Analysis of RNA modification

Abstract

In various aspects, the invention provides a method of detecting nucleotide modifications in a sample comprising RNA, the method comprising reacting RNA in the sample with periodate to form periodate-treated RNA in the sample, sequencing the periodate-treated RNA in the sample, and detecting a modification signature in the sequence.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims priority to U.S. Provisional Patent Application No. 63 / 338,160, filed on May 4, 2022, the disclosure of which is incorporated herein by reference in its entirety.

[0003] STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT

[0004] This invention was made with government support under Grant No. NIH RM1HG008935 awarded by the National Institutes of Health and Grant No. BC191198 awarded by the Congressionally Directed Medical Research Programs of the Department of Defense. The government has certain rights in this invention.

[0005] Incorporation by Reference of Electronically Submitted Materials

[0006] Incorporated herein by reference in its entirety is a computer-readable nucleotide / amino acid sequence listing filed concurrently with the present application and identified as follows: a 66,294-byte extensible markup language (xml) file named "767182_SequenceListing.xml," created on May 3, 2023, with a final creation date of May 4, 2023.

[0007] background

[0008] Queuosine (Q) is a 7-deaza-7-aminomethyl-cyclopentenediol derivative present in the wobble anticodon position (position 34 in tRNA nomenclature) of tRNAs for Tyr, His, Asn, and Asp. Unique among the approximately 50 modifications of human RNA, queuosine tRNA modifications are synthesized de novo in bacteria, whereas in mammals, the substrate for the Q modification of tRNA is queuine, a catabolite of the Q base of enteric bacteria. Q34 is known to enhance decoding speed, regulate decoding accuracy in translation, and regulate tRNA fragment biosynthesis.

[0009] Currently, methods for detecting and quantifying Q modifications in tRNA include radioactive guanine exchange, liquid chromatography-mass spectrometry (LC / MS), acrylamidophenylboronic acid (APB), or acid denaturing gel electrophoresis.

[0010] New methods are needed to detect Q modifications and other modifications in tRNA.

[0011] Brief Overview

[0012] In various aspects, the present disclosure provides a method for detecting nucleotide modifications in a sample containing RNA, the method comprising: reacting the RNA in the sample with periodate to form periodate-treated RNA in the sample, sequencing the periodate-treated RNA in the sample, and detecting modification features in the sequence.

[0013] Additional aspects are described herein. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 depicts Q modification in tRNA and shows a gel and sequencer plot demonstrating that Q modification produces a deletion signature following periodate treatment. Figure 1A The chemical structures of the Q base and its putative periodate-oxidized form are depicted. Figure 1B Depicted is a Northern blot of an APB gel showing tRNAs from cells cultured in 0Q and 100Q medium Asn and tRNA His Q modification levels in samples. "Q" indicates tRNA with quercetin modification, and "G" indicates tRNA without quercetin modification. The shift in gel migration distance seen for Q-modified tRNA is caused by the reaction of the Q base with the boronic acid derivative used in the APB gel. Figure 1C Figure 2 shows the tRNA expression in samples from 0Q and 100Q under ± periodate treatment conditions. His A graph showing the deletion fractions found in cDNA sequences of . Figure 1D The region ±5 nt (nucleotides) of Q34 residue (vertical dashed line) is depicted. Figure 1C Magnification of the graphs shown. Biological replicates are superimposed in each graph. Only the most abundant tRNAs are shown His Data from isodecoder. N1-methylguanosine (m1G) at position 37 is another known modification that produces the deletion feature seen in the figure. Figure 1E Depicted is a graph characterizing the proportion of mutations, insertions, and terminations detected in the ±5 nt region of residue Q34 using the same samples shown in panel 1C.

[0016] Figure 2 depicts graphs showing periodate treatment-dependent deletion signatures in cDNA prepared from tRNA. These graphs are relative to Figure 1CThose shown have an expanded scale and show the region of ±5 nt of the Q34 residue (dashed line) in each tRNA. Biological replicates are superimposed in each figure. For nuclear-encoded tRNAs, only data for the most abundant isoencoders for Asn / Tyr / Asp are shown. All residue numbers are according to standard tRNA nomenclature, i.e., the wobble anticodon nucleotide designates position 34. The tRNAs that show their Q modification missing characteristics are: Figure 2A , nuclear-encoded tRNA Asn ; Figure 2B , mitochondrial encoded tRNA His ; Figure 2C , mitochondrial encoded tRNA Asn and Figure 2D , mitochondrial encoded tRNA Tyr In addition to the missing Q modification signature, several tRNAs also have known modifications at position 37. 2 i 6 Missing features are shown at A. Mitochondrial encoded tRNA Asp ms 2 i 6 A missing feature is shown in Figure 2E In the nuclear-encoded tRNA Tyr ms 2 i 6 A missing feature is shown in Figure 2F Another known modification that also produces a deletion feature is m1G at position 37, such as Figure 2G Nuclear-encoded tRNA Asp The periodate-independent deletion signature at position 37 is of unknown origin.

[0017] Figure 3 provides additional information about the Q-modified tRNAs used in the experiments whose results are shown in Figures 1 and 2. In the figure, a gap was introduced in the sequence to enable alignment at wobble position 34 and maximize sequence conservation. Figure 3A The sequences of Q-modified nuclear-encoded and mitochondrial-encoded tRNAs are shown as their cDNA sequences, respectively. The anticodon nucleotides are shown in bold, and the ±5 nt region at position 34 is underlined. Figure 3B The five tRNAs with the highest expression levels in HEK293T cells are shown Asn Sequences of iso-decoders. In the most highly expressed iso-decoders, the anticodon nucleotide is shown in bold and the ±5 nt region is underlined. Sequence differences between iso-decoders are shown as single nucleotides in bold. Figure 3C These are the five tRNAs that showed the highest expression levels in HEK293T cells AsnFigure 11-15 corresponds to the abundance of iso-decoders. Figure 3B tRNA sequences in . Each symbol corresponds to a biological replicate that was sequenced separately.

[0018] Figure 4 depicts a diagram showing the nuclear encoded tRNA His and tRNA Asn Figure 3 is a graph of the quantitative assessment of the level of Q modification detected in tRNAs. The region ± 3 nt of the Q34 residue (dashed line) in each tRNA is shown. Figure 4A The tRNAs found for 11 calibration samples prepared as described in the method of Example 1 are shown. His Overlay of the detected missing ratios of the 11 calibration samples premixed with decreasing ratios of 0Q and increasing ratios of 100Q RNA. Figure 4B Shows the Figure 4A The 11 calibration samples prepared described above revealed tRNA Asn Superposition of the missing proportions of the tests. Figure 4C It shows that the deletion ratio at Q34 can be fitted to the equation log2y=a+bx, where a is the intercept and b is the slope. His The curve has a fit of a = -7.0, b = 0.023 and r2 = 0.964. tRNA Asn The curve has a fit of a = -6.0, b = 0.025 and r2 = 0.985. Figure 4D The five tRNAs expressed at the highest levels are shown Asn Q modification levels found in iso-decoders. Each symbol corresponds to a biological replicate sequenced individually.

[0019] Figure 5 depicts a graph and plot showing analysis of periodate treatment-dependent 2-thio tRNA modifications in biological samples without Q modification (denoted as OQ). All residue numbering is according to standard tRNA nomenclature, i.e., the wobble anticodon nucleotide is at position 34. Figure 5A The chemical structures of the 2-thio modifications found in tRNA and their putative periodate-oxidized forms are shown. Figure 5B -D shows the mutation and deletion characteristics seen in the ±5nt region of the relevant residue (dashed line) in each human tRNA. The sample is OQ, and the results with (solid line) and without (dashed line) periodate treatment are shown. Biological replicates are superimposed in each figure. Figure 5B The results show that the target site is known to contain 5-taurinomethy-2-thio-U (τm 5 s 2 U) Ratio of mutations and deletions seen in the indicated mitochondrial encoded tRNAs. Figure 5C The results show that the target site is known to contain 5-taurine methyl-U (τm 5 U) Ratio of mutations and deletions seen in the indicated mitochondrial encoded tRNAs. Figure 5D The results show that the target of the known 5-methoxycarbonylmethyl-2-thio-U (mcm 5 s 2 The ratio of mutations and deletions seen in the nuclear encoded tRNAs shown in Figure 34. Another known modification that also produces a characteristic is the Arg N3-methylcytosine (m3C) found at position 32 of (TCT). Figure 5E Shown are tRNAs with and without periodate treatment. Arg (TTC), tRNA Gln (TTG) and tRNA Glu (TTC) mcm for co-worker decoder 5 s 2 U34 mutation rate and abundance. Each symbol corresponds to a biological replicate that was sequenced individually.

