Application of BAZ2B as target spot in non-alcoholic fatty liver and hepatitis

Abstract

The invention relates to application of BAZ2B as a target spot in non-alcoholic fatty liver and hepatitis. More specifically, the present application relates to agents for modulating the expression or activity of BAZ2B, such as down-regulators of BAZ2B; compositions comprising said agent for modulating the expression or activity of BAZ2B; and a method for regulating the expression level or activity of BAZ2B in a cell, such as a method for inhibiting the expression or activity of BAZ2B. The present application also relates to a method for treating or ameliorating liver diseases, such as diseases associated with lipid metabolism, non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), and obesity, by modulating the expression level or activity of BAZ2B in a cell, and to a method for treating or ameliorating liver diseases, such as, for example, diseases associated with lipid metabolism, non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH).

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and more specifically, the present invention relates to the application of BAZ2B gene as a target in non-alcoholic fatty liver disease, namely hepatitis. Background Art

[0002] Nonalcoholic fatty liver disease (NAFLD) is a rapidly growing chronic disease worldwide and has become the most important chronic liver disease[1,2]. In recent years, the incidence of NAFLD has increased dramatically, with a global incidence of 25%[3]. It also increases with age, with the incidence in people over 60 years old reaching 30%[1]. NAFLD is a continuous and dynamic spectrum of liver diseases that can progress from hepatic steatosis to nonalcoholic steatohepatitis (NASH), the latter of which is characterized by necrotic inflammation and rapid progression of liver fibrosis[3]. 15% to 20% of patients with NASH-related fibrosis may progress to cirrhosis, end-stage liver disease, or even hepatocellular carcinoma[1,3]. Liver fibrosis is the most important predictor of NASH-related long-term mortality, liver transplantation, and liver-related clinical events[2,3]. Therefore, preventing or reversing the progression of NASH and its liver fibrosis is the key to improving prognosis. However, there is currently a lack of effective NASH treatment drugs. The root cause is that the pathological formation of NAFLD is complex and heterogeneous, and the exact cellular and molecular mechanisms have not yet been fully elucidated [2,3].

[0003] Although the pathological process of NAFLD / NASH is complex and variable, there are still some common triggering factors. It is currently believed that the formation and progression of NAFLD / NASH are the result of the parallel action of multiple factors. Factors such as obesity, type 2 diabetes, hyperlipidemia and unhealthy lifestyle, accompanied by insulin resistance, lead to the destruction of the lipid metabolism homeostasis of hepatocytes, followed by hepatocyte fatty degeneration, excessive oxidative stress and endoplasmic reticulum stress, and mitochondrial dysfunction, which ultimately cause hepatocyte damage, death or aging, and then promote immune inflammatory response and liver fibrosis formation [4,5]. It should be emphasized that the intensity of these blows and their consequences depend to varying degrees on the individual's genetic background and epigenetic changes [6].

[0004] Epigenetic mechanisms play a key role in cell aging and mitochondrial dysfunction, and the impact of epigenetic changes on cells and tissues is lifelong[7,8]. Abnormal modification of histones can affect mitochondrial function and cell aging, leading to diabetes, cancer, etc., while excessive acetylation increases the expression of NASH phenotype-related genes (CREBH, SIRT1), aggravating inflammation and liver damage. Therefore, elucidating the cellular and molecular mechanisms of cell aging and NAFLD / NASH formation from the perspective of epigenetic mechanisms will help discover new therapeutic targets[9].

[0005] In recent years, studies have found that the bromodomain adjacent to zinc finger domain protein 2B (BAZ2B) gene contains bromodomains and plant homologous domains. It is a regulatory subunit of the ISWI-nucleosome complex and can participate in chromosome remodeling and gene transcription

[10] . Mouse Baz2b can affect the expression of liver regeneration-related genes through H3K27ac and H3K4me3 histone modifications. Inhibiting Baz2b can improve the liver regeneration ability of mice

[11] . Our laboratory's preliminary work

[12] found that BAZ2B expression increases with age and inhibits the expression of mitochondrial-related genes, impairing mitochondrial function and ultimately causing behavioral function degeneration. Aged Baz2b knockout mice weigh less and maintain better cognitive function than aged wild-type mice. Overweight and obesity are one of the main causes of NAFLD

[13] . Aging and mitochondrial dysfunction also play an important role in the pathological process of NAFLD and NASH. Based on this, we hypothesized that BAZ2B may be involved in the pathological process of aging-related NAFLD and NASH. Therefore, it can be used as a target to further explore the cellular and molecular mechanisms of the formation and progression of NAFLD / NASH and to find drugs with potential therapeutic value.

[0006] After extensive and in-depth research, the inventors have revealed that BAZB plays an important regulatory role in the occurrence and development of NAFLD / NASH diseases, and downregulation of the BAZ2B gene can significantly alleviate the disease process, improve liver fatty degeneration in elderly mice, and improve liver fibrosis levels in CDAHFD model mice. Therefore, BAZ2B can be used as a research target for NAFLD / NASH diseases, develop drugs that inhibit or delay NAFLD / NASH diseases, and as a diagnostic and prognostic assessment marker for diseases related to NAFLD / NASH diseases. Summary of the invention

[0007] The purpose of the present invention is to provide the use of BAZ2B gene as a target for alleviating NAFLD / NASH.

[0008] In some embodiments of the present invention, a down-regulator of BAZ2B protein or its encoding gene is provided, and its use in preparing a composition for improving or preventing NAFLD / NASH disease. The down-regulator is selected from: a gene editing agent that specifically knocks out the BAZ2B encoding gene; an interfering molecule that specifically interferes with the expression of the BAZ2B encoding gene; a small molecule agent that specifically inhibits the BAZ2B protein or its encoding gene; or an antibody or ligand that specifically binds to the BAZ2B protein.

[0009] In some specific embodiments of the present invention, an agent for regulating the expression or activity of BAZ2B is provided, wherein the agent is a down-regulator for the BAZ2B gene or the protein encoded therein.

[0010] In one embodiment of the present invention, a down-regulator for the BAZ2B gene or the protein encoded therein is provided, wherein the down-regulator is selected from: a gene editing agent that specifically knocks out the BAZ2B encoding gene, an interfering molecule that specifically interferes with the expression of the BAZ2B encoding gene, and an antibody or ligand that specifically binds to the BAZ2B protein.

[0011] In one embodiment of the present invention, a down-regulator for the BAZ2B gene or the protein encoded therein is provided, wherein the down-regulator is a gene editing agent that specifically knocks out the BAZ2B encoding gene.

[0012] In one embodiment of the present invention, a down-regulator for the BAZ2B gene or its encoded protein is provided, wherein the down-regulator comprises a CRISPR / Cas system, the system comprising sgRNA or a nucleic acid capable of forming the sgRNA, and Cas9 mRNA or a nucleic acid capable of forming the Cas9 mRNA. In a specific embodiment, the gene editing reagent comprises an sgRNA or a nucleic acid capable of forming the sgRNA selected from the following: SEQ ID NO: 1 and SEQ ID NO: 2.

[0013] In one embodiment of the present invention, a down-regulator for the BAZ2B gene or the protein encoded therein is provided, wherein the down-regulator is an interfering molecule that specifically interferes with the expression of the BAZ2B encoding gene, and the interfering molecule is selected from antisense oligonucleotides (ASO), small interfering ribonucleic acids (siRNA), micro RNA (miRNA) and nucleic acid aptamers.

[0014] In one embodiment of the present invention, a down-regulator against the BAZ2B gene or the protein encoded therein is provided, wherein the down-regulator is an antisense oligonucleotide targeting BAZ2B.

[0015] In one embodiment of the present invention, a down-regulator for the BAZ2B gene or its encoded protein is provided. In some specific embodiments, the down-regulator includes an exemplary antisense oligonucleotide sequence selected from the following:

[0016] ATGGCAACAGTTCTCCAGACTCCAT(SEQ ID NO:5);

[0017] AGCCTTCTGCTGCCTACCCATAGTC (SEQ ID NO: 6); and

[0018] GGATACCTGAAAGGAAACACATCGT (SEQ ID NO:7).

[0019] In one embodiment of the present invention, a composition for regulating the expression or activity of BAZ2B is provided, which comprises the agent or down-regulator described in any one of the above embodiments.

[0020] In one embodiment of the invention, a composition for regulating BAZ2B expression or activity is provided, which further comprises a pharmaceutically acceptable carrier for delivering the medicament. In some specific embodiments, the carrier includes a virus, which may include a lentivirus, a retrovirus, an adenovirus, and an adeno-associated virus. In some other embodiments, the carrier includes a liposome.

[0021] In one embodiment of the present invention, a composition for regulating BAZ2B expression or activity is provided, which further comprises a targeting agent for targeting the agent to a diseased region or cell.

