme digestion efficiency.

[0698] For all formats, PCR products were purified using standard DNA purification columns.

[0699] Figure 8Describe the generation of covalently closed TDSCs with end forms comprising thiophosphate modifications.For TDSCs with end forms comprising thiophosphate modifications (thiophosphate end forms), each reaction adds up to 10 μg of 50 μL PCR DNA to NEBNext Ultra II end repair / dA-tailing buffer (8 μL) and enzyme (3 μL) mixture (E7546L), and first at 20 ° C for 30 min, then at 65 ° C for 30 min.After short cooling on ice, NEBNextUltra II connection module components are added, which include connection mixture (30 μL), connection enhancer (1 μL) and 3 μL containing 100 μM solution of DNA adapter to be connected. The reaction is incubated for>1 hour, but usually overnight.Then the PCR-adapter solution connected is purified by Nucleospin Midi column, quantified by Nanodrop, and any unconnected PCR is purified at 37 ° C for one hour using ExoIII (NEB M0206).

[0700] Fig. 9 Depicted is the production of covalently blocked TDSCs with TelN terminal forms. For TDSCs with TelN terminal forms, 1 μg of PCR DNA was incubated in a 40 μL reaction containing 4 μL 10x ThermoPol buffer, 2 μL TelN protelomerase (M0651, New England Biolabs) at 30°C for 1 hour. TelN-modified DNA was then purified by Zymo DCC-100 columns, quantified by Nanodrop, and any unmodified PCR was cleaned up using ExoIII (NEB M0206) at 37°C for one hour.

[0701] Fig.10 Depicted is the production of circular dsDNA molecules. To synthesize circular dsDNA molecules, DNA is digested using a restriction enzyme corresponding to the restriction enzyme recognition sequence, such as KpnI-HF-V2 (R3142, New England Biolabs) in an overnight reaction. The DNA is then purified using a DNA purification column. The digested DNA is circularized using T3 DNA ligase (M0317, New England Biolabs) at 26°C for one hour. Non-circularized DNA is degraded by incubating the DNA with T5 exonuclease (M0663L, New England Biolabs) at 37°C for one hour. T5 exonuclease is used to digest linear dsDNA, but not circular dsDNA. DNA is purified using a DNA purification column. Other similar methods, such as agarose gel purification, may also be used.

[0702] The composition and purity of the resulting dsDNA forms were analyzed on an Agilent 5300 fragment analyzer using the CRISPR Discovery kit (DNF-930-K1000CP). dsDNA injection buffer and electrophoresis gels with embedding dye were prepared fresh daily, while labeling trays with mineral oil overlays and capillary conditioning solutions were prepared fresh monthly. Buffers were prepared according to the manufacturer's specifications. Circular dsDNA samples were diluted with water to a final concentration of 100 pg / uL. For each sample well, 2uL of DNA sample was added to 22uL of dilution buffer (0.1X TE), and 2-4 replicates were run for each sample, with one well for the MDK DNA ladder. Samples were run through the instrument controller software using the default settings of the CRISPR Discovery method (CRP-910-33).

[0703] Sample traces were analyzed using ProSize Data Analysis Software v4.0.2.7. Peak analysis conditions for dsDNA were set to 5 for "Peak Width (sec)", 50 for "Minimum Peak Height (RFU)", 3 for "Extra Valley Points", and "Baseline Between Valleys" on. Manual baseline was set to -2 min from the lower marker and +2 min from the upper marker. Under these conditions, peaks were automatically detected by the software and peak widths were selected by the software, except for cases where manual adjustments were required due to broad peaks, shoulders, or multiple peaks in a narrow size range.

[0704] Figure 11-13 Fragment Analyzer traces of dsDNA forms with 5' cytosine modifications are shown. Fig.11 Shown is a circular dsDNA construct produced in a reaction using 25% 5-formylcytosine and purified as described above. Figure 12-13 shows a phosphorothioate terminal form ( Fig.12 ) and TelN-terminal form ( Fig.13 ) was produced in a reaction using 25% 5-formylcytosine and purified as described above. In each trace, a single peak (indicated by an arrow) is clearly visible. These results show that a variety of TDSC forms can be produced and purified, including those containing chemically modified nucleotides (e.g., 5-formylcytosine).