[0020] FIG6 depicts a graph and diagram showing analysis of periodate treatment-dependent 2-thio tRNA modifications in a biological sample with Q modification (denoted 100Q). All residue numbering is according to standard tRNA nomenclature, i.e., the wobble anticodon nucleotide is at position 34. The sample contained Figure 5A The same 2-thio modification as depicted in FIG. Fig. 6A -B shows the mutation and deletion signatures seen in the ±5nt region of the relevant residue (dashed line) in each human tRNA. The sample is 100Q with (solid line) and without (dashed line) periodate treatment. Biological replicates are superimposed in each figure. Fig. 6A The results show that the target site is known to contain 5-taurinemethyl-2-thio-U (τm 5 s 2 U) The proportion of mutations and deletions seen in the indicated mitochondrial encoded tRNAs. Figure 6B The results show that the target of the known 5-methoxycarbonylmethyl-2-thio-U (mcm 5 s 2 (U) Ratio of mutations and deletions seen in the indicated nuclear-encoded tRNAs of 34. Figure 6C Shown are tRNAs with and without periodate treatment. Arg (TCT), tRNA Gln (TTG) and tRNA Glu (TTC) mcm for co-worker decoder 5 s 2U34 mutation rate and abundance. Each symbol corresponds to a biological replicate that was sequenced individually.

[0021] Figure 7 Depicts mcm as a DNA sequence 5 s 2 Sequences of U34-modified human tRNA isodecoders. In the isodecoders expressed at the highest level for each tRNA, the anticodon nucleotides are shown in bold and the ±5nt region is underlined. Sequence differences between isodecoders are shown as scattered nucleotides in bold.

[0022] Figure 8 depicts a graph and a diagram showing 2-thio tRNA modifications in E. coli tRNA and their response to stress. Shown are mutation and deletion signatures in the ±5nt region from the relevant residue (dashed line) in each tRNA. Fig. 8A The chemical structures of the 2-thio modifications found in tRNA and their putative periodate-oxidized forms are shown. Figure 8B The results show that the target protein is known to contain 5-carboxymethylaminomethyl-2-thio-U (cmnm 5 s 2 (U) The proportion of mutations and deletions found for the indicated tRNAs of 34. Figure 8C The results show that the 32-thio-C(s 2 C) shows the ratio of mutations and deletions found in the tRNAs shown. Another known modification that also produces sequence features is tRNA Arg I34 in (ACG). Fig.8D The results show that the 4-thio-U(s 4 U) His Proportions of mutations and deletions found. Fig. 8E Shows the content of s 2 Response of C32-modified Escherichia coli tRNA to exposure to the stressors 2,2'-bipyridyl (DIP), hydrogen peroxide (H2O2), and methyl α-D-pyranoglucopyranoside (αMG). Biological replicates are shown in each figure. ***: p < 10-3, ns: not significant. The x-axis shows the type of stressor ("none" corresponds to no stressor), and the y-axis shows the expression of s 2 Differences in the mutational signatures of each E. coli tRNA modified with C32.

[0023] Fig. 9 The cmnm-containing cells exposed to the stressors 2,2'-bipyridyl (DIP), hydrogen peroxide (H2O2) and methyl α-D-pyranoglucopyranoside (αMG) 5 s 2 U34 tRNA Gln(TTG) and tRNA Glu (TTC) stress response of Escherichia coli. The x-axis shows the type of stressor (“none” corresponds to no stressor), and the y-axis shows the concentration of cmnm 5 s 2 Differences in the mutational signatures of all E. coli tRNAs modified with U34.

[0024] Fig.10 The abundance of microbial 5S rRNA from different bacterial taxa at the class level is shown. Libraries were constructed for the same human fecal sample under the following four treatment conditions: # without periodate and without demethylase; square with periodate and without demethylase; circle without periodate and with demethylase; * with periodate and with demethylase.

[0025] Figure 11 depicts the Fig.11A Absence ratio of tRNA Q modifications found in reference sequences for the indicated species. Fig.11A The proportion of deletions at nucleotide position 34 (the wobble position in the tRNA anticodon) for four bacterial classes is shown. Sequence reads were performed under the following treatments: # without periodate, squares with periodate. Fig. 11B Shown are the deletion ratios in the region of + / - 5 nucleotides around position 34 of the Q-modifiable tRNA in Roseburia. Sequencing was performed with (solid line) and without (dashed line) periodate treatment.

[0026] Fig.12 Depicted are the s surrounding tRNA position U34 found in reference sequences from the indicated bacterial species. 2 U modification. Sequencing was performed with (solid line) and without (dashed line) periodate treatment.

[0027] Fig.13 Depicted are the s surrounding tRNA position C32 found in reference sequences from the indicated bacterial species. 2 C32 modification. In the specific microorganisms studied, some tRNAs corresponding to the anticodons are not present, and therefore their sequences are not available. For example, there is no tRNA in C. beijerinckii or L. phylofermentans Arg (CCG). Sequencing was performed with (solid line) and without (dashed line) periodate treatment.

[0028] Fig.14 Depicted are the s surrounding tRNA position C34 found in reference sequences from the indicated bacterial species. 2C34 modification. In the specific microorganism studied, some tRNAs corresponding to the anticodons are not present, and therefore their sequences are not available. For example, there is no tRNA in C. maltaromaticum or Clostridium beijerinckii. Pro (CGG). Sequencing was performed with (solid line) and without (dashed line) periodate treatment.

[0029] Details

[0030] In various aspects, the present disclosure provides a method for detecting nucleotide modifications in a sample comprising RNA, the method comprising: reacting the RNA in the sample with periodate to form periodate-treated RNA in the sample, sequencing the periodate-treated RNA in the sample, and detecting the modification characteristics in the sequence. In various aspects, the method also includes performing a control sequencing reaction on a portion of the RNA from the sample, wherein the control sequencing reaction is performed on RNA that has not been treated with periodate. In various aspects, the nucleotide modification is (a) substitution with a quenching glycoside (Q modification), or (b) substitution of an oxygen atom at position 2 of a pyrimidine nucleotide with a sulfur atom (2-thio modification).

[0031] In various aspects, nucleotide modifications are detected as the presence of mutational signatures or deletion signatures in the sequence. As used herein, "signature" refers to unique base misincorporation (mutation) caused in nucleic acid sequencing by base modification itself or its derivatives produced by various chemical or enzymatic treatments. A signature can be a deletion, insertion, or termination in RNA-seq data. A signature is generated when the reading mechanism of the reverse transcriptase encounters a unique chemical structure modified in the template RNA.

[0032] In various aspects, the nucleotide modification is a Q modification. Q is a 7-deaza-7-aminomethyl-cyclopentenediol derivative present in the wobble anticodon position (position 34 in tRNA nomenclature) of tRNA for the amino acids Tyr, His, Asn, and Asp (see Figure 1A , Q34). The guanine tRNA modification is synthesized de novo in bacteria, while in mammals, the substrate for the Q modification in tRNA is quinine, which is a catabolite of the Q base of enteric bacteria. Among the four tRNAs, the G34 guanine base is replaced with quinine by a two-component enzyme encoded in the mammalian genome to produce the Q-modified tRNA. Q34 is known to enhance decoding speed, regulate decoding accuracy in translation, and regulate tRNA fragment biosynthesis.

[0033] In mammals, the intestinal availability of quinine affects the virulence of resident gut microbes and regulates cancer growth. Levels of Q modifications in tRNA are particularly high in human brain tissue, and quinine plays a role in resistance to cancer metabolism and neuronal damage. Because quinine must be cleared from the intestine and Q-tRNA modifications are directly involved in protein biosynthesis, quinine and Q-tRNA modifications provide a clear link between the gut microbiome and host protein homeostasis.

[0034] Current methods for detecting and quantifying Q modifications in tRNAs have limitations. Guanine exchange has only been used to quantify total Q levels in all tRNAs. LC / MS can accurately analyze Q modifications in individual tRNAs, but it requires large amounts of input material and has difficulty quantifying Q ratios. Gel electrophoresis methods can quantify Q modifications in individual tRNAs, but still require micrograms of total RNA and are only performed on one tRNA species at a time. In addition, neither LC / MS nor gels have sufficient resolution to study tRNA isodecoders in mammals. The term "isodecoders" refers to tRNA sequences that share the same anticodon but have different main body sequences of the tRNA.