[0022] In one embodiment of the present invention, there is provided the use of the agent, down-regulator or composition described in any of the above embodiments in the preparation of a medicament for treating and / or preventing a disease or condition. In some specific embodiments, the disease or condition is selected from non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH) and obesity. In some specific embodiments, the disease or condition is a disease or condition associated with liver lipid metabolism. In some embodiments, the metabolic-related disease or condition is overweight, weight gain, obesity, nonalcoholic fatty liver disease, diabetes, insulin resistance, alcoholic fatty liver disease, dyslipidemia, steatosis (e.g., hepatic steatosis, cardiac steatosis, renal steatosis, muscle steatosis), abetalipoproteinemia, glycogen storage disease, Weyl-Crutchberg disease, lipodystrophy; liver disease, liver inflammation, hepatitis, steatohepatitis, hepatitis C, genotype 3 hepatitis C, α1-antitrypsin deficiency, acute fatty liver of pregnancy, Wilson's disease; kidney disease; heart disease, hypertension, ischemia, heart failure, cardiomyopathy; poisoning; HIV; neurodegenerative diseases, Parkinson's disease, Alzheimer's disease; cancer; physical exercise-induced conditions. In some embodiments of the invention, the metabolic-related disease or condition is high cholesterol, and reducing BAZ2B activity can be used in a method of reducing cholesterol in a cell, tissue or object. In some embodiments, the metabolic-related disease or condition is an eating disorder, anorexia, starvation, malnutrition, total parenteral nutrition, severe weight loss, underweight, refeeding syndrome; metabolic changes mediated by gastrointestinal surgery, jejuno-iliac bypass, gastric bypass; and inflammatory / infectious conditions, jejunal diverticular disease with bacterial overgrowth, or inflammatory bowel disease.

[0023] In one embodiment of the present invention, there is provided a reagent for detecting BAZ2B expression or activity for use in preparing a kit for diagnosis and prognosis assessment of a disease. In some specific embodiments, the disease or condition is selected from non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH) and obesity. In some specific embodiments, the disease is a disease or condition associated with liver lipid metabolism. In some embodiments, the metabolic-related disease or condition is overweight, weight gain, obesity, nonalcoholic fatty liver disease, diabetes, insulin resistance, alcoholic fatty liver disease, dyslipidemia, steatosis (e.g., hepatic steatosis, cardiac steatosis, renal steatosis, muscle steatosis), abetalipoproteinemia, glycogen storage disease, Weyl-Crutchberg disease, lipodystrophy; liver disease, liver inflammation, hepatitis, steatohepatitis, hepatitis C, genotype 3 hepatitis C, α1-antitrypsin deficiency, acute fatty liver of pregnancy, Wilson's disease; kidney disease; heart disease, hypertension, ischemia, heart failure, cardiomyopathy; poisoning; HIV; neurodegenerative diseases, Parkinson's disease, Alzheimer's disease; cancer; physical exercise-induced conditions. In some embodiments of the invention, the metabolic-related disease or condition is high cholesterol, and reducing BAZ2B activity can be used in a method of reducing cholesterol in a cell, tissue or object. In some embodiments, the metabolic-related disease or condition is an eating disorder, anorexia, starvation, malnutrition, total parenteral nutrition, severe weight loss, underweight, refeeding syndrome; metabolic changes mediated by gastrointestinal surgery, jejuno-iliac bypass, gastric bypass; and inflammatory / infectious conditions, jejunal diverticular disease with bacterial overgrowth, or inflammatory bowel disease.

[0024] In one embodiment of the present invention, there is provided a use of a reagent for detecting BAZ2B expression or activity in the preparation of a kit for disease diagnosis and prognosis assessment, wherein the kit is used for typing, differential diagnosis, and / or susceptibility analysis of NAFLD / NASH diseases.

[0025] In one embodiment of the present invention, there is provided the use of a reagent for detecting BAZ2B expression or activity in the preparation of a kit for disease diagnosis and prognosis evaluation, wherein the kit is used to evaluate NAFLD / NASH disease therapeutic drugs, drug efficacy, prognosis, or for selecting an appropriate treatment method.

[0026] In one embodiment of the invention, there is provided a method for treating a disease or condition, the method comprising administering to an object in need thereof a medicament, a down-regulator or a composition according to any of the above embodiments. In some specific embodiments, the disease or condition is selected from non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH) and obesity. In some specific embodiments, the disease is a disease or condition associated with liver lipid metabolism. In some embodiments, the metabolic-related disease or condition is overweight, weight gain, obesity, nonalcoholic fatty liver disease, diabetes, insulin resistance, alcoholic fatty liver disease, dyslipidemia, steatosis (e.g., hepatic steatosis, cardiac steatosis, renal steatosis, muscle steatosis), abetalipoproteinemia, glycogen storage disease, Weyl-Crutchberg disease, lipodystrophy; liver disease, liver inflammation, hepatitis, steatohepatitis, hepatitis C, genotype 3 hepatitis C, α1-antitrypsin deficiency, acute fatty liver of pregnancy, Wilson's disease; kidney disease; heart disease, hypertension, ischemia, heart failure, cardiomyopathy; poisoning; HIV; neurodegenerative diseases, Parkinson's disease, Alzheimer's disease; cancer; physical exercise-induced conditions. In some embodiments of the invention, the metabolic-related disease or condition is high cholesterol, and reducing BAZ2B activity can be used in a method of reducing cholesterol in a cell, tissue or object. In some embodiments, the metabolic-related disease or condition is an eating disorder, anorexia, starvation, malnutrition, total parenteral nutrition, severe weight loss, underweight, refeeding syndrome; metabolic changes mediated by gastrointestinal surgery, jejuno-iliac bypass, gastric bypass; and inflammatory / infectious conditions, jejunal diverticular disease with bacterial overgrowth, or inflammatory bowel disease.

[0027] In one embodiment of the present invention, a method for regulating the expression level or activity of BAZ2B in a cell is provided, the method comprising administering the agent, down-regulator or composition according to any one of the above embodiments to a subject in need thereof.

[0028] The present invention is not intended to be limited to systems and methods that must satisfy one or more of any of the objects or features mentioned in the present invention. It is also important to note that this document is not limited to the exemplary or original embodiments described herein. Modifications and substitutions made by those of ordinary skill in the art are considered to be included within the scope of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 The expression of BAZ2B gene in the liver of NAFLD / NASH patients is shown. Figure 1 a, Typical images of BAZ2B expression in the liver of normal subjects and NAFLD / NASH patients, scale bar equals 50 μm. Figure 1b, Statistical analysis of BAZ2B expression in the liver of normal people and NAFLD / NASH patients. *** P < 0.001 (unpaired Student's t-test). Figure 1 c, Statistical analysis of BAZ2B expression levels in the liver of normal / obese NAFLD / NASH patients in the human gene database (GSE61260), significance is indicated by ***P<0.001 (one-way ANOVA Tukey's test). Figure 1 d, Typical image of BAZ2B expression in the liver of NAFLD / NASH patients, scale bar equals 50 μm. Figure 1 e / f, Statistical analysis of BAZ2B expression levels in liver lesions and normal areas of NAFLD / NASH patients. *** P < 0.001 (unpaired Student's t-test).

[0030] Figure 2 It was shown that BAZ2B knockout can suppress hepatic steatosis in aged mice. Figure 2 a, Representative images of livers from BAZ2B knockout heterozygous, homozygous, and wild-type mice at young and old ages. Figure 2 d, Representative images of H&E and Oil Red staining of aged livers from Baz2B knockout heterozygous, homozygous, and wild-type mice. Scale bar equals 50 μm. Figure 2 b / c Statistical analysis of liver weight and relative body weight ratio of BAZ2B knockout heterozygous, homozygous and wild-type mice in young (about 4.5 months) and old (about 24 months). ** P < 0.01 (one-way ANOVA Tukey's test). Figure 2 e / f, Statistical analysis, fatty degeneration area and oil red staining results of BAZ2B knockout heterozygous, homozygous and wild-type mice in the aged liver. * P < 0.05 (one-way ANOVA Tukey's test).

[0031] Figure 3 The mechanistic study showed that BAZ2B plays a role in improving age-related hepatic steatosis. Figure 3 a, Representative images of BAZ2B expression in liver of wild-type mice at young and old ages, scale bar equals 50 μm. Figure 3 b, Statistical analysis of BAZ2B expression levels in the livers of young and old wild-type mice. * P < 0.05 (unpaired Student's t-test). Figure 3 c, Statistical analysis, mitochondrial activity in the liver of BAZ2B knockout heterozygous, homozygous and wild-type mice, significant difference between the two groups.* P < 0.05 (one-way ANOVA Tukey's test). Figure 3 d, RNA-seq analysis results, enrichment pathway diagram of upregulated genes in the liver of BAZ2B knockout mice compared with wild-type mice. Figure 3 e, Statistical analysis, glucose tolerance test results of aged mice, significant difference between * P < 0.05 (one-way ANOVA Tukey's test). Figure 3 f, Statistical analysis, results of respiratory gas exchange rate (RER, RER = VCO2 / VO2) in metabolic cage test of aged mice, significant difference between the two groups. *** P < 0.001 (one-way ANOVA Tukey's test).