[0705] Example 16: Evaluation of TDSC gene expression in vitro

[0706] This example demonstrates the use of chemically modified TDSCs to detect and quantify gene expression in cultured cells.

[0707] Experimental constructs and controls were administered via lipid transfection (liposome transfection). DNA lipid transfection was performed in HEKa cells using Lipofectamine3000 transfection reagent (#L3000001, Thermo Fisher Scientific) according to the manufacturer's instructions. All DNA constructs and controls used a 1:2:3 ratio of DNA:P3000:Lipofectamine3000. One day before transfection, 10,000 cells were pre-seeded into each well of a 96-well plate. Transfection was performed when cells reached approximately 80% to 90% confluence. For each well of a 96-well plate, 3XLipofectamine3000 was first added to 5uL Opti-MEM TM Dilute in Opti-MEM I Reduced Serum Medium (#31985070, Thermo Fisher Scientific). Use 2X P3000 reagent in 5uL Opti-MEM TM I reduced serum medium. Then the DNA was added to TM I low serum medium Lipofectamine3000, and gently mix by pipetting. After incubation at room temperature for 15 minutes, the DNA-Lipofectamine3000 complex is added dropwise to different areas of the well containing the target cells in complete medium. Gently shake the plate back and forth and left and right to evenly distribute the DNA-Lipofectamine3000 complex. After transfection, incubate the cells in a CO2 tissue culture incubator and replace the medium 6 to 8 hours after transfection.

[0708] To determine the expression of the construct encoding the fluorescent reporter mCherry, cells were first washed with PBS before flow cytometry analysis. All flow cytometry was performed on the MACSQuant VYB of Miltenyi. To detect the mCherry signal, a yellow laser (wavelength 561nm) was used for excitation, and a 615 / 620nm emission filter was used. 20,000 events were recorded for each sample, and the data were analyzed using Flowjo V.9.0 software. Cells were first gated on FSC-A and SSC-A graphs to remove cell debris. The population was further plotted on FSC-A and FSC-H graphs to limit single cell populations. Finally, the percentage of expressing cells was determined using a bivariate graph between fluorescent signal expressing cells and non-expressing cells. The distribution of expressing cells was used to determine the expression level in each cell. Expression analysis was performed at multiple time points.

[0709] Figures 14A-14BIt is shown that multiple TDSC constructs produced with or without chemical modification can express reporter genes. In HEKa cells, dsDNA with three different structures (circular double strands, covalently blocked TDSC with thiophosphate terminal form and covalently blocked TDSC with TelN terminal form) produced detectable expression of reporter protein mCherry. As described in Example 15, DNA molecules in which deoxycytosine is at least partially replaced by 5-formylcytosine also retain function, as defined by similar ratios of cells expressing mCherry. These results show that TDSC with different terminal forms can also be transcribed and produce protein products even after chemical modification.

[0710] Example 17: Evaluation of the effects of TDSCs on innate immune responses in cells in vitro.

[0711] This example describes the effects of chemically modified dsDNA constructs (eg, TDSC) on the innate immune response of cultured cells.

[0712] Experimental constructs were prepared as in Example 15 above and then applied to cells as in Example 16 above. qPCR was performed on cells to determine the RNA levels of a panel of proinflammatory cytokines, including human IFNL1, CXCL8, TNF, IL17B, IL6, IFNB1, CCL2, IL23, IL17E, CXCL10, CXCL1, CCL5, IL1B, IL5, IL33, IL1A, CXCL2, IL17C, and IL18. Human GAPDH was used as an endogenous control for analysis. Primer sequences can be found in Appendix 4. Briefly, mRNA was extracted from cells using the PicoPure RNA Isolation Kit (Thermo Fisher Scientific #KIT0204) according to the manufacturer's instructions. RNA to cDNA EcoDry TM cDNA was synthesized using the Premix (oligo dT) (Takara #639542) kit. Analysis was performed using the QuantStudio7 Flex Real-Time PCR System and the SYBR Select Master Mix from Life Technologies Corporation. RNA expression was normalized to GAPDH and expressed as fold change relative to the method control (lipofection reagent without DNA).

[0713] Table 4. Primer sequences used for qPCR quantification of immune markers.