[0035] In various aspects, the presence of a deletion feature in the sequence of the Q modification site is detected. In various aspects, the periodate treated RNA is sequenced using high throughput DNA sequencing.

[0036] High-throughput (also known as Nextgen or depth) DNA sequencing has become a versatile tool for studying many RNA modifications. Various DNA sequencing instruments and platforms are commercially available. The preferred system for performing DNA sequencing is the NGS (Next Generation Sequencing) system of Illumina, Inc. When RNA is sequenced using DNA sequencing, RNA is used as a template for a reverse transcriptase that produces a cDNA copy of the template RNA. Any suitable reverse transcriptase (RT) can be used, for example, TGI RT, AMV RT, ThermoScript TM RT (Invitrogen TM )、MMLV RT、SuperScript TM IV RT (Invitrogen TM ) etc. In various aspects, the reverse transcriptase can be SuperScript TM IVRT (Invitrogen TM ).

[0037] The modification signature is found in the DNA copy of the RNA template produced by reverse transcriptase. The RNA sequence can be reported as the sequence of its DNA copy (i.e., a sequence containing the DNA bases A, G, C, and T), or as the RNA sequence itself (i.e., a sequence containing the RNA bases A, G, C, and U). Although a large chemical moiety is attached to the Q base at position 7, the Q modification itself has not been found to leave a detectable signature in standard RNA-seq procedures (see Figure 1A , Q34). Thus, Q modification was detected in the DNA copy of the periodate-treated RNA, whereas no Q modification was detected in the DNA copy of the control (untreated) RNA.

[0038] It is known that periodate oxidizes cis-diol groups to aldehydes. Periodate oxidation can be used to study tRNA aminoacylation levels by chromatography, microarrays, or sequencing. The Q base has a cis-diol group that is a known substrate for periodate oxidation (see Figure 1A The reaction shown in ), the periodate oxidation is a common reaction for confirming the presence of Q modification in APB gel electrophoresis. In the tRNA-seq program that measures tRNA loading levels, periodate treatment is usually a step in sequencing library construction before reverse transcription (Evans, ME, Clark, WC, Zheng, G. and Pan, T. (2017) Determination of tRNA aminoacylation levels by high-throughput sequencing. Nucleic Acids Res, 45, e133; Behrens, A., Rodschinka, G. and Nedialkova, DD (2021) High-resolution quantitative profiling of tRNA abundance and modification status in eukaryotes by mim-tRNAseq. Mol Cell, 81, 1802-1815). However, these studies cannot be used for the detection of Q modification. In the paper by Evans et al., no controls without periodate from RNA from the same sample were sequenced, and the Q modification levels of these samples were unknown. In the Behrens et al. paper, only the Saccharomyces cerevisiae samples were periodate treated, and Saccharomyces cerevisiae does not naturally have the Q modification in its tRNA.

[0039] The finding that oxidized Q bases induce a deletion signature in the reverse transcriptase (RT) reaction during sequencing library construction was unexpected. Without being bound by any particular hypothesis, it is thought that the Q base affects anticodon-codon pairing by altering the geometry of the anticodon loop and increasing its rigidity. In vitro studies of codon-anticodon complexes showed a 3-fold increase in the stability of QU pairing compared to GU, whereas pairing with C was destabilized. The 5-membered ring of the Q base is located in the major groove of the RNA-DNA hybrid in the active site of reverse transcriptase. Periodate oxidation opens the ring, which may result in increased flexibility and spatial occupancy of the oxidized portion within the major groove, thereby inducing RT to skip the oxidized Q nucleotide.

[0040] In various aspects, the method for detecting nucleotide modifications in RNA also includes quantifying the proportion of RNA modified with Q. In various aspects, the proportion of quantifying RNA includes comparing the Q level detected in RNA with a calibration curve established from RNA without Q modification (0Q) and with complete Q modification (100Q).

[0041] In various aspects, the nucleotide modification is a 2-thio modification. Thio modification is widespread in mammalian and bacterial tRNAs. In human tRNA, 2-(2-thio, s 2 ) or 4-(4-thio, s 4 Direct substitution of an oxygen atom with sulfur at position ) occurs in the wobble anticodon uridine (U34) of several nuclear-encoded tRNAs and several mitochondrial-encoded tRNAs. Examples of 2-thio modifications are Figure 5A Shown as Tm 5 s 2 U34 and mcm 5 s 2 U34.

[0042] In E. coli tRNA, s 2 The modification occurs in the wobble anticodon uridine of several tRNAs and in the anticodon loop of several other tRNAs at position 32 of cytosine (s 2 In addition, many E. coli tRNAs also contain an s at position 8 between the receptor and the D stem region. 4 U modification. Anticodons 2 The U34 modification is always accompanied by an additional modification at C5, and the thiolation modification plays a role in the decoding efficiency of the C-terminal codons of Gln, Glu, Lys tRNAs versus the U-terminal codons, and the AGY codon of Arg tRNA. 2 The C32 modification plays a role in the selective decoding of Arg codons. 4 U8 modification is a UV sensor that triggers UV response in E. coli.

[0043] Periodate is known to oxidize sulfide and thiol groups ( Figure 5A The reaction shown in Figure 5) can change the sequencing characteristics of the thio modification present in some tRNAs. The 2-thio modification is located in the minor groove of the DNA-RNA hybrid formed in the reverse transcriptase active site. The 2-thio oxidation can change the proofreading mechanism of the reverse transcriptase, thereby producing a detectable feature in cDNA sequencing. In various aspects, the 2-thio modification is detected by (i) a mutation feature at the site of the 2-thio modification in the RNA sequence and / or (ii) a deletion feature near the site of the 2-thio modification in the RNA sequence (see Figure 5).

[0044] The RNA molecule used in the method can be any suitable RNA molecule. In various aspects, the RNA is from a mammal or a bacterium. The mammal can be a human. The bacterium can be any suitable bacterium, for example, Escherichia coli. In various aspects, the RNA is a total RNA, for example, a complete complement of an RNA molecule isolated from a cell. In various aspects, the RNA is a tRNA. In various aspects, the tRNA is a nuclear encoded tRNA, i.e., a cytosolic tRNA, or a mitochondrial encoded tRNA.

[0045] The following includes certain aspects of the disclosure.

[0046] 1. A method for detecting nucleotide modifications in a sample containing RNA, the method comprising: reacting the RNA in the sample with periodate to form periodate-treated RNA in the sample, sequencing the periodate-treated RNA in the sample, and detecting modification features in the sequence.

[0047] 2. The method according to aspect 1 further comprises performing a control sequencing reaction on a portion of RNA from the sample, wherein the control sequencing reaction is performed on RNA that has not been treated with periodate.

[0048] 3. The method according to aspect 1 or aspect 2, wherein the detected modification feature is a mutation feature or a deletion feature in the sequence.

[0049] 4. The method according to any one of aspects 1-3, wherein the nucleotide modification is (a) substitution with quench glycoside (Q modification), or (b) substitution of the oxygen atom at position 2 of the pyrimidine nucleotide with a sulfur atom (2-thio modification).

[0050] 5. The method according to any one of aspects 1-4, wherein the nucleotide modification is a Q modification.

[0051] 6. The method according to aspect 5, wherein a deletion feature is detected at the site of Q modification in the sequence.

[0052] 7. The method according to any one of aspects 1-6, further comprising quantifying the proportion of RNA having Q modification.

[0053] 8. The method according to aspect 7, wherein quantifying the ratio of RNA comprises comparing the Q level detected in the RNA to a calibration curve established from RNA without Q modification (0Q) and with full Q modification (100Q).

[0054] 9. The method according to any one of aspects 1-4, wherein the nucleotide modification is a 2-thio modification.

[0055] 10. The method according to aspect 9, wherein (i) a mutation feature is detected at the site of 2-thio modification in the sequence and / or (ii) a deletion feature is detected near the site of 2-thio modification in the sequence.

[0056] 11. The method according to any one of aspects 1-10, wherein the RNA is from a mammal or a bacterium.

[0057] 12. The method according to any one of aspects 1-11, wherein the RNA is total RNA, tRNA, nuclear-encoded tRNA or mitochondrial-encoded tRNA.

[0058] 13. The method according to any one of aspects 1-12, wherein the periodate-treated RNA is sequenced using high-throughput DNA sequencing.