[0032] Figure 4 It was shown that BAZ2B knockout could inhibit the level of liver fibrosis in CDAHFD model mice. Figure 4 a, Statistical analysis of body weight changes in BAZ2B knockout heterozygous, homozygous and wild-type mice after normal feeding and CDAHFD modeling. Figure 4 b, Statistical analysis of liver weights of BAZ2B knockout heterozygous, homozygous, and wild-type mice after normal feeding and CDAHFD modeling. Figure 4 c / d, Statistical analysis, liver alanine aminotransferase (ALT) / aspartate aminotransferase (AST) levels in BAZ2B knockout heterozygous, homozygous and wild-type mice after normal feeding and CDAHFD modeling, with significance as * P<0.05, *** P < 0.001 (one-way ANOVA Tukey's test). Figure 4 e, Typical images of H&E staining of the livers of BAZ2B knockout heterozygous, homozygous, and wild-type mice after normal feeding and CDAHFD modeling. The scale bar is 50 μm. Figure 4 f / g, Statistical analysis, hepatic steatosis / inflammatory infiltration in BAZ2B knockout heterozygous, homozygous and wild-type mice after normal feeding and CDAHFD modeling, with significant difference between the two groups. *** P < 0.001 (one-way ANOVA Tukey's test). Figure 4 h, Typical images of Sirius red staining of the livers of BAZ2B knockout heterozygous, homozygous, and wild-type mice after normal feeding and CDAHFD modeling. Figure 4 i. Statistical analysis. Liver fibrosis in BAZ2B knockout heterozygous, homozygous and wild-type mice after normal feeding and CDAHFD modeling. *** P < 0.001 (one-way ANOVA Tukey's test).

[0033] Figure 5 The results showed that BAZ2B improves liver fibrosis in CDAHFD mice. Figure 5 a, RNA-seq analysis results, volcano plot of differentially expressed genes in the liver of BAZ2B knockout mice compared with wild-type mice after CDAHFD modeling. Figure 5 b / c, RNA-seq analysis results, enrichment pathway diagram of up / downregulated genes in the liver of BAZ2B knockout mice compared with wild-type mice after CDAHFD modeling. Figure 5 dk, Statistical analysis, PPARα / Acsl1 / Acox1 / Gls2 / Ifit2 / Ifit3 / IRF7 / TLR2 mRNA expression levels in the liver of BAZ2B knockout heterozygous, homozygous and wild-type mice after normal feeding and CDAHFD modeling, significant difference was shown in Table 2. * P<0.05, ** P < 0.01 (one-way ANOVA Tukey's test). Figure 5 l. In the mouse liver gene expression database GSE130970, the expression level of IRF7 in the liver of healthy controls and patients with mild / severe NAFLD (NAFLD score greater than 3) was significantly higher than that in controls. ** P < 0.01 (one-way ANOVA Tukey's test).

[0034] Figure 6 It was shown that BAZ2B ASO can inhibit the level of liver fibrosis in CDAHFD model mice. Figure 6 a, Analysis of the similarity between the mouse BAZ2B gene and the human BAZ2B gene, red indicates a match. Figure 6 b, Statistical analysis of liver weights in the control group, CDAHFD group, and CDAHFD+BAZ2B ASO-1, 2, and 3 groups. Figure 6 c / d, Statistical analysis of liver alanine aminotransferase (ALT) / aspartate aminotransferase (AST) levels in the control group, CDAHFD group, and CDAHFD+BAZ2B ASO-1, 2, and 3 groups. * P<0.05, ** P<0.01, *** P < 0.001 (one-way ANOVA Tukey's test). Figure 6 e, Typical images of H&E and Sirius red staining of the livers of the control group, CDAHFD group, and CDAHFD+BAZ2BASO-1, 2, and 3 groups. The scale bar equals 50 μm. Figure 6 f. Statistical analysis of liver inflammatory infiltration in the control group, CDAHFD group, and CDAHFD+BAZ2B ASO-1, 2, and 3 groups. * P<0.05,*** P < 0.001 (one-way ANOVA Tukey's test). Figure 6 g, Statistical analysis of Sirius red staining in the control group, CDAHFD group, and CDAHFD+BAZ2B ASO-1, 2, and 3 groups. ** P<0.01, ***P<0.001 (one-way ANOVA Tukey's test).

[0035] Figure 7 The BAZ2B mRNA full sequence knockdown target design is shown. Figure 7 a, Schematic diagram of the design of siRNA knockdown targets for the full sequence of BAZ2B mRNA. Figure 7 b, Statistical analysis of BAZ2B mRNA full sequence siRNA knockdown validation, significance is shown in *** P < 0.001 (one-way ANOVA Tukey's test).

[0036] Figure 8 It was shown that BAZ2B liver-specific knockdown virus can inhibit the levels of liver steatosis and fibrosis in CDAHFD model mice. Figure 8 a, Statistical analysis of liver weights in the control group, CDAHFD+TBG-NC group, and CDAHFD+TBG-Baz2b group. Figure 8 b / c, Statistical analysis of liver alanine aminotransferase (ALT) / aspartate aminotransferase (AST) levels in the control group, CDAHFD+TBG-NC group, and CDAHFD+TBG-Baz2b group. * P<0.05, ** P < 0.01 (one-way ANOVA Tukey's test). Figure 8 d, Typical images of H&E, Oil Red and Sirius Red staining of the livers of the control group, CDAHFD+TBG-NC group and CDAHFD+TBG-Baz2b group, the scale bar equals 50 μm. Figure 8 e / f, Statistical analysis of fatty degeneration area and hepatic inflammatory infiltration in the control group, CDAHFD+TBG-NC group and CDAHFD+TBG-Baz2b group. ** P<0.01, *** P < 0.001 (one-way ANOVA Tukey's test). Figure 8 g, Statistical analysis of the oil red staining results of the control group, CDAHFD+TBG-NC group, and CDAHFD+TBG-Baz2b group. *** P < 0.001 (one-way ANOVA Tukey's test). Figure 8h, Statistical analysis of Sirius red staining in the control group, CDAHFD+TBG-NC group and CDAHFD+TBG-Baz2b group. ** P<0.01, *** P < 0.001 (one-way ANOVA Tukey's test). DETAILED DESCRIPTION

[0037] The specific function of BAZ2B protein is not clear in this field. BAZ2B protein contains DNA binding domain, PHD zinc finger domain and BROMO domain that can bind to acetylated histones. The functions of these domains suggest that BAZ2B may play an epigenetic regulatory role. Studies have reported that its homologous protein BAZ2A is a component of the chromatin remodeling complex, which can bind to DNA and inhibit transcription.

[0038] In the present invention, the term "BAZ2B protein" refers to a protein having a sequence as shown in SEQ ID NO: 3 (human) or SEQ ID NO: 4 (mouse) (the gene sequences of which are respectively shown in GenBank NM_013450 (human) and GenBank NM_001001182 (mouse)). BAZ2B protein is highly conserved in mammals, and the sequence identity between the mouse protein and the human protein is high.

[0039] SEQ ID NO:3

[0040] NM_001289975.1 Human (Homo sapiens) bromodomain-adjacent zinc finger domain 2B (BAZ2B), transcript variant 2, mRNA

[0041]

[0042]

[0043]

[0044]

[0045]

[0046] SEQ ID NO:4

[0047] NM_001001182.3 Mouse (Mus musculus) bromodomain-adjacent zinc finger domain 2B (Baz2b), mRNA

[0048]

[0049]

[0050]

[0051]

[0052]

[0053]

[0054] The present invention relates in part to regulating the activity (e.g., level and / or function) of the BAZ2B protein to regulate its activity in parts including cells, tissues, organs, and objects. The compositions, agents, and methods of the present invention can be used to treat subjects suffering from or at risk of suffering from a disease or condition that may be characterized by abnormal BAZ2B activity levels or undesirable BAZ2B activity levels. The present invention also relates in part to methods for diagnosing and assessing the state of diseases and conditions that may be characterized by abnormal BAZ2B activity. Therefore, the methods and agents of the present invention can be used to treat and assess such diseases and conditions in a subject. The present invention also relates in part to regulating BAZ2B activity in a subject from an initial activity level to an activity level that effectively reduces or eliminates symptoms of a disease or condition and / or prevents the onset of symptoms of a disease or condition.

[0055] As used herein, a subject shall mean a human or vertebrate mammal, including but not limited to mice, dogs, cats, horses, goats, and primates (such as monkeys). Therefore, the present invention can be used to treat diseases or conditions in humans and non-human subjects. For example, the methods and compositions of the present invention can be used in veterinary applications and in human prevention and treatment regimens. In some embodiments of the present invention, the subject can be a human or a mouse.

[0056] Non-limiting examples of subjects to which the present invention can be applied are subjects diagnosed with, suspected of having, or at risk of developing a disease or condition of interest. The methods of the present invention can be applied to subjects who have been diagnosed with a disease or condition of interest at the time of treatment or are believed to be at risk of developing or developing a disease or condition of interest.

[0057] In some aspects of the invention, the subject suffering from the relevant disease or condition is a subject with a detectable relevant abnormality compared to a normal control. In certain aspects of the invention, the subject may not have significant differences compared to a normal control, but it is desirable to use the methods provided herein to change the relevant activity of the subject.

[0058] In some aspects of the invention, a subject is at risk for developing or developing a disease or condition of interest. A subject at risk for developing a disease or condition of interest is a subject that has an increased likelihood of developing the disease or condition compared to a control risk. In some embodiments of the invention, the risk level may be statistically significant compared to the control risk level. Subjects at risk may include, for example, subjects with genetic abnormalities, the presence of which has been shown to be associated with a higher likelihood of developing a disease or condition of interest; subjects with a family and / or personal history of a disease or condition of interest; subjects exposed to an agent (such as a chemical toxin) or activity; and / or subjects who have previously been treated for a disease or condition of interest and are in apparent remission.