[0714]

[0715]

[0716]

[0717] Figures 15A-15C and 16A-16C show HEKa ( Figures 15A-15C ) and THP1 cells ( Figures 16A-16C ) to the innate immune response of TDSCs produced with or without 5-formylcytosine. In HEKa and THP1 cells, dsDNA with three different structures (circular double strands, linear TDSCs with thiophosphate terminal forms, and linear TDSCs with TelN terminal forms) produced a measurable innate immune response, as defined by the detectable expression of cytokines IFNB, CXCL10, and IL6. For covalently blocked TDSCs, partially replacing cytosine with 5-formylcytosine reduced the immune response in HEKa and THP1 cells, as defined by reduced expression of IFNB, CXCL10, and IL6. These results show that the terminal structure of TDSCs and the presence of chemical modifications (e.g., 5-formylcytosine) can affect the innate immune response to double-stranded DNA while retaining the ability to encode functional protein products.

[0718] Fig.17 The innate immune response of HEKa cells to covalently blocked TDSCs with phosphorothioate terminal adapters and various modifications at the carbon 5 (C-5) position of cytosine is shown. For each differently chemically modified dsDNA molecule, the innate immune response is visualized as a scatter plot, where the X-axis represents the reduction in interferon signaling, defined as the average fold change reduction of markers IFNB and CXCL10 relative to TDSCs containing unmodified cytosine, and where the Y-axis represents the reduction in inflammatory cytokine signaling, defined as the average fold change reduction of markers IL6 and TNFa relative to TDSCs containing unmodified cytosine. These results indicate that incorporation of specific chemical modifications at the C-5 position of cytosine in TDSCs can reduce the innate immune response to dsDNA in immunocompetent cell lines.

[0719] All publications, patents, and patent applications cited herein are incorporated by reference in their entirety to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. In the event of a conflict in a terminology herein and that of an incorporated reference, the terminology herein controls.

Claims

1. A TDSC comprising: a) upstream DNA end form, which is a closed end; b) double-stranded region; c) downstream DNA end form, which is a closed end, wherein the TDSC comprises one or more chemically modified nucleotides, The one or more chemically modified nucleotides comprise chemically modified cytosine nucleotides and / or phosphorothioate bonds. 2 . The TDSC of claim 1 , wherein one or both of the upstream DNA end form and the downstream DNA end form comprise a loop. 3 . The TDSC according to claim 1 , wherein the upstream DNA end form, the downstream DNA end form and / or the double-stranded region comprises one or more chemically modified nucleotides.

4. The TDSC of any one of claims 1-3, wherein one or more of the chemically modified nucleotides are conjugated to a peptide or a protein.

5. The TDSC of any one of claims 1-4, wherein one or more of the chemically modified nucleotides comprises a phosphorothioate bond. 6 . The TDSC according to claim 1 , wherein the first strand and the second strand of the TDSC each comprise one or more chemically modified nucleotides.

7. The TDSC of any one of claims 1 to 6, wherein the first strand and the second strand of the TDSC each comprise one or more phosphorothioate bonds.

8. The TDSC of any one of claims 1-7, wherein the upstream and / or downstream DNA end forms each comprise at least 1, 2, 3, 4, 5 or 6 phosphorothioate bonds (e.g., between 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 terminal nucleotides of the upstream and downstream DNA end forms, e.g., on the first strand, on the second strand, or on both the first strand and the second strand).

9. The TDSC of any one of claims 1-8, wherein the one or more chemically modified nucleotides comprise chemically modified cytosine nucleotides.

10. The TDSC of claim 9, wherein the chemically modified cytosine nucleotide has a substitution other than hydrogen at carbon 5 of the cytosine.

11. The TDSC according to any one of claims 1 to 10, comprising one or more of the following: i) a promoter sequence (wherein optionally, the promoter sequence is located in the double-stranded region); ii) a payload sequence (e.g., a therapeutic payload sequence) operably linked to the promoter sequence (wherein optionally, the payload sequence is located in the double-stranded region); iii) heterologous functional sequences, such as nuclear targeting sequences or regulatory sequences; iv) maintaining the sequence; and / or v) Origin of replication.