[0059] It should be noted that the foregoing is merely an example of an aspect. Other exemplary aspects are apparent from the entire description herein. It will also be appreciated by those of ordinary skill in the art that each of these aspects can be used in various combinations with other aspects provided herein.

[0060] The following examples further illustrate the present disclosure, but should of course not be construed as limiting its scope in any way.

[0061] Example 1

[0062] method

[0063] According to some aspects of the present disclosure, the following methods are used in the analysis of dapoxetine and 2-thio RNA modifications.

[0064] HEK293T cell growth

[0065] HEK293T cells were cultured with complete DMEM medium under normal conditions. 0Q HEK293T cells were obtained by culturing cells for several generations with dialyzed FBS, and 100Q HEK293T cells were obtained by treating 0Q cells with 1 μM quinine for 24 hours (8). Briefly, HEK293T cells were grown to 80% confluence and passaged in complete DMEM medium (Cytiva Hyclone SH30022.01) containing 10% dialyzed FBS (Thermo Fisher Scientific 26400044) and 1% penicillin-streptomycin (Thermo Fisher Scientific 15070063). TRIzol reagent (Thermo Fisher Scientific 15596026) was used to extract total RNA at each passage according to the manufacturer's manual. tRNA was continuously checked at each passage by APB gel-based Northern blotting. His / Asn Q levels in tRNA His / Asn The Q modification ratio of 100Q cells dropped below detection after about 10 passages; these cells were designated as OQ. 100Q cells were obtained by culturing OQ cells to 60%-80% confluence and then incubating with 1 μM quinine for 24 hours.

[0066] Northern blotting of APB gel

[0067] Northern blotting was performed as previously described (Zhang, W., Xu, R., Matuszek, Z., Cai, Z. and Pan, T. (2020) Detection and quantification of glycosylated queuosine modified tRNAs by acid denaturing and APB gels. RNA, 26, 1291-1298). 3 μg of total RNA was added to each microcentrifuge tube and diluted to 9 μL with H2O. 1 μL of 1 M Tris-HCl (pH 9.0) was added to the tube and mixed, then incubated at 37 ° C for 30 minutes to deacylate tRNA. 10 μL of 2× RNA loading dye (8 M urea, 0.1 M EDTA, 0.05% bromophenol blue, 0.05% xylene cyanol) was added to each tube. All samples were loaded onto a pre-run, hand-cast 10% denaturing PAGE gel containing 0.5% (g / ml) acrylamidophenylboronic acid (APB). The gel was run at 18W for about 2-3h using 1×TAE buffer in a 4°C cold room until the xylene cyanol blue band was about 1-2cm from the bottom. The gel area containing the target tRNA was saved, and a Hybond-XL membrane (GE Healthcare, RPN303S) slightly larger than the gel was placed on top of the gel and the gel was carefully removed from the plate. A gel dryer (Bio-Rad, 1651745) was then used at 80°C for 4 hours for dry RNA transfer. The gel and membrane were separated by soaking in distilled water. The RNA was cross-linked to the membrane by UV exposure twice at 254nm, 1200mJ each time. The membrane was then blocked with hybridization buffer (20mM phosphate, pH 7, 300mM NaCl, 1% SDS) for 2×30 minutes at room temperature. The membrane was incubated with 50 mL of 3 pmol / mL biotinylated tRNA probe in a UVP hybridization oven (Analytik Jena 95-0030-01) at 60°C for 16 h, and then washed 2×30 min in a UVP hybridization oven with 50 mL of wash buffer (20 mM phosphate, pH 7, 300 mM NaCl, 2 mM EDTA, and 0.1% SDS). The membrane was then incubated with streptavidin-HRP conjugate (Genscript M00091) in 30 mL of hybridization buffer (1:5,000-1:10,000 dilution) at room temperature for 30 min, and then washed three times in 25 mL of wash buffer for 5 min each. The membrane was then transferred to plastic wrap with the RNA side facing up. Peroxidase detection reagents 1 and 2 (Bio-Rad 1705061) (0.1 mL / 1 cm 2The membrane was then transferred to a new plastic wrap to remove the extra detection reagent. The membrane was scanned using the ChemiDoc imaging system (Bio-Rad) and data were analyzed using ImageLab (Bio-Rad).

[0068] The oligonucleotide probe sequence is: tRNA His : 5'-Biotin-TGCCGTGACTCGGATTCGAACCGAGGTTGCTGCGGCCACAACGC AGAGTACTAACCACTATACGATCACGGC[SEQ ID NO:1]; tRNA Asn : 5'-biotin-CGTCCCCTGGGTGGGCTCGAACCACCAACCTTTCGGTTAACAGCC GAACGCGCTAACCGATTGCGCCACAGAGAC [SEQ ID NO: 2].

[0069] E. coli growth and RNA extraction:

[0070] E. coli MG1655 cells were grown in LB to an A600 of 0.4 before subjecting the culture to stress conditions. Cells were harvested by centrifuging 25 mL of culture at 12,000 RCF for 1 min and decanting the medium. 25 mL of mock-treated cells were left to grow for 10 min. Iron depletion stress was performed by adding 2,2'-dipyridyl (DIP) to 25 mL of cells to a final concentration of 250 μM for 10 min. Hydrogen peroxide stress was performed by adding H2O2 to 25 mL of cells to a final concentration of 0.5% for 10 min. Glucose phosphate stress was performed by adding α-methyl glucoside-6-phosphate (αMG) to 25 mL of cells to a final concentration of 1 mM for 10 min. Cells were harvested by centrifugation at 3,000 × g for 5 min and resuspended in 0.5 mL of ice-cold lysis buffer (150 mM KCl, 2 mM EDTA, 20 mM HEPES pH 7.5) and then snap frozen in liquid nitrogen. RNA was extracted by a hot acid-phenol protocol. Briefly, 0.5 mL of acid-buffered phenol (pH 4.5 citrate) was added to the frozen sample. The sample was incubated in a heating block at 50° C. with shaking for 30 min. The aqueous phase was then removed and subjected to another round of phenol extraction, followed by 2 rounds of chloroform extraction, and finally precipitated with 2 μl of 15 mg / ml glycoblue (ThermoFisher AM9515), 300 mM sodium acetate, and 3 volumes of ethanol. The sample was incubated at -80° C. for 1 hour and then centrifuged at maximum speed (20k RCF) for 45 min to precipitate RNA. The precipitate was washed twice with 70% ethanol and then resuspended in water.

[0071] Periodate treatment

[0072] One-pot deacylation and β-elimination for tRNA loading

[0073] For periodate-treated RNA, up to 500 ng of total RNA in 7 μL was used for optional one-pot beta elimination prior to library construction. Initially, 1 μL of 90 mM sodium acetate buffer (pH 4.8) was added to 7 μL of input RNA. Next, 1 μL of freshly prepared 150 mM sodium periodate solution was added, with reaction conditions of 16 mM NaIO4, 10 mM NaOAc pH 4.8. Periodate oxidation was performed at room temperature for 30 min. Oxidation was quenched by adding 1 μL of 0.6 M ribose to a final concentration of 60 mM and incubating for 5 minutes. Next, 5 μL of freshly prepared 100 mM sodium tetraborate, pH 9.5 was added to a final concentration of 33 mM. The mixture was incubated at 45 °C for 30 min. To terminate β elimination and perform 3'-end repair, 5 μL of T4 PNK mix (200 mM TrisHCl pH 6.8, 40 mM MgCl2, 4 U / μL T4 PNK from New England Biolabs) was added to the reaction and incubated at 37°C for 20 min. T4 PNK was heat inactivated by incubation at 65°C for 10 min. The 20 μL reaction mixture was directly used for the first barcode ligation by adding 30 μL of ligation master mix, as described below.

[0074] Standard tRNA deacylation

[0075] For RNA that was not periodate treated, total RNA for library construction was prepared by deacylation in 100 mM Tris-HCl, pH 9.0, at 37°C for 30 min, followed by neutralization to a final concentration of 180 mM by addition of sodium acetate, pH 4.8. The deacylated RNA was then ethanol precipitated and resuspended in water or using the OligoClean-and-Concentrator from Zymo Research. TM Desalting by spin column.

[0076] Barcode concatenation and multiplexing

[0077] Samples were incubated overnight at 16°C in 50 μL of ligation solution with the following final concentrations: 15% PEG 8000, 1× NEB T4 RNA Ligase I Buffer, 50 μM ATP, 5% DMSO, 1 mM hexaaminecobalt(III) chloride, 0.8 μM barcode ligation oligonucleotide, and 1 U / μL NEB T4 RNA Ligase I.