[0059] In the context of the present invention, the BAZ2B activity in a cell, tissue or object may be higher relative to the BAZ2B activity in a cell, tissue or object that does not suffer from a related disease or condition. Therefore, in some diseases and conditions that can be treated using the methods and medicaments of the present invention, a BAZ2B activity higher than normal may be a feature of a related disease or condition, and may also be used to diagnose a related disease or condition. The feature of some related diseases or conditions may not be a BAZ2B activity level higher than normal in a cell, tissue or object, but may be treated by reducing the BAZ2B activity in a given object. For example, an object may have a normal BAZ2B activity level compared to a control level from a sample, tissue or object that does not suffer from a related disease or condition, but reducing the level in an object may treat a related disease or condition in the object.

[0060] BAZ2B activity (e.g., the level of BAZ2B and / or the function of BAZ2B) can be measured according to the present invention and compared with a control value of BAZ2B activity. The control can be a predetermined value, which can be in various forms. It can be a single cutoff value, such as a median or mean value. It can be determined based on a comparison group, such as a group with normal BAZ2B activity and a group with abnormal BAZ2B activity. Another example of a comparison group can be a group with one or more symptoms or diagnoses of a related disease or condition, and a group without one or more symptoms or diagnoses of a related disease or condition. Another comparison group can be a group with a family history of a related disease or condition, and a group without such a family history. The predetermined value can be set as follows, for example, when the test population is divided equally (or unequally) into multiple groups (such as a low-risk group, a moderate-risk group, and a high-risk group) or quartiles or quintiles, the lowest quartile or quintile is the individual with the lowest risk (such as the risk of a related disease or condition) and the lowest BAZ2B activity amount, and the highest quadrant or quintile is the individual with the highest risk (such as the risk of a related disease or condition) and the highest BAZ2B activity amount.

[0061] Of course, the predetermined value will depend on the specific population selected. For example, compared with a population known to suffer from abnormal BAZ2B protein expression or the presence of a related condition, an apparently healthy population will have a different "normal" range. Therefore, the predetermined value selected can take into account the category into which an individual or cell falls. Those of ordinary skill in the art can select suitable ranges and categories only by routine experiments. As used herein, "abnormal" means significantly different from a normal control. Abnormally high BAZ2B activity means high relative to a selected control, and may include an increase in activity in an object or cell by at least 0.1%, 0.5%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 150%, 200% or more compared to a normal control level. Abnormally low BAZ2B activity means low relative to a selected normal control, and can include a decrease of at least 0.5%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% in a subject or cell compared to a normal control level. Typically, the control is based on an apparently healthy normal individual of an appropriate age, or an apparently healthy cell.

[0062] In some aspects of the invention, the BAZ2B activity value of the determined object can be used as a control value for subsequently determining the BAZ2B activity in the same object, thereby enabling the assessment of deviations from the "baseline" BAZ2B activity in the object. Therefore, the initial BAZ2B activity level in the object can be determined, and the method and agent of the present invention are used to reduce the BAZ2B activity level in the object, with the initial level as the control level of the object. Using the method and agent of the present invention, with the treatment of the relevant disease or condition in the object, the BAZ2B activity in the object can be reduced by at least 0.5%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or more relative to the initial level. Similarly, the initial BAZ2B activity level in the object can be determined, and the method and agent of the present invention are used to increase the BAZ2B activity level in the object, with the initial level as the control level of the object. Using the methods and agents of the invention, BAZ2B activity in a subject may be increased by at least 0.5%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more relative to initial levels following treatment of a relevant disease or condition in the subject.

[0063] It will be appreciated that in addition to predetermined values, a control according to the invention may be a sample of material tested in parallel with the experimental material. Examples include samples from a control population or control samples produced by preparation to be tested in parallel with the experimental samples.

[0064] treat

[0065] The present invention relates in some aspects to a method for regulating BAZ2B activity in a cell, tissue and / or object. The term "regulation" as used herein means to change the level of BAZ2B activity in a cell (e.g., BAZ2B level and / or function). In some embodiments of the present invention, changing BAZ2B activity includes changing the level of BAZ2B in a cell or tissue. Therefore, increasing the activity of BAZ2B in a cell may include increasing the level (e.g., amount) of BAZ2B in a cell. Similarly, reducing the activity of BAZ2B in a cell may include reducing the level (e.g., amount) of BAZ2B in a cell. In some embodiments of the present invention, the level of BAZ2B may be changed or regulated by increasing the expression of BAZ2B. Therefore, some embodiments of the inventive method may include increasing or reducing the level of BAZ2B-related encoding nucleic acids or polypeptides in a cell, tissue or object, which may result in changes in BAZ2B activity in a cell, tissue or object. As described elsewhere herein, in some embodiments of the invention, cells whose levels of BAZ2B or its activity can be increased or decreased by treatment with the methods of the invention may include, but are not limited to, hepatocytes, muscle cells, cardiomyocytes, circulating cells, neuronal cells, glial cells, adipocytes, skin cells, hematopoietic cells, epithelial cells, sperm, oocytes, muscle cells, adipocytes, kidney cells, hepatocytes, or pancreatic cells.

[0066] As used herein, the term "treatment" when used in reference to a disease (e.g., a disease or condition characterized by abnormal BAZ2B activity) can refer to prophylactic treatment to reduce the likelihood that a subject will develop the disease or condition, or it can refer to treatment after a subject has developed the disease or condition in order to eliminate the disease or condition or reduce the level of the disease or condition, prevent the disease or condition from getting worse (e.g., becoming more severe), and / or slow the progression of the disease compared to the absence of treatment.

[0067] In certain embodiments of the invention, changing BAZ2B activity includes increasing or decreasing the function of BAZ2B in a cell, tissue, or object. In some such embodiments, the level of BAZ2B is not changed, but the function of one or more BAZ2B in the cell can be changed (e.g., increased or decreased). Examples of methods that can change the function of BAZ2B may include, but are not limited to, contacting BAZ2B with an antibody or its functional fragment that binds to BAZ2B and changes its function. For example, in some embodiments of the invention, antibodies that inhibit BAZ2B function can be delivered to cells as part of a treatment regimen. Similarly, in some embodiments of the invention, agents that enhance or inhibit BAZ2B function can be administered to cells or objects to cause regulation of BAZ2B activity. Agents that enhance or inhibit BAZ2B function and / or enhance or inhibit BAZ2B levels may be referred to herein as BAZ2B regulators.

[0068] In some embodiments of the present invention, BAZ2B modulators may include BAZ2B molecules, anti-BAZ2B antibodies or functional fragments thereof, small molecule BAZ2B inhibitors or small molecule BAZ2B enhancers. Examples of BAZ2B molecules include BAZ2B or nucleic acids encoding BAZ2B. As used herein, BAZ2B modulators may be agents that regulate (e.g., increase or decrease) BAZ2B activity in cells, tissues and / or objects. BAZ2B modulators that reduce or decrease BAZ2B activity may be referred to as BAZ2B downregulators, while BAZ2B modulators that increase or enhance BAZ2B activity may be referred to as BAZ2B enhancers.

[0069] Thus, an effective amount of an agent that increases or decreases BAZ2B activity can be administered to a subject in need of treatment for a relevant disease or condition. Administering an agent that increases BAZ2B activity or an agent that decreases BAZ2B activity to a subject can decrease a relevant disease or condition in the subject.

[0070] As used herein, the term "vector" refers to a nucleic acid molecule capable of transporting another nucleic acid operatively linked thereto between different genetic environments. The term "vector" also refers to a virus or organism capable of transporting nucleic acid molecules. Some useful vectors are those capable of autonomous replication and / or expression of nucleic acids linked thereto. Vectors capable of directing the expression of genes operatively linked thereto are referred to herein as "expression vectors". Other useful vectors include, but are not limited to, viruses, such as lentiviruses, retroviruses, adenoviruses, adeno-associated viruses, and bacteriophages.

[0071] The vectors that can be used in the methods of the present invention may include additional sequences, including but not limited to one or more signal sequences and / or promoter sequences or combinations thereof. Expression vectors and methods of using them are well known in the art. In certain embodiments of the present invention. Lentivirus is a non-limiting example of a vector that can be used to generate a stable cell line. The term "cell line" as used herein refers to an established cell culture that will continue to proliferate when given an appropriate culture medium.

[0072] Certain aspects of the invention include methods of administering an antibody or antigen binding fragment thereof that specifically binds to BAZ2B to change BAZ2B activity (e.g., reduce BAZ2B activity). In some embodiments of the invention, such an antibody or antigen binding fragment thereof may be administered to cells and / or objects to inhibit BAZ2B activity in cells and / or objects. The term "antigen binding fragment" of an antibody as used herein refers to one or more parts of an antibody that retains the ability to specifically bind to an antigen (e.g., BAZ2B). Antigen binding fragments of BAZ2B modulating antibodies for use in the methods of the invention may be prepared and tested using known methods and routine procedures. In some embodiments of the invention, the antibody is a recombinant antibody, a polyclonal antibody, a monoclonal antibody, a humanized antibody, or a chimeric antibody, or a mixture of these antibodies.