12. The TDSC of claim 11, wherein the cargo sequence encodes a polypeptide (eg, a protein).

13. The TDSC of claim 11 or 12, wherein the cargo sequence encodes a functional RNA (eg, miRNA, siRNA or tRNA).

14. The TDSC of any one of claims 11-13, wherein the cargo sequence is heterologous to the target cell.

15. The TDSC according to any one of claims 1 to 14, wherein the TDSC is resistant to endonuclease digestion and / or resistant to immunosensor recognition.

16. The TDSC according to any one of claims 1 to 15, wherein the upstream DNA end form and the downstream DNA end form have the same nucleotide sequence.

17. The TDSC according to any one of claims 1 to 15, wherein the upstream DNA terminal form and the downstream DNA terminal form have different nucleotide sequences.

18. The TDSC of any one of claims 1-17, wherein one or both of the upstream exonuclease-resistant DNA end form and the downstream exonuclease-resistant DNA end form comprise a hairpin.

19. The TDSC of any one of claims 1-18, wherein the blocked end comprises one or more (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, or 50) unhybridized (e.g., not part of a double-stranded region) nucleotides.

20. The TDSC of any one of claims 1-17, wherein the blocked end does not contain any unhybridized nucleotides (eg, wherein all nucleotides of the blocked end are hybridized to another nucleotide).

21. The TDSC of any one of claims 1-20, wherein the upstream DNA end form, the downstream DNA end form, or both comprise a protelomerase sequence.

22. The TDSC of any one of claims 1-20, wherein the upstream DNA end form, the downstream DNA end form, or both do not comprise a protelomerase sequence.

23. The TDSC of any one of claims 1-22, wherein 80%, 85%, 90%, 95%, 98%, 99% or 100% of the sugars of the TDSC are deoxyribose.

24. The TDSC of any one of claims 1-23, wherein the TDSC is capable of being replicated (eg, by a DNA polymerase native to the cell comprising the TDSC).

25. The TDSC of any one of claims 1-23, wherein the TDSC cannot be replicated.

26. The TDSC of any one of claims 1-25, wherein the TDSC is linear and capable of cyclization.

27. The TDSC of any one of claims 1-25, wherein the TDSC is linear and cannot be cyclized.

28. The TDSC of any one of claims 1-27, wherein the TDSC or a portion thereof is capable of integrating into the genome.

29. The TDSC of any one of claims 1-27, wherein the TDSC or a portion thereof is incapable of integrating into the genome.

30. The TDSC of any one of claims 1-29, wherein the TDSC is capable of multimerization.

31. The TDSC of any one of claims 1-29, wherein the TDSC is incapable of multimerization.

32. A TDSC comprising: a) upstream exonuclease-resistant DNA end forms; b) a double-stranded region; and c) downstream exonuclease-resistant DNA end forms, The TDSC comprises one or more chemically modified nucleotides.

33. The TDSC of claim 32, wherein one or both of the upstream exonuclease-resistant DNA end form and the downstream exonuclease-resistant DNA end form are open ends.

34. The TDSC of claim 32 or 33, wherein one or both of the upstream exonuclease-resistant DNA end form and the downstream exonuclease-resistant DNA end form are blunt ends or sticky ends.

35. A TDSC comprising: a) an upstream double-stranded blunt-ended DNA end form (e.g., an upstream exonuclease-resistant DNA end form that is a double-stranded blunt end) comprising a phosphorothioate modification on each strand; b) a double-stranded region; and c) a downstream double-stranded blunt-ended DNA end form (eg, a downstream exonuclease-resistant DNA end form that is a double-stranded blunt end) comprising a phosphorothioate modification on each strand.

36. A TDSC comprising: a) upstream exonuclease-resistant DNA end forms; b) double-stranded region; c) downstream exonuclease-resistant DNA end forms, wherein one or both of the upstream exonuclease-resistant DNA end form and the downstream exonuclease-resistant DNA end form comprise a Y-adapter configuration, Optionally, wherein the TDSC comprises one or more chemically modified nucleotides.

37. A TDSC comprising: a) upstream exonuclease-resistant DNA end forms; b) double-stranded region; c) downstream exonuclease-resistant DNA end forms, One or both of the upstream exonuclease-resistant DNA end form and the downstream exonuclease-resistant DNA end form comprise one or more of the following: a nuclear targeting sequence, a maintenance sequence, or a sequence that binds to an endogenous polypeptide in a target cell.