[0078] After overnight ligation, 50 μL of 100 mM EDTA was added to each sample to inactivate the ligase. The samples were then combined and 8 μL of Streptavidin MyOne C1 Dynabeads from ThermoFisher per sample was added to the combined samples. The biotinylated samples were then allowed to bind to the beads for 15 minutes. After binding, the beads were then stained with the Invitrogen Streptavidin-coated MyOne TM The beads were magnetized according to the instructions for C1 dynabeads (https: / / www.ThermoFisher.com / order / catalog / product / 65001). The supernatant was removed and the samples were washed once with high salt Tween wash buffer (1 M NaCl, 0.1% Tween 20 and 20 mM TrisHCl, pH 7.4) and once with low salt wash buffer (100 mM NaCl, 20 mM Tris-HCl, pH 7.4).

[0079] The RT reaction was performed with Superscript IV at 55°C for 10 minutes and then further incubated overnight at 37°C. PCR was performed using standard Illumina index primers after ligation of another DNA oligonucleotide containing the primer binding site of the Illumina index primer. PCR products were sequenced using Illumina NovaSEQ.

[0080] Calibration samples

[0081] The quercetin calibration samples were mixed using different amounts of 0% quercetin (quercetin-depleted) HEK total RNA and 100% quercetin (quercetin-rich) HEK total RNA in a final volume of 10 μL. (Quincetin modification levels were quantified by Northern blot.) The calibration samples ranged from 0% quercetin to 100% quercetin in 10% intervals.

[0082] As above, connect the barcode and Multiplexing The bead-bound sample produced after the step was resuspended in 40 μL of deionized, autoclaved water, and then 10 μL of 0.25M NaIO4, 0.5M NaOAc / HOAc, pH 5 solution was added (final concentration: 50 mM NaIO4, 0.1M NaOAc / HOAc, pH 5). The reaction was carried out at room temperature for 30 minutes and quenched by adding 10 μL of 1M ribose for 5 minutes. After quenching, the barcode was connected and the sample was quenched as previously described. Multiplexing Wash samples as described in the section.

[0083] Data analysis

[0084] Libraries were sequenced on an Illumina Hi-Seq or NEXT-Seq platform. First, paired-end reads were split by barcode sequence using Je multiplexer (Jedemultiplex) with BPOS=BOTH BM=READ_1LEN=4:6FORCE=true C=false 6 options. BM and LEN options were adjusted for samples with 3nt barcodes instead of 4nt barcodes, and for samples with barcodes located in read 2. The barcode sequences are available on Github at https: / / github.com / ckatanski / Q_paper. Next, the read 2 file was used to map bowtie2 (45) with the following parameters: -qp 10 --local—no-unal. The reads were mapped to a curated list of non-redundant tRNA genes with tRNAScane scores >40 for the corresponding organisms (human and Escherichia coli). Bowtie2 output sam files were converted to bam files and then sorted using samtools. Next, reads were collapsed into 1nt windows using IGV. The IGV output .wig files were reformatted using a custom python script (available on GitHub at https: / / github.com / ckatanski / Q_paper). Bowtie2 output Sam files were also used as input to a custom python script that used PySam (a python decorator for SAMtools (46)) to sum all reads mapped to each gene. Data were visualized using a custom R script (available on GitHub at https: / / github.com / ckatanski / Q_paper). The "per million reads" normalization was calculated by dividing the number or reads mapped to a specific gene by the total number of reads mapped to tRNA in that sample and scaling 1,000,000 times. Unless otherwise stated, analysis was limited to genes and positions with read coverage >100 reads. For display, the position values ​​of each tRNA gene were adjusted to match the standard tRNA numbering (anticodons at positions 34, 35, and 36). For calibration curves, the linear or semilogy line of best fit was fitted using Origin using least squares regression and the r2 statistic was calculated. To compare changes in grooming during stress, an unpaired two-sided Wilcox test (Mann-Whitney) was used, with p values: n1>0.05; *, less than 0.05; **, less than 0.01, and ***, less than 0.001.

[0085] result

[0086] Periodate treatment generates a signature loss of Q modifications in RNA sequences

[0087] Total RNA from HEK293T cells with no tRNA Q modification (0Q) or with complete tRNA Q modification (100Q) was used. Figure 1B ), unexpectedly found that tRNA from 100Q cells His The Q34 nucleotide deletion was characteristic only in periodate-treated samples but not in untreated controls ( Figure 1C , Figure 1D This feature is not present in OQ cells ( Figure 1C , Figure 1D The periodate-dependent deletion signature of Q nucleotides in sequencing was the most prominent among other features analyzed, such as mutations, insertions, and terminations ( Figure 1E ).

[0088] FIG. 2 shows the use of periodate treatment to generate sequencing features in DNA copies of additional base-modified RNAs.

[0089] A total of 8 tRNAs in human cells can be modified with Q. Nuclear-encoded tRNA His and tRNA Asn Modified with Q, tRNA Tyr and tRNA Asp The mitochondrial tRNAs encoded by these same four amino acids are also modified with Q. First, the DNA sequences replicated from the Q-modified tRNAs were examined for the presence of the missing feature. Asn A relatively high deletion ratio of about 13% was shown at position Q34, which was Q modification-dependent and periodate-dependent ( Figure 2A ). All four mitochondrial tRNAs also showed deletion signatures at Q-modified nucleotides in the same manner, ranging from mt-tRNA Asp About 4% of the detection level to mt-tRNA Asn About 20% detection level in Figure 2B -D).

[0090] Next, check the known MS at position 37 in tRNA 2 i 6 A mutation's ability to produce a deletion signature in DNA sequencing prior to periodate treatment. The deletion signature was found to be associated with mitochondrial encoded tRNA Asp ms 2 i 6 A( Figure 2E ) and nuclear-encoded tRNA Tyr ( Figure 2FAnother known modification that also produces a deletion feature is m1G at position 37, such as Figure 2G Nuclear-encoded tRNA Asp shown. Figure 2G The periodate-independent deletion characteristic of position 37 in OQ seen in is of unknown origin.

[0091] These results suggest that the missing signature is related to Q34, ms 2 i 6 A37 is associated with m1G modification.

[0092] FIG3 shows the effect of the base sequence surrounding the Q-modified nucleotide on the detected deletion features.

[0093] A factor that may influence the level of the missing feature is the nucleotide sequence immediately upstream of the Q34 residue. Cytosolic tRNA with upstream C32 was found Asn (5'GGCUQUU)( Figure 3A ) has a high missing proportion ( Figure 2A ), while tRNA with upstream U32 His (5'CGUUQUG)( Figure 3A ) has a low missing proportion ( Figure 1D ). Similarly, mt-tRNA Asn (5'AGCUQUU)( Figure 3A ) has an upstream C32, and mt-tRNA His (5'GAUUQUG)( Figure 3B ) have an upstream U32, which is consistent with the observed high and low deletion ratios for these two tRNAs ( Figure 2C and Figure 2B ). mt-tRNA Asp (5'CUUUQUC) with upstream U32 and U31 ( Figure 3A ), which may be related to the observed deletion signature spanning 4 nucleotides ( Figure 2E Finally, mt-tRNA Tyr (5'GACUQUA) may have a high deletion ratio, but this may be due to ms 2 i 6 The A37 modification was masked by the A37 modification, which resulted in a large deletion signature that overshadowed the Q modification deletion signature and was detected in samples with or without periodate treatment ( Figure 2D ).

[0094] These results indicate that the proportion of deletions detected in DNA sequences replicated from Q-modified tRNAs is strongly dependent on the upstream sequence context of the Q modification.

[0095] This experiment explored whether periodate treatment leads to deletion signatures in DNA sequences replicated from diol-Q-modified tRNAs.