[0073] BAZ2B modulators of the present invention may be administered alone or in combination with one or more additional agents. In some embodiments, agents of the present invention may synergize with one or more other therapeutic agents or treatments and improve the effect of one or more therapeutic agents or activities. Therefore, BAZ2B down-regulators may synergize to improve the effect of one or more agents or treatments that may be administered to treat a related disease or condition.

[0074] Targeting agents that can be used according to the methods of the invention are those that direct the agents of the invention to specific cell types or organelles to be treated, such as hepatocytes, muscle cells, cardiomyocytes, circulating cells, neurons, glial cells, adipocytes, skin cells, hematopoietic cells, epithelial cells, sperm, oocytes, muscle cells, adipocytes, kidney cells, hepatocytes or pancreatic cells, such as mitochondria. The selection of targeting agents will depend on the nature of the disease or condition in question. In some cases, it may be desirable to target the agent to skeletal muscle, myocardium, kidney, liver, brain, etc. One of ordinary skill in the art will know and be able to select and use suitable targeting agents for the methods of the invention. Non-limiting examples of targeting agents for mitochondria are mitochondrial targeting agents based on gramicidin S, which are agents that use the carnitine-acylcarnitine translocase system, cytochrome, malate dehydrogenase.

[0075] Labeling agents can be used in the methods of the present invention to determine the localization of BAZ2B in cells and tissues, which can also be used to assess the cell, tissue or organelle location of administered therapeutic agents. Methods for attaching and using labeling agents such as enzyme labels, dyes, radioisotope labels, etc. are well known in the art.

[0076] Therapeutically effective amount

[0077] The BAZ2B modulators of the present invention (e.g., anti-BAZ2B antibodies or functional fragments thereof, BAZ2B inhibitors, etc.) are administered to a subject in an effective amount to treat a disease or condition. An "effective amount to treat a disease or condition" is an amount necessary or sufficient to achieve the desired biological effect. For example, an effective amount of an agent of the present invention may be an amount necessary to (i) slow down or stop the progression of a related disease or condition; or (ii) reverse one or more symptoms of a related disease or condition. According to some aspects of the present invention, an effective amount is an amount of an agent of the present invention alone or in combination with another drug or treatment, which, when combined or co-administered or administered alone, results in a therapeutic response to the related disease or condition in the prevention or treatment of a related disease or condition. The biological effect may be an improvement or absolute elimination of symptoms caused by a related disease or condition. In another embodiment, the biological effect is the complete elimination of a related disease or condition, as demonstrated by a diagnostic test indicating that the subject does not have the disease or condition.

[0078] Typically, in clinical trials, determine the effective amount of an agent or drug that improves BAZ2B activity or an agent or drug that reduces BAZ2B activity, and the test establishes an effective dose of a subject population relative to a control population in a blind study. In some embodiments, an effective amount is an amount that causes a desired response, such as an amount that reduces a related disease or condition in a cell or tissue of an object suffering from a related disease or condition. Therefore, the effective amount of a related disease or condition characterized by reduced BAZ2B activity and / or a related disease or condition that is desired to improve BAZ2B activity can be an amount that increases the amount of BAZ2B activity in an object to an amount higher than the amount that occurs in an object or tissue when a composition is not applied when applied. Similarly, the effective amount of a related disease or condition characterized by increased BAZ2B activity and / or a related disease or condition that is desired to reduce BAZ2B activity can be an amount that reduces the amount of BAZ2B activity in a cell, tissue, and / or object to an amount lower than the amount that occurs in an object or tissue when a composition or drug is not applied when applied. In the case of treating a disease or condition, the desired response may be to reduce or eliminate one or more symptoms of the disease or condition in a cell, tissue, and / or subject. The reduction or elimination may be temporary or may be permanent. Methods for measuring the level of BAZ2B activity or nucleic acid or polypeptide encoding BAZ2B may be used to monitor the state of the disease or condition. In some aspects of the invention, the desired response for treating a disease or condition may also be to delay the onset of the disease or condition or even prevent the onset of the disease or condition.

[0079] The effective amount of a compound (also referred to herein as a drug compound) that modulates (increases or decreases) BAZ2B activity can also be determined by assessing the physiological effects of administration on cells or subjects (e.g., reduction of the associated disease or condition after administration). Assays suitable for determining the efficacy of the drug compounds of the present invention are known to those skilled in the art and can be used to measure the level of response to treatment, and the amount of the drug compound administered to the subject can be changed at least in part based on these measurements. The therapeutic amount can be different by, for example, increasing or decreasing the amount of the therapeutic composition, changing the administered therapeutic composition, changing the route of administration, changing the time of administration, etc. The effective amount will vary with the following factors: the specific condition being treated, the age and physical condition of the subject being treated; the severity of the condition, the duration of treatment, the nature of the co-treatment (if any), the specific route of administration, and other factors within the knowledge and expertise of the health practitioner. For example, the effective amount may depend on the extent to which an individual has an abnormally low or abnormally high level of BAZ2B activity, and / or the desired level of BAZ2B activity for effective treatment of the associated disease or condition.

[0080] The effective amount of the compounds of the present invention in treating related diseases or conditions or reducing the risk of related diseases or conditions can vary depending on the specific compound used, the delivery method of the compound, and whether it is used alone or in combination. The effective amount for any particular application can also vary according to these factors, such as the related disease or condition being treated, the specific compound being administered, the size of the subject, or the severity of the related disease or condition. The technician can determine the effective amount of a specific compound of the present invention based on experience without too much experimentation. In conjunction with the teachings provided herein, by selecting between various active compounds and weighting factors, an effective preventive or therapeutic treatment regimen that is completely effective for treating a specific subject without causing a large amount of toxicity can be planned, and the weighting factors are such as efficacy, relative bioavailability, patient weight, severity of adverse side effects, and preferred mode of administration.

[0081] The dosage of the drug compound can be adjusted by a personal health care provider or veterinarian, particularly in the case of any complications. The therapeutically effective amount is usually changed between 0.01mg / kg to about 1000mg / kg, about 0.1mg / kg to about 200mg / kg or about 0.2mg / kg to about 20mg / kg, and is administered once or more times a day for one or more days. The absolute amount depends on a variety of factors, including simultaneous treatment, administration times and individual subject parameters, including age, physical condition, body shape and body weight. These are factors known to those of ordinary skill in the art, and can only be determined by routine experiments. In some embodiments, a maximum dose can be used, that is, the highest safe dose according to reasonable medical judgment.

[0082] Multiple doses of the compounds of the invention are also contemplated. In some cases, the compounds of the invention (e.g., anti-BAZ2B antibodies or functional fragments thereof, BAZ2B-related encoding nucleic acids, BAZ2B enhancers or inhibitors, etc.) can be administered at least daily, every other day, every week, every other week, every month, etc. The dose can be administered once a day or more than once a day, for example, 2, 3, 4, 5 or more times in a 24-hour cycle.

[0083] The pharmaceutical compounds of the present invention can be administered alone, in combination with each other and / or in combination with other drug treatments or other treatment regimens administered to subjects suffering from related diseases or conditions. The pharmaceutical compositions used in the aforementioned methods are preferably sterile and contain an effective amount of a therapeutic agent that modulates BAZ2B activity to a level sufficient to produce a desired response at a unit weight or volume suitable for administration to a subject.

[0084] The dosage of the composition regulating BAZ2B activity administered to the subject can be selected according to different parameters, particularly according to the mode of administration used and the state of the subject. Other factors include the desired treatment period. In the case of insufficient response in the subject when the initial dose is administered, a higher dose (or an effective higher dose by a different more localized delivery route) can be used within the tolerance of the patient.

[0085] Application method

[0086] For BAZ2B modulators, a variety of administration routes can be used. The specific delivery method selected will undoubtedly depend on the specific condition being treated and the dosage required for the therapeutic effect. In general, the method of the present invention can be implemented using any medically acceptable mode of administration, meaning a method that produces an effective level of protection without causing clinically unacceptable side effects. In some embodiments of the present invention, the compounds of the present invention can be administered orally, intestinal, mucosal, transdermal and / or parenteral. The term "parenteral" includes subcutaneous, intravenous, intramuscular, intraperitoneal and intrasternal injection or infusion techniques. Other routes include, but are not limited to, nasal (e.g., through a gastric-nasal tube), dermal, vaginal, rectal and sublingual. The delivery route of the present invention may include intrathecal, intraventricular or intracranial. In some embodiments of the present invention, the compounds of the present invention can be placed in a sustained-release matrix and administered by placing the matrix in an object. In some aspects of the invention, nanoparticles coated with delivery agents that target specific cells or organelles (a non-limiting example is mitochondria) can be used to deliver compounds (e.g., anti-BAZ2B antibodies or functional fragments thereof, BAZ2B-related encoding nucleic acids, BAZ2B enhancers or inhibitors, etc.) to target cells.