38. A TDSC comprising: a) upstream exonuclease-resistant DNA end forms; b) double-stranded region; c) downstream exonuclease-resistant DNA end forms, Wherein one or both of the upstream exonuclease-resistant DNA end form and the downstream exonuclease-resistant DNA end form have one or more of the following characteristics: i) does not comprise the nucleic acid sequence TATCAGCACACAATTGCCCATTATACGC (SEQ ID NO:55) and GCGTATAATGGGCAATTGTGTGCTGATA (SEQ ID NO:56), or a nucleic acid sequence having at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence identity thereto; and / or the nucleic acid sequence TATCAGCACACAATAGTCCATTATACGC (SEQ ID NO:57) and GCGTATAATGGACTATTGTGTGCTGATA (SEQ ID NO:58); ii) each nucleotide in the TDSC binds to another nucleotide in the TDSC; iii) the upstream exonuclease-resistant DNA end form has a loop size of less than about 28 or 56 nucleotides in length or greater than about 28 or 56 nucleotides in length; or iv) the downstream exonuclease-resistant DNA end form has a loop size of less than about 28 or 56 nucleotides in length or greater than about 28 or 56 nucleotides in length.

39. A pharmaceutical composition comprising a double-stranded DNA (dsDNA) comprising an effector sequence, wherein: a) the dsDNA lacks a vector backbone or lacks material portions of a vector backbone, or does not contain a non-human (e.g., bacterial) origin of replication; b) the dsDNA is unencapsidated, substantially free of viral proteins, does not contain viral packaging signals, or does not contain viral ITRs; c) the dsDNA comprises exonuclease-resistant ends; and d) the dsDNA comprises at least one chemically modified nucleotide.

40. A pharmaceutical composition comprising the TDSC according to any one of claims 1-38.

41. The pharmaceutical composition of claim 39 or 40, wherein the dsDNA or TDSC is contained in a lipid nanoparticle (LNP).

42. A raw TDSC, comprising: a) upstream exonuclease-resistant DNA end forms; b) double-stranded region; c) downstream exonuclease-resistant DNA end forms, in: (i) the proto-TDSC comprises one or more (e.g., 1 or 2) uracil nucleotides, or (ii) the upstream exonuclease-resistant DNA end form comprises a sticky end, and / or wherein the downstream exonuclease-resistant DNA end form comprises a sticky end.

43. A method for expressing a heterologous cargo in a target cell, the method comprising: (i) introducing the TDSC or the composition according to any one of claims 1 to 41 into a target cell, wherein the double-stranded region of the TDSC comprises a sequence encoding a heterologous cargo; and (ii) maintaining (e.g., incubating) the cells under conditions suitable for expression of the heterologous cargo from the TDSCs; The heterologous cargo is thereby expressed in the target cell.

44. A method for delivering a heterologous cargo to a target cell, the method comprising: introducing the TDSC or composition of any one of claims 1 to 41 into a target cell, wherein the double-stranded region of the TDSC comprises a sequence encoding a heterologous cargo; The heterologous cargo is thereby delivered to the target cell.

45. A method of modulating (e.g., increasing or decreasing) a biological activity in a target cell, the method comprising: (i) introducing the TDSC or composition of any one of claims 1 to 41 into a target cell, wherein the double-stranded region of the TDSC comprises a sequence encoding a heterologous cargo that modulates a biological activity in the target cell; and (ii) maintaining (e.g., incubating) the cells under conditions suitable for expression of the heterologous cargo from the TDSCs; Thereby modulating the biological activity in the target cell.

46. ​​A method of treating a cell, tissue or subject in need thereof, the method comprising: administering to the cell, tissue or subject the TDSC or composition of any one of claims 1-41, wherein the double-stranded region of the TDSC comprises a sequence encoding a heterologous cargo; The cell, tissue or subject is thereby treated.

47. A method for preparing a TDSC, the method comprising connecting: Double-stranded DNA molecules a self-annealing DNA molecule comprising a first region and a second region, wherein the first region hybridizes to the second region; Thus, TDSC is generated. Optionally, wherein the self-annealing DNA molecule further comprises a loop between the first region and the second region.

Images