[0096] Sugar-Q-modified tRNAs did not react significantly with the boronic acid derivatives used in the APB gel and therefore did not show a shift in gel migration distance as seen with Q-modified tRNAs (see, e.g., Figure 1B However, both galactose and mannose can form a small proportion of furanose tautomers containing cis-diols, which are in equilibrium with the major pyranose tautomers. Tyr and tRNA Asp The 100Q sample had an almost stoichiometric amount of glycosylated Q modification, as measured by a combination of APB and acid denaturing gel electrophoresis (not shown). Tyr and tRNA Asp All show missing features ( Figure 2F-2G ), although the proportion of deletions detected was small. tRNA Tyr and tRNA Asp The deletion ratios of tRNA and tRNA are only about 0.5% and 2%, respectively, which are significantly lower than the values ​​seen for unglycosylated Q-modified tRNA. Since the deletion background in sequencing is <0.1%, these low deletion ratios can still be used to detect sugar-Q modifications, especially in tRNA sequencing where the read coverage of sugar-Q nucleotides can easily reach >1,000. Although cytosolic tRNA Tyr and tRNA Asp The difference in the deletion ratio of gal-Q and man-Q may be related to the products of the periodate reaction, but these two tRNAs also have C32 (tRNA Tyr tRNA with 5'GACUGUA Asp with a 5' GCCUGUC), which enhances the proportion of deletion features detected.

[0097] Taken together, these results demonstrate that modified nucleotides, particularly Q-modified nucleotides, can be readily detected using periodate-treated RNA-seq libraries, with sugar-Q-modified nucleotides having lower detection characteristics.

[0098] The missing ratio can be used to quantify the level of Q modification

[0099] These experiments explored the use of cDNA sequencing to quantify the proportion of Q modifications in biological samples, which would enable the simultaneous assessment of transcriptome-wide tRNA properties associated with Q modifications.

[0100] To assess whether the deletion signature could be used to quantify Q levels, two biological samples of 0Q and 100Q HEK293T cells were systematically mixed to provide different ratios from 0% to 100% Q, and sequencing reactions were performed after periodate treatment of total RNA. His and tRNA Asn The deletion ratio at position Q34 of Figure 4A , Figure 4B ). A calibration curve was prepared from this data ( Figure 4C ).

[0101] It was found that when using Q to modify the exponential dependence of the ratio (r2 = 0.964, 0.985, Figure 4C ) rather than a linear fit (r2 = 0.901, 0.923, not shown), the curve fit of the deletion ratio versus the change in the percentage of Q modification was much better. The explanation for this nonlinear result is that the reverse transcription efficiency of (Q34)tRNA after periodate treatment is lower than that of unmodified (G34)tRNA. In any given sample, up to 20% of the Q34-modified tRNAs produce the deletion signature. Therefore, when the level of Q modification in the sample is low, the quantitative generation of DNA copies containing the deletion signature is inaccurate. Support for this explanation is provided by similar nonlinear results observed for other modifications that reduce the efficiency of reverse transcriptase, such as for N1-methyl-A (m1A) RNA.

[0102] Interestingly, tRNA His and tRNA Asn Both showed very similar slopes in their Q-modified calibration curves ( Figure 4C ). This result is consistent with the absolute value of the detected deletion ratio being dependent on the sequence environment around Q34 in each type of tRNA, but the varying Q levels of the tRNA population in each sample respond to the reverse transcriptase reaction in the same way.

[0103] In HEK293T RNA samples, five tRNA Asn Isocoders account for the total tRNA Asn >95% ( Figure 3C , D), while a single tRNA His Isocoders account for the total tRNA His >99% of the five tRNAs Asn The missing ratios detected by the 100Q samples of the same decoder are almost the same ( Figure 4D ), indicating that all are modified at the same level. This is consistent with all five isoencoders sharing the same sequence in an 11-nucleotide window around the Q34 residue ( Figure 3B , underlined region of tRNA clt26,1).

[0104] These results suggest that the deletion ratio levels detected in periodate-treated RNA-seq libraries can be used to quantify Q modification levels in RNA samples.

[0105] Periodate treatment also generates sequencing signatures in 2-thio modifications

[0106] These experiments explored whether the presence of 2-thio modifications in RNA produces sequencing signatures in DNA copies made from it.

[0107] In mitochondrial encoded tRNA, 5-tauromethyl-2-thiouridine (τm 5 s 2 U) in the context of 2 U modification is present in tRNA Gln , tRNA Glu and tRNA Lys The wobble anticodon position in mt-tRNA Gln and mt-tRNA Glu Strong DNA mutation signatures were found at the modified nucleotides ( Figure 5B and Fig. 6A , left), accompanied by a strong double deletion signature 1-2 nucleotides upstream of the modified nucleotide ( Figure 5B and Fig. 6A , right). Both modification features are periodate-dependent, but not Q-dependent (dashed and solid lines represent the presence and absence of periodate, respectively). Mitochondrial-tRNA Lys Shows periodate-dependent deletion signature consistent with 2-thio modification ( Figure 5B and Fig. 6A , right), but no mutation signature ( Figure 5B and Fig. 6A , left). This result may be due to the unusual sequence context and / or other modifications surrounding the 5-methyltaurine-modified nucleotides. 5 s 2 Among the U34-modified tRNAs, only mt-tRNA Lys With N at position 37 6 -Threonylcarbamoyladenosine (t 6 A) modification, which may affect whether s at wobble position 34 is obtained in the reverse transcriptase reaction 2 Another possibility is that the mt-tRNA in a specific sample (total RNA from HEK293T cells) Lys May not contain a 2-thio modification at position U34.

[0108] Importantly, two mitochondrial tRNAs with 5-methyltaurine but no 2-thio modification, namely mt-tRNA Leu (TAA) and mt-tRNA Trp , in τm 5 U wobble position 34 showed no periodate-dependent mutation or deletion signature ( Figure 5C ), which supports the conclusion that mt-tRNA Gln and mt-tRNA Glu The periodate-dependent mutations and deletions in mt-tRNA are indeed derived from 2-thiolation. Trp middle( Figure 5C These features clearly correspond to the known 2-methylthio-N 6 -Isopentenyl-A(ms 2 i 6 A) 37 modification. ms 2 i 6 The sulfur atom in A can also be thio-modified, which may contribute to periodate-dependent features in sequencing.

[0109] In nuclear-encoded tRNA, 5-(carboxy)methylaminomethyl-2-thiouridine (mnm 5 s 2 U34) in the context of 2 -Modification present in tRNA Arg (TCT), tRNA Gln (TTG) and tRNA Glu Indeed, strong periodate-dependent mutational signatures were found for all three tRNAs at the modified nucleotide positions in both OQ and 100Q cells ( Figure 5D and Figure 6B ), indicating that this feature is not Q-dependent. Depending on the tRNA species, double deletion features also exist at or upstream of the modified nucleotide. These results indicate that periodate treatment can detect mnm 5 s 2 U34 modification, although the ratio of mutational and deletional features seen may depend on the context of adjacent sequences and other modifications in proximity to the 2-thio modification.

[0110] For 0Q and 100Q RNA, the abundance of tRNA in the samples was also compared. Arg (TCT), tRNA Gln (TTG) and tRNA Glu (TTC) mutation characteristics of the iso-decoder (respectively Figure 5Eand Figure 6C ). Arg (TCT) and tRNA Gln Among the isoencoders of (TTG), despite the variation in abundance of the isoencoders, the mutation ratios were comparable. This result was expected because the sequence differences of these isoencoders were all outside the ±5 nucleotide window of modification ( Figure 7 ). In contrast, in tRNA Glu A 2.5-fold difference in mutation ratio was observed in the (TTC) isoencoders ( Figure 5E and Figure 6C ). This difference may be attributed to the modification of these tRNAs within the ±5 nucleotide window Glu Significant differences seen in the sequences of (TTC) iso-decoders ( Figure 7 ), instead of mnm 5 s 2 Differences in the modified portion of U34.

[0111] Calibration curves for 2-thio modifications can also be prepared. Oligonucleotides containing these modifications can be readily obtained by chemical synthesis.

[0112] These results suggest that 2-thio modifications in nucleotides generate mutations and deletion signatures in the DNA copy of the RNA sequence.

[0113] Sulfosylation in Escherichia coli and Sulfosylation in Stress Response

[0114] These experiments explored the sequencing effects of thiolation modifications in tRNA from Escherichia coli.

[0115] Fig. 8A The indicated types of 2-thio modifications are present in E. coli tRNA. E. coli tRNA was sequenced with and without periodate treatment. Gln (TTG) and tRNA Glu The wobble anticodon position in (TTC) shows the known 5-carboxymethylaminomethyl-2-thiouridine (cmnm 5 s 2 U) modified strong, periodate-dependent mutation and deletion signatures ( Figure 8B ). As found for several human 2-thio modifications, the mutation signature is located at the modified nucleotide, while the deletion signature is at or immediately upstream of the modified nucleotide.