[0087] The medicament of the present invention can be administered in a preparation, which can be administered in a pharmaceutically acceptable solution, which can generally contain pharmaceutically acceptable concentrations of salt, buffers, preservatives, compatible carriers, adjuvants and optional other therapeutic ingredients. According to the inventive method, the compound can be administered in a pharmaceutical composition. Typically, the pharmaceutical composition comprises a compound of the present invention and a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers are well known to those of ordinary skill in the art. As used herein, a pharmaceutically acceptable carrier means a non-toxic material that does not interfere with the biological activity of the active ingredient, such as the ability of a compound (e.g., an anti-BAZ2B antibody or a functional fragment thereof, a BAZ2B-related encoding nucleic acid, a BAZ2B enhancer or inhibitor, etc.) to treat a related disease or condition.

[0088] Pharmaceutically acceptable carriers include diluents, fillers, salts, buffers, stabilizers, solubilizers, and other materials known in the art. Exemplary pharmaceutically acceptable carriers are known to those skilled in the art. These preparations may generally include salts, buffers, preservatives, compatible carriers, and optionally other therapeutic agents. When used in medicine, salts should be pharmaceutically acceptable salts, but non-pharmaceutically acceptable salts can be conveniently used to prepare pharmaceutically acceptable salts thereof, which are not excluded from the scope of the present invention. These pharmacologically and pharmaceutically acceptable salts include, but are not limited to, those prepared by the following acids: hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, maleic acid, acetic acid, salicylic acid, citric acid, formic acid, malonic acid, succinic acid, etc. In addition, pharmaceutically acceptable salts, such as sodium salts, potassium salts, or calcium salts, can be prepared by alkali metal salts or alkaline earth metal salts.

[0089] The compounds of the invention can be administered directly to tissues. In some embodiments, the tissue to which the compound is administered is a tissue in which a relevant disease or condition may occur. Direct tissue administration can be achieved by direct injection. The compound can be administered once, or alternatively it can be administered multiple times. If administered multiple times, the compound can be administered by different routes. For example, the first (or first few) administrations can be administered directly to the affected tissue, while subsequent administrations can be systemic.

[0090] When systemic delivery is desired, the compound can be formulated for parenteral administration by injection, for example, by bolus injection or continuous infusion. Formulations for injection can be present in unit dosage form (e.g., in ampoules or in multidose containers), with or without added preservatives. The composition can take the form of a suspension, solution or emulsion in an oil or aqueous vehicle, and can contain preparatants such as suspending agents, stabilizers and / or dispersants.

[0091] Preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils (such as olive oil) and organic esters for injection (such as ethyl oleate). Aqueous carriers include water, alcohol / aqueous solutions, emulsions or suspensions, including salts and buffered media. Parenteral vehicles include sodium chloride solution, Ringer's dextrose, glucose and sodium chloride, lactated Ringer's solution or fixed oils. Intravenous vehicles include liquid and nutritional supplements, electrolyte supplements (such as those based on Ringer's dextrose), etc. Preservatives and other additives, such as antibacterial agents, antioxidants, chelating agents and inert gases, etc., may also be present. Lower doses will be produced by other forms of administration (such as intravenous administration). In the case where the patient does not respond sufficiently to the initial dose administered, a higher dose (or an effective higher dose achieved by different more localized delivery routes) can be used within the patient's tolerance allowance. Multiple doses can be used daily as needed to obtain suitable systemic or local compound levels.

[0092] In other embodiments, the delivery vehicle is a biocompatible microparticle or implant suitable for implantation into a mammalian recipient. Exemplary biocorrodible implants that can be used according to the method include biocompatible biodegradable polymer matrices for containing biomacromolecules. These delivery methods are well known to those skilled in the art and can be used to achieve sustained release of the compounds of the invention in a subject, and can be selected to not degrade but to release over an extended period of time by diffusion.

[0093] Both non-biodegradable and biodegradable polymer matrices can be used to deliver the compounds of the invention to a subject. In some embodiments, the matrix can be biodegradable. The matrix polymer can be a natural or synthetic polymer. The polymer can be selected based on the desired release time period (usually a few hours to a year or more). Typically, a release period between a few hours and three to twelve months can be used. The polymer is optionally in the form of a hydrogel that can absorb up to about 90% of its weight of water and, optionally, further cross-linked with multivalent ions or other polymers.

[0094] Typically, biodegradable implants can be used to deliver the compounds of this invention by diffusion or by degradation of a polymer matrix. Exemplary synthetic polymers for these purposes are well known in the art. Biodegradable polymers and non-biodegradable polymers can be used to deliver the compounds of this invention using methods known in the art. Bioadhesive polymers (such as biodegradable hydrogels) can be used to deliver the compounds of this invention for treatment. Other suitable delivery systems may include time release, delayed release or sustained release delivery systems. These systems can avoid repeated administration of the compounds, improving the convenience of the object and the physician. Many types of release delivery systems are available and are known to those skilled in the art. In addition, hardware delivery systems based on pumps can be used, some of which are modified for implantation.

[0095] The use of long-term sustained release implants may be particularly suitable for the preventive treatment of an object and for an object under the risk of a related disease or condition that recurs. Long-term release as used herein means that an implant is constructed and arranged to deliver a therapeutic level of active ingredient for at least 30 days, 60 days, 90 days or longer. Long-term sustained release implants are well known to those of ordinary skill in the art, and include some in the above-mentioned release system.

[0096] The therapeutic formulations of the compounds of the present invention can be prepared to be stored in the form of a lyophilized formulation or an aqueous solution by mixing the compound with the desired purity with an optional pharmaceutically acceptable carrier, excipient or stabilizer. Acceptable carriers, excipients or stabilizers are nontoxic to recipients at the dosages and concentrations used, and include buffers such as phosphoric acid, citric acid and other organic acids; antioxidants, including ascorbic acid and methionine; preservatives (e.g., octadecyldimethylbenzyl ammonium chloride; hexamethonium chloride; benzalkonium chloride, benzethonium chloride; phenol, butyl alcohol or benzyl alcohol; alkyl parabens, such as methyl or propyl parabens; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol); low molecular weight (less than about 10 residues); proteins, such as serum albumin, gelatin or immunoglobulins; hydrophilic polymers, such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine or lysine; monosaccharides, disaccharides and other carbohydrates, including glucose, mannose or dextrins; chelating agents, such as EDTA; sugars, such as sucrose, mannitol, trehalose or sorbitol; salt-forming counterions, such as sodium; metal complexes, (e.g., Zn-glycoprotein complex); and / or nonionic surfactants, such as or polyethylene glycol (PEG).

[0097] Testing and Diagnosis

[0098] Certain aspects of the present invention include methods for assessing the state of a related disease or condition characterized by abnormal BAZ2B activity. Such methods may include determining the level or function of BAZ2B, and comparing the measured level or function with a control level or function. In some embodiments of the present invention, the method includes using an antibody or antigen binding fragment that specifically binds to BAZ2B in a determination of the level of BAZ2B or a nucleic acid or polypeptide encoding BAZ2B in a detection cell and / or object. Such a determination may include obtaining a biological sample from an object, determining the level of BAZ2B molecules in the biological sample, and comparing the level with a control level. The biological sample used herein may be an in vitro biological sample or may be a sample detected (e.g., obtained) in vivo. The biological sample used herein may be a cell sample, a tissue sample, a blood sample, a body fluid sample, a subcellular sample, etc. Biological samples may include cells, tissues or organelles, and may include a variety of cell types, such as, but not limited to, hepatocytes, muscle cells, cardiomyocytes, circulating cells, neurons, glial cells, adipocytes, skin cells, hematopoietic cells, epithelial cells, sperm, oocytes, muscle cells, adipocytes, kidney cells, hepatocytes, pancreatic cells, etc. In some embodiments of the invention, the biological sample may include one or more cancer cells. In certain embodiments of the invention, the biological sample does not include cancer cells.

[0099] Assays for evaluating a disease or condition of interest characterized by abnormal BAZ2B activity may include, but are not limited to: (1) characterizing the effect of BAZ2B activity in a subject on treatment of a disease or condition of interest; (2) evaluating changes in BAZ2B activity (e.g., level and / or function) in a subject as a result of a treatment; (3) selecting a treatment for a disease or condition of interest based at least in part on BAZ2B activity measured in cells of a subject; and (4) determining the state of a disease or condition of interest in a subject. Thus, some embodiments of the methods of the present invention may characterize a subject, monitor treatment regimens, select treatments, and better understand disease states. For example, antibodies or antigen-binding fragments thereof of the present invention and other methods of the present invention may be used to measure or determine BAZ2B activity in cells and / or subjects, which may directly indicate a disease or condition of interest in a cell and / or subject.

[0100] The present invention includes in some aspects a variety of assays for determining BAZ2B activity. The methods of the present invention can be used to determine BAZ2B activity (level and / or function of BAZ2B) in cells, tissues, objects and samples (e.g., from objects, in cultures, etc.), including but not limited to: binding assays, such as using antibodies or antigen-binding fragments thereof that specifically bind to BAZ2B; gel electrophoresis; mass spectrometry; NMR, etc. Immunoassays that can be used according to the present invention include but are not limited to: sandwich-type assays, competitive binding assays, one-step direct tests, and two-step tests, such as those commonly used in the art. The binding of antibodies that specifically bind to BAZ2B can also be evaluated in vivo (in living subjects) using detectable labels known in the art and suitable in vivo methods.

[0101] The methods and assays of the present invention (e.g., binding assays, gel electrophoresis, mass spectrometry, NMR, etc.) can be used to determine changes in BAZ2B activity over time in an object or cell sample (e.g., cell culture). This allows monitoring of BAZ2B activity in an object that is about to undergo treatment for a related disease or condition, and can also monitor an object that is currently undergoing treatment for a related disease or condition. Therefore, the methods of the present invention can be used to diagnose or evaluate a related disease or condition in an object, and can also be used to evaluate the efficacy of therapeutic treatments for a related disease or condition to evaluate the activity of BAZ2B in an object at different time points. For example, the BAZ2B activity of an object can be measured before starting a treatment regimen (preventing or treating a related disease or condition), during a treatment regimen, and / or after a treatment regimen, thereby providing status information of a related disease or condition in an object.

[0102] The assays of the invention can also be used to assess the potency of candidate BAZ2B modulators that increase or decrease the expression of BAZ2B-related encoding nucleic acids or BAZ2B in cells or tissues in cells from culture, e.g., as screening assays to assess candidate BAZ2B modulators that modulate BAZ2B activity. BAZ2B modulators that alter BAZ2B activity in cells, tissues or subjects can be used to treat a related disease or condition or as a pretreatment for a related disease or condition (e.g., to prepare cells or subjects for subsequent treatment).

[0103] It should be understood that the treatment regimen can be a related disease or condition in the prevention or treatment object. The present invention provides in some aspects a method for monitoring the response of a subject to a preventive treatment and / or treatment of a related disease or condition provided to the subject. The method of the present invention (e.g., in combination with determination, gel electrophoresis, mass spectrometry, NMR, etc.) can also be used to monitor the onset, progression or regression of a related disease or condition in a subject at risk of developing a related disease or condition. The BAZ2B activity in two, three, four or more biological samples obtained from the subject at intervals can be measured. The BAZ2B activity measured in the sample can be compared and the change in activity over time can be used to assess the state and stage of the related disease or condition in the subject (or cell or tissue sample), and / or the effect of a treatment strategy on the related disease or condition in the subject (or cell or tissue sample). By providing an index of a related disease or condition, useful prognostic information can be obtained with an antibody or fragment thereof that specifically binds to BAZ2B, and can be used to select treatment for the subject, such as selecting drug therapy, behavioral therapy, surgical treatment, etc.

[0104] Determinations described herein may include determination of BAZ2B activity, including but not limited to determination of the level of nucleic acids encoding BAZ2B in cells, tissues and objects and / or determination of the level of BAZ2B. When implementing the various methods of the present invention, the level of BAZ2B-related encoding nucleic acids or polypeptides can be determined in various ways. In some embodiments of the present invention, the level of BAZ2B-related encoding nucleic acids or polypeptides in cells, tissues or objects is measured relative to the control level of BAZ2B-related encoding nucleic acids or polypeptides. A possible measurement of a BAZ2B-related encoding nucleic acid or level is to measure the absolute level of BAZ2B-related encoding nucleic acids or polypeptides. This can be expressed as, for example, BAZ2B-related encoding nucleic acids per cell or tissue unit. Another measurement of BAZ2B-related encoding nucleic acids or levels is to measure the change in the level of BAZ2B-related encoding nucleic acids or polypeptides over time. This can be expressed as an absolute amount or as a percentage that increases or decreases over time. Antibodies or antigen-binding fragments or other compounds that specifically bind to BAZ2B or nucleic acids encoding BAZ2B can be used alone for diagnostic methods, or in combination with certain antibodies or binding compounds known in the art. Known antibodies may include antibodies that specifically bind to other proteins associated with relevant diseases or conditions or other cellular marker proteins that can be used to quantify BAZ2B-related encoding nucleic acids or levels per cellular unit, etc.

[0105] As described above, the compounds of the invention (e.g., anti-BAZ2B antibodies or functional fragments thereof, BAZ2B-related encoding nucleic acids, BAZ2B enhancers or inhibitors, etc.) can also be used to characterize BAZ2B activity by monitoring changes in BAZ2B activity over time. For example, in some related diseases and conditions, the increase in BAZ2B activity is related to the possibility of related diseases or conditions that are increased in cells and / or tissues, while in some related diseases and conditions, the reduction in BAZ2B activity is related to the possibility of related diseases or conditions that are increased in cells and / or tissues. In addition, some related diseases and conditions may not be directly characterized by abnormal BAZ2B activity, but can be treated by regulating (increasing in some cases and reducing in other cases) BAZ2B activity. In each related disease or condition, it may be desirable to assess the BAZ2B activity in treated cells, tissues or objects.

[0106] Thus, the level of BAZ2B activity over time can be monitored to determine whether the status of a disease or condition of interest in a subject or cell culture has changed. A change in BAZ2B activity, such as an increase or decrease in BAZ2B activity greater than 0.1% of a baseline activity level, a previous activity level, or a control activity level, can be used as an indicator of the efficacy of the treatment of the invention for reducing or increasing BAZ2B activity, or the need for the treatment of the invention, respectively.

[0107] In some embodiments of the invention, the increase in BAZ2B activity in a cell or tissue can be an increase in BAZ2B activity of more than 0.2%, more than 0.5%, more than 1.0%, 2.0%, 3.0%, 4.0%, 5.0%, 7.0%, 10%, 15%, 20%, 25%, 30%, 40%, 50% or more than the previous BAZ2B activity in the subject. In some embodiments of the invention, the reduction in the level of BAZ2B activity in a cell or tissue can be a reduction of more than 0.2%, more than 0.5%, more than 1.0%, 2.0%, 3.0%, 4.0%, 5.0%, 7.0%, 10%, 15%, 20%, 25%, 30%, 40%, 50% or more. The increase or decrease in the BAZ2B activity measurement value over time can indicate a change in the state of a related disease or condition in a sample or subject, the therapeutic efficacy of a related disease or condition, or the acquisition of a desired BAZ2B activity level in a related disease or condition.

[0108] For determination of the state of a disease or condition of interest, the methods of the invention can be used to determine the BAZ2B activity in two or more samples collected at different times, and compare the measured values ​​to each other and / or to the control BAZ2B activity levels. These comparisons can be used to determine the state of a disease or condition of interest in a subject and allow evaluation of the treatment of a disease or condition of interest. Comparison of the BAZ2B activity of a subject measured in biological samples obtained from a subject at different times and / or on different days can be used as a measurement of the effectiveness of any treatment for a disease or condition of interest in a subject. One of ordinary skill in the art will recognize that any changes in the BAZ2B activity of a cell occurring in response to contacting the cell with a candidate agent for treating a disease or condition of interest or a candidate agent for regulating BAZ2B activity can be used to test the effectiveness of treatment methods and candidate treatments in vitro.

[0109] One of ordinary skill in the art will appreciate that treatment may also be evaluated based on the evaluation of symptoms or clinical endpoints of the disease or condition of interest, which evaluation may be combined with the methods of the invention to assess the status of the disease or condition of interest and / or the efficacy of a treatment for the disease or condition of interest.

[0110] Reagent test kit

[0111] The present invention also includes a kit including the composition of the present invention and instructions for use. The kit of the present invention may include one or more compounds that can be used to treat related diseases or conditions or in some aspects of the present invention for diagnosing or monitoring related diseases or conditions, such as anti-BAZ2B antibodies or their functional fragments, BAZ2B-related encoding nucleic acids, BAZ2B enhancers or inhibitors, etc. A kit comprising compounds such as anti-BAZ2B antibodies or their functional fragments, BAZ2B-related encoding nucleic acids, BAZ2B enhancers or inhibitors, etc., can be prepared for use in methods of treatment, in vitro diagnosis, prognosis and / or use of any suitable histology, cytology, serology or other methods to monitor the BAZ2B activity level in cells, tissues and / or objects. The components of the kit of the present invention may be packaged in an aqueous medium or in a lyophilized form. The kit of the present invention may include a carrier that is zoned to tightly accommodate one or more container devices or a series of container devices (such as test tubes, vials, flasks, bottles, syringes, etc.). The first container device or container device series may contain one or more compounds, such as anti-BAZ2B antibodies or functional fragments thereof, BAZ2B-related encoding nucleic acids, BAZ2B enhancers or inhibitors, etc. The second container device or container device series may contain a targeting tag or linker-tag intermediate capable of delivering the compound to a cell or tissue.

[0112] The kits of the invention may also include instructions. The instructions are generally in written form and provide guidance for performing a specific assay or treatment using the kit and guidance for performing a determination based on the assay or treatment.

[0113] Methods for Identifying Candidate Compounds

[0114] Some aspects of the present invention include methods for identifying and / or screening candidate agents for regulating BAZ2B activity in cells, tissues and / or objects. The method may include mixing the candidate agent with cells or tissues or mixing it into the object, and measuring the BAZ2B activity before and after contact with the candidate agent. Compared with appropriate controls, the increase in the amount of BAZ2B activity indicates that the agent can increase BAZ2B levels. Compared with appropriate controls, the reduction in the amount of BAZ2B activity indicates that the agent can reduce BAZ2B levels.