[0116] E. coli tRNA also contains 2-thio-C (s 2 C) and 4-thio-U(s 4U) modification. In all five tRNAs, known s 2 Strong, periodate-dependent mutational signature of C32 modification ( Figure 8C , left). In each case, at s 2 Low-level deletion signatures were also observed approximately 1-3 nucleotides upstream of the C-modified nucleotide ( Figure 8C , right). On the other hand, the 8th position s 4 U modification showed only mutational signatures independent of periodate treatment, but not deletion signatures ( Fig.8D ). A possible explanation is that the 2-thio modified structure is located in the minor groove of the DNA-RNA hybrid in the active site of the reverse transcriptase, while the 4-thio modified structure is located in the major groove. These results are consistent with the thio-oxidized structural groups located in the minor groove of the RNA-DNA hybrid interfering with the proofreading activity of the reverse transcriptase.

[0117] To examine the biological consequences of 2-thio modification in tRNA, E. coli was grown in the presence of various stressors: 2,2'-bipyridyl (DIP), which chelates Fe 2+ ; H2O2, which induces oxidative stress; and α-methylglucoside-6-phosphate (αMG), which induces glucose starvation. tRNA sequencing was performed on control (unstressed) and stressed samples. Under stress conditions, cmnm 5 s 2 U34-modified tRNA Gln (TTG) and tRNA Glu The mutation rate of (TTC) did not change ( Fig. 9 ). In contrast, the s 2 C32 levels decreased in response to DIP stress, but not in response to H2O2 or αMG stress ( Fig. 8E ). The 2-thio-C modification is produced by the enzyme TtcA, which contains an iron-sulfur cluster in the active site; under iron chelating conditions s 2 The lower yield of C32 is consistent with reduced activity of the TtcA enzyme. 2 Whether the reduction in C32 levels affects the decoding of specific codons (CGN and AGN) read by these modified tRNAs remains to be determined.

[0118] These results demonstrate that 2-thiolation modifications in bacterial (E. coli) RNA produce the same deletion and mutation signatures in the DNA copy of the RNA sequence as found in human RNA and provide another way to explore the consequences of stress experienced by E. coli.

[0119] Example 2

[0120] method

[0121] According to some aspects of the present disclosure, the following method is used to analyze base modifications in small RNAs of human stool samples.

[0122] Read processing and mapping

[0123] Libraries were sequenced on Illumina Hi-Seq or NEXT-Seq platforms. First, paired-end reads were split by barcode sequence using the Je demultiplexer with options BPOS=BOTH BM=READ_1 LEN=4:6 FORCE=true C=false (Girardot, C., Scholtalbers, J., Sauer, S., Su, SY and Furlong, EE (2016) Je, a versatile suite to handle multiplexed NGS libraries with unique molecular identifiers. BMC Bioinformatics, 17, 419). For samples with 3nt barcodes instead of 4nt barcodes, and for samples where the barcode is located in read 2, the BM and LEN options were adjusted. Next, only reads starting with the barcode (usually read 2) were used for mapping with bowtie2 (version 2.3.3.1) with the following parameters: "-q-p10 --local --no-unal". The human sample reads were mapped to the human transcriptome, where tRNA genes formed a selected, non-redundant set of high-scoring tRNA genes. The reference was a combination of HG19 ORFs, ncRNAs, and a non-redundant selected list of tRNAs based on HG19 tRNAs, with tRNA-scan SEs with scores>47, and 3'"CCA" added. Bowtie2 output sam files were converted to bam files and then sorted using samtools. Next, IGV was used to collapse the reads into 1nt windows. The IGV output .wig file was reformatted using a custom python script (available on GitHub). The Bowtie2 output Sam file was also used as input to a custom python script that used PySam (a python decorator for SAMtools) (see Li, H., Handsaker, B., Wysoker, A., Fennell, T., Ruan, J., Homer, N., Marth, G., Abecasis, G., Durbin, R. and Genome Project Data Processing, S. (2009) The Sequence Alignment / Map format and SAMtools. Bioinformatics, 25, 2078-2079), https: / / github.com / pysam-developers / pysam) to sum all reads mapped to each gene.The associated custom script was used to partition the reads based on a 10 nt window mapped to the 3' end of each tRNA; this was used for fragment analysis. The data were visualized using a custom R script. All custom scripts are available on GitHub (https: / / github.com / ckatanski / CHRIS-seq).

[0124] Microbiome 5S rRNA analysis

[0125] Reference sequences of 5S rRNA were downloaded from the 5S rRNA database (http: / / combio.pl / rrna / ) (Szymanski, M., Zielezinski, A., Barciszewski, J., Erdmann, V A and Karlowski, W M (2016) 5S RNAdb: an information resource for 5S ribosomal RNAs. Nucleic Acids Res., 44, D180-183). Sequences from bacteria (n = 7291), archaea (n = 319), eukaryotes (n = 2861), mitochondria (n = 110) and plastids (n = 838) were combined. The complete lineage was assigned to each reference using the ETE3 NCBI Taxa toolkit in python. Sequencing reads were processed and mapped to the combined 5S reference set using bowtie2 with mapping parameters as described above. Mapping data were further processed to obtain base-wise mapping information and counts by gene. These data were combined with the SRP signal-identified particle mapping data (below) by species. Mapping data for species within the same genus were summarized. Data were then grouped by order or class, respectively, and then summarized.

[0126] Analysis of microbiome tRNA modifications

[0127] Sequencing reads were aligned to tRNA references from seven microorganisms with the most abundant tRNA coverage. tRNA references were obtained from the Genomic tRNA Database (4) from these species: http: / / gtrnadb.ucsc.edu / GtRNAdb2 / genomes / bacteria / Bact_dore_1 / ; http: / / gtrnadb.ucsc.edu / GtRNAdb2 / genomes / bacteria / Bifi_long_longum_BBMN68 / : http: / / gtrnadb.ucsc.edu / GtRNAdb2 / genomes / bacteria / Carn_malt_LMA28 / : http: / / gtrnadb.ucsc.edu / GtRNAdb2 / genomes / bacteria / Cl os_beij_ATCC_35702_SA_1 / Clos_beij_ATCC_35702_SA_1-seq.html:http: / / gtrnadb.ucsc.edu / GtRNAdb2 / genomes / bacteria / Faec_prau_L2_6_L2_6 / ; http: / / gtrnad b.ucsc.edu / GtRNAdb2 / genomes / bacteria / Lach_phyt_ISDg / ; http: / / gtrnadb.ucsc.edu / GtRNAdb2 / genomes / bacteria / Rose_inte_XB6B4 / Rose_inte_XB6B4-seq.html. (See Chan, PP and Lowe, TM (2016) GtRNAdb 2.0: an expanded database of transfer RNA genes identified in complete and draft genomes. Nucleic Acids Res, 44, D184-189.). Modifications were identified by deletion or mutation signatures according to Katanski, CD, Watkins, CP, Zhang, W., Reyer, M., Miller, S. and Pan, T. (2022) Analysis of queuosine and 2-thio tRNA modifications by high throughput sequencing. Nucleic Acids Res., 50, e99.

[0128] result

[0129] Abundance of microbial 5S rRNA sequences

[0130] Fig.10 The abundance of microbial 5S rRNA from different bacterial taxa at the class level is shown. Libraries were constructed for the same human fecal sample under the following four treatment conditions: # without periodate and without demethylase; square with periodate and without demethylase; circle without periodate and with demethylase; * with periodate and with demethylase.

[0131] 5S rRNA abundance was the same in all four sequencing libraries, indicating that periodate and demethylase treatment did not affect 5S rRNA abundance.

[0132] tRNA Q modification using reference sequences from various bacterial species

[0133] Figure 11 shows the tRNA Q modification (present only in tRNAs of Tyr / His / Asn / Asp) found in reference sequences from the indicated bacterial species. Sequence reads were performed with and without periodate treatment. After periodate treatment, the absence of the Q modification becomes detectable. Fig.11A The proportion of deletions at nucleotide position 34 (tRNA nomenclature, wobble anticodon) in tRNAs from species in four bacterial classes is shown: Bacteroidia, Actinobacteria, Bacilli, Clostridia. Sequence reads were performed under the following treatments: # without periodate, squares with periodate. Fig. 11B The proportion of deletions in the region of + / - 5 nucleotides at position 34 in the Q-modifiable tRNA from the bacterium Roseburia rosea is shown: dotted line - without periodate; solid line - with periodate.

[0134] The ratio of deletions detected at tRNA Q modifications varied between the tRNAs and bacteria tested. Tyr A large deletion at position A37 in Fig. 11B ) from the assumed ms 2 i 6 A modification.

[0135] tRNAs using reference sequences from various bacterial species 2 U Modification

[0136] Fig.12 The tRNAs found in reference sequences from the indicated bacterial species are shown. 2U modification. The tRNAs around position U34 (tRNA nomenclature) are shown Glu (TTC) (above) or tRNA Gln (TTG) (bottom) The mutation rate detected in the sequence was detected by the increased mutation rate at position U34 after periodate treatment. 2 U, represented by thick arrows. Dashed lines are without periodate; solid lines are with periodate.

[0137] Some levels of S were detected in both Glu (TTC) (top) and Gln (TTG) tRNAs from each bacterial species tested except B. longum 2 U modification, in Bifidobacterium longum, tRNAs did not show S 2 U modification.

[0138] tRNAs using reference sequences from various bacterial species 2 C32 Modification

[0139] Fig.13 The tRNAs found in reference sequences from the indicated bacterial species are shown. 2 C32 modification. For Bacteroides dorei Arg (CCT), Fig.13 The sequence listed in is one of the two tRNA isoencoder sequences. The other sequence is AAGTTCCTAA (SEQ ID NO:73). In the particular microorganism being studied, some tRNAs corresponding to the anticodons are not present, so there are no sequences for them. For example, there is no tRNA in C. beijerinckii or L. phylofermentans Arg (CCG). tRNAs around position C32 (tRNA nomenclature) are shown. Arg (ACG), tRNA Arg (CCG), tRNA Arg (CCT) and tRNA Arg The proportion of mutations detected in the (TCT) sequence. The mutation rate at position C32 was detected by increasing the mutation rate after periodate treatment. 2 C, indicated by arrows. The dashed line is without periodate; the solid line is with periodate.

[0140] Apart from Fig.13 The four tRNAs shown Arg In addition, s 2C32 modifications (data not shown): Bacteroides dornoni, GlyTCC, TrpCCA; Carnobacterium maltiferum, CysGCA, SerGCT, SerTGA; Clostridium beijerinckii, CysGCA, GlyTCC, SerGCT, SerTGA; F. prausnitzii, GlyTCC, SerGCT, TyrGTA, L. phytofermentans, GlyTCC, TyrGTA; and R. intestinalis, CysGCA, GlyTCC, SerGCT, TrpCCA, TyrGTA.

[0141] s 2 The proportion of C32 modification was determined from the four tRNAs tested in the species (e.g., in Bacillus maltiferus). Arg None of the four tRNAs tested were detected in any of Arg This modification change was detected in (in Faecalibacterium prausnitzii and enteric rosella).

[0142] tRNAs using reference sequences from various bacterial species 2 C34 modification

[0143] Fig.14 The tRNAs found in reference sequences from the indicated bacterial species are shown. 2 C34 modification. In the particular microorganism studied, some tRNAs corresponding to the anticodons are not present, so there is no sequence for them. For example, there is no tRNA in Bacillus maltiferus or Clostridium beijerinckii. Pro (CGG). tRNAs around position C34 (tRNA nomenclature) are shown Pro The mutation rate detected in the (CGG) sequence was detected by the increased mutation rate at position C34 after periodate treatment. 2 C, indicated by arrows. The dashed line is without periodate; the solid line is with periodate.

[0144] Apart from Fig.14 tRNA shown Pro In addition to the (CGG) data, s 2 C34 modifications (data not shown): Bacteroides domitories, ThrCGT; Bifidobacterium longum, AlaCGC, LysCTT, GlnCTG, ThrCGT, ValCAC; Clostridium beijerinckii, GlnCTG; and Faecalibacterium prausnitzii, AlaCGC, ThrCGT.

[0145] In tRNAs from 4 of the 8 species tested Pro(CGG) detected 2 C modification.

[0146] All references, including publications, patent applications, and patents, cited herein are hereby incorporated by reference to the same extent as if each reference were individually and specifically indicated to be incorporated by reference and were set forth in its entirety herein.

[0147] In the context of describing the present invention (especially in the context of the appended claims), the use of the terms "a" and "an" and "the" and "at least one" and similar references should be interpreted as covering both the singular and the plural, unless otherwise specified herein or clearly contradicted by the context. The use of the term "at least one" followed by a list of one or more items (e.g., "at least one of A and B") should be understood to mean any combination of one or more of the listed items (A or B) or the listed items (A and B), unless otherwise specified herein or clearly contradicted by the context. Unless otherwise specified, the terms "comprising", "having", "including" and "containing" should be interpreted as open terms (i.e., meaning "including but not limited to"). Unless otherwise specified herein, the description of the numerical range herein is intended only to be used as a shorthand method of referring to each individual value falling within the range, respectively, and each individual value is incorporated into the specification as if it were individually described herein. Unless otherwise specified herein or clearly contradicted by the context, all methods described herein can be performed in any suitable order. Unless otherwise claimed, the use of any and all examples or exemplary language (e.g., "such as") provided herein is intended only to better illustrate the present invention and is not intended to limit the scope of the present invention. No language in the specification should be construed as indicating that any unclaimed element is essential to the implementation of the present invention.

[0148] The preferred aspects of the present invention are described herein, including the best mode known to the inventor for implementing the present invention. After reading the foregoing description, variations of those preferred aspects will become apparent to those of ordinary skill in the art. The inventor of the present application expects that such variations will be appropriately adopted by those skilled in the art, and the inventor of the present application intends to practice the present invention in a manner different from that specifically described herein. Therefore, the present invention includes all modifications and equivalents of the subject matter recorded in the appended claims as allowed by applicable law. In addition, unless otherwise noted herein or otherwise clearly contradictory to the context, the present invention encompasses any combination of the above-mentioned elements in all possible variations thereof.

Claims

1. A method for detecting nucleotide modifications in a sample containing RNA, the method comprising: The RNA in the sample is reacted with periodate to form periodate-treated RNA in the sample, the periodate-treated RNA in the sample is sequenced, and the modification feature in the sequence is detected, wherein the nucleotide modification is (a) substitution with quenching nucleotide (Q modification) or (b) substitution of the oxygen atom at the second position of the pyrimidine nucleotide with a sulfur atom (2-thio modification).

2. The method according to claim 1, further comprising performing a control sequencing reaction on a portion of RNA from the sample, wherein the control sequencing reaction is performed on RNA that has not been treated with periodate.

3. The method according to claim 1, wherein the detected modification feature is a mutation feature or a deletion feature in the sequence. The method according to claim 1 , wherein the nucleotide modification is a Q modification. The method according to claim 4 , wherein a deletion feature is detected at the site of Q modification in the sequence. The method according to claim 4 , further comprising quantifying the proportion of RNA having Q modification.

7. The method of claim 6, wherein quantifying the ratio of RNA comprises comparing the Q level detected in the RNA to a calibration curve established from RNA without Q modification (0Q) and with full Q modification (100Q). The method according to claim 1 , wherein the nucleotide modification is a 2-thio modification.

9. The method according to claim 8, wherein (i) a mutation feature is detected at the site of the 2-thio modification in the sequence and / or (ii) a deletion feature is detected near the site of the 2-thio modification in the sequence.

10. The method of claim 1, wherein the RNA is from a mammal or a bacterium.

11. The method of claim 1, wherein the RNA is total RNA, tRNA, nuclear-encoded tRNA, or mitochondrial-encoded tRNA.

12. The method of claim 1, wherein the periodate-treated RNA is sequenced using high-throughput DNA sequencing.

13. The method of claim 2, wherein the nucleotide modification is a Q modification. The method according to claim 13 , wherein a deletion feature is detected at the site of the Q modification in the sequence.

15. The method of claim 13, further comprising quantifying the proportion of RNA having Q modification.

16. The method of claim 15, wherein quantifying the ratio of the RNA comprises comparing the Q level detected in the RNA to a calibration curve established from RNA without Q modification (0Q) and with full Q modification (100Q).

17. The method of claim 2, wherein the nucleotide modification is a 2-thio modification.

18. The method according to claim 17, wherein (i) a mutation feature is detected at the site of the 2-thio modification in the sequence and / or (ii) a deletion feature is detected near the site of the 2-thio modification in the sequence.

19. The method of claim 2, wherein the RNA is from a mammal or a bacterium.

20. The method of claim 2, wherein the RNA is total RNA, tRNA, nuclear-encoded tRNA, or mitochondrial-encoded tRNA.

21. The method of claim 2, wherein the periodate-treated RNA is sequenced using high-throughput DNA sequencing.

Images