[0115] The assay mixture that can be used to evaluate the candidate treatment for the relevant disease or condition comprises a candidate agent. The candidate agent can be an antibody, a small organic compound, a small molecule, a polypeptide, a nucleic acid, etc., and can therefore be selected from a combinatorial antibody library, a combinatorial protein library, a small organic molecule library, or any other suitable source. Typically, a plurality of reaction mixtures with different agent concentrations are measured in parallel to obtain different responses for a variety of concentrations. Typically, one of these concentrations is used as a negative control, that is, the agent concentration is 0 or below the agent concentration at the detection limit.

[0116] Candidate agents that can be tested to determine whether they can be used to modulate BAZ2B activity and whether they can be used to treat related diseases or conditions may include numerous chemical substances, nucleic acids, proteins, etc. In some embodiments of the present invention, candidate agents are small organic compounds, i.e., molecular weights of more than 50, but less than about 2500, preferably less than about 1000, and more preferably less than about 500. Candidate agents include chemical functional groups necessary for structural interactions with and / or nucleic acids, and typically include at least amino, carbonyl, hydroxyl or carboxyl, preferably include at least two of the chemical functional groups, more preferably at least 3 of the chemical functional groups. Candidate agents may include cyclic carbon or heterocyclic structures and / or aromatic or polyaromatic structures substituted by one or more of the above functional groups. Candidate agents may also be biomolecules such as, sugars, fatty acids, sterols, isoprenoids, purines, pyrimidines, derivatives or structural analogs of the above substances, or combinations thereof, etc.

[0117] Candidate agents are obtained from a variety of sources, including libraries of synthetic or natural compounds. For example, a variety of means can be used for random and directed synthesis of a variety of organic compounds and biomolecules, including expression of randomized oligonucleotides, synthetic organic combinatorial libraries, random or non-random phage display libraries, combinatorial libraries of proteins or antibodies, etc. Alternatively, libraries of natural compounds in the form of bacterial, fungal, plant and animal extracts are available or easily generated. In addition, natural and synthetically produced libraries and compounds can be easily modified by conventional chemical, physical and biochemical methods. In addition, known agents can be directed or randomly chemically modified, such as acylation, alkylation, esterification, amidination to produce structural analogs of agents.

[0118] A variety of other reagents may also be included in the assay mixture to test candidate compounds. These may include reagents such as salts, buffers, neutral proteins (e.g., albumin), detergents, etc., which can be used to help optimize the combination of protein-protein and / or protein-reagent. Such reagents may also reduce the non-specific or background interactions of the reaction components. Other reagents that improve the assay effectiveness may also be used, such as protease inhibitors, nuclease inhibitors, antimicrobial agents, etc. The order of adding components, incubation temperature, incubation time, and other assay parameters may be easily determined. Such experiments only involve optimizing assay parameters, rather than the basic composition of the assay. The incubation temperature is typically 4°C to 40°C. The incubation time may be minimized to facilitate rapid, high-throughput screening, typically 0.1 to 10 hours. After incubation, variables such as the presence or absence of BAZ2B and BAZ2B activity may be detected by conventional methods available to the user. For example, BAZ2B activity may be determined using standard methods and by measuring detectable markers as described herein.

[0119] Some examples are provided below to illustrate specific examples of implementing the present invention, which are not intended to limit the scope of the present invention. It will be apparent to those skilled in the art that the present invention will find application in a variety of compositions and methods.

[0120] Example

[0121] Example 1. Materials and methods

[0122] 1. Construction of BAZ2B knockout mice using CRISPR / Cas9 method

[0123] The mouse BAZ2B gene has 14 transcripts, of which 4 transcripts encode proteins, including 2 long transcripts and 2 very short transcripts. The proteins encoded by the 2 long transcripts are exactly the same, and sgRNA is designed in the exon region where the start codon ATG is located:

[0124] sgRNA1: ATCATCTTCTGCTCCTTCCGTGG (SEQ ID NO: 1);

[0125] sgRNA2: AGATGATGTTGGTGTAGTGGAGG (SEQ ID NO: 2).

[0126] The above sgRNA (two were constructed into the plasmid separately) was constructed into the HP180Cass9 plasmid, and the sgRNA (two were transcribed separately and mixed 1:1) and cas9mRNA were transcribed in vitro and injected into mouse fertilized eggs to obtain F0 generation mice. The genotype of the F0 generation mice was analyzed by PCR, and then the genotype knockout homozygous mice were obtained by hybridization.

[0127] 2. Inducing NASH-liver fibrosis mouse model using a high-fat diet

[0128] 1-2 months BAZ2B knockout heterozygous, homozygous and wild-type mice were randomly divided into a control group and a choline-deficient, L-amino acid-defined, high-fat diet (CDAHFD) group. The normal group mice were fed with normal diet, and the CADHFD group mice were fed with A06071302 (choline-free high-fat diet). The mice were fed for 8 consecutive weeks, and their body weight was measured every week. After the experiment, samples and serum were collected to measure liver function and histopathological changes.

[0129] 3. Histopathological Scoring of Mouse Liver

[0130] The liver paraffin sections were sectioned and stained with H&E, Oil red and Sirius red. The European fatty liver progression blockade histological scoring system (SAF) was used to score the pathological characteristics of the mouse liver sections, including hepatocyte steatosis, ballooning, lobular inflammation and fibrosis.

[0131] 4. Mouse liver mitochondrial oxygen consumption rate (OCR) detection

[0132] Seahorse was used to analyze the oxygen consumption rate (OCR) of mouse liver mitochondria. 10ug of liver mitochondria were placed in 50ul of mitochondrial analysis solvent (MAS), centrifuged at 2000g for 10min, 450ul of substrate was added, and the mitochondrial OCR after adding ADP, oligomycin, FCCP, rotenone + antimycin was detected in sequence.

[0133] 5. RNAscope staining

[0134] Using Advanced Cell Diagnostic (ACD) Technology was used to detect the expression level of BAZ2B mRNA in human and mouse liver.

[0135] Specific experimental results

[0136] Example 2. BAZ2B gene expression is significantly increased in the liver of NAFLD / NASH patients

[0137] By using RNAscope technology to specifically label BAZ2B mRNA, the inventors found that the expression level of BAZ2B in the liver of NAFLD / NASH patients was significantly higher than that in the liver of normal people ( Figure 1 a, b). Especially in the liver of NAFLD / NASH patients, BAZ2B expression around the lesion area is significantly higher than that in the normal area ( Figure 1 d, e, f). In addition, by analyzing the BAZ2B expression levels in the liver of normal people / obese NAFLD / NASH patients in the human gene database (GSE61260), it was found that the BAZ2B mRNA level in the liver of obese NAFLD / NASH patients was higher than that in normal patients ( Figure 1 c) These results suggest that increased BAZ2B expression is associated with the pathological progression of NAFLD / NASH.

[0138] Example 3. BAZ2B knockout inhibits liver steatosis in aged mice

[0139] In order to explore the regulatory role of the BAZ2B gene in aging-related hepatic steatosis, the inventors used the CRISPR / Cas9 method to construct BAZ2B knockout mice. In order to perform mouse liver histopathological scoring, heterozygous, homozygous and wild-type mice with BAZ2B knockout were bred by BAZ2B knockout heterozygous mice. The changes in liver weight during aging in heterozygous, homozygous and wild-type mice with BAZ2B knockout were analyzed with age. The results showed that wild-type mice showed age-dependent liver weight gain, while the relative weight ratio of the liver of heterozygous, homozygous and wild-type mice with BAZ2B knockout was not much different in young age ( Figure 2 a, c), in the old stage, the liver-to-body weight ratio of BAZ2B knockout heterozygous, homozygous and wild-type mice was not much different, but the liver size and weight of BAZ2B knockout homozygous mice were significantly smaller than those of wild-type mice ( Figure 2 a, b).

[0140] Hematoxylin-eosin staining (H&E) and oil red staining (the former is a staining method that specifically marks the nucleus and cytoplasm, and the latter is a staining method that specifically marks fat) revealed that BAZ2B knockout mice had significantly reduced liver fatty degeneration compared with wild-type mice ( Figure 2 d, e, f).

[0141] These results suggest that BAZ2B knockout can suppress hepatic steatosis in aged mice.

[0142] Example 4. BAZ2B alleviates age-related hepatic steatosis by regulating liver mitochondrial function

[0143] Next, we explored the potential mechanism by which BAZ2B improves age-related liver steatosis. Using RNAscope technology, we found that compared with young wild-type mice, the expression level of BAZ2B mRNA in the liver of old wild-type mice was significantly increased ( Figure 3 a, b). The inventors' previous work found that BAZ2B can regulate the expression of genes related to mitochondrial function in brain tissue. RNA-seq analysis showed that the expression levels of genes related to fat metabolism, redox, PPAR and insulin signaling pathway in the liver of aged BAZ2B knockout mice were higher than those in wild-type mice ( Figure 3 d). By extracting mouse liver mitochondria and measuring oxygen respiration rate (OCR), it was found that the mitochondrial activity in the liver of BAZ2B knockout mice was higher than that of wild-type mice ( Figure 3 c). At the same time, the expression of genes related to lipid metabolism in the liver of BAZ2B knockout aged mice increased significantly, suggesting that BAZ2B knockout promoted lipid metabolism in aged mice.

[0144] In addition, the inventors found through glucose tolerance experiments that aged wild-type mice showed a certain degree of insulin resistance, while BAZ2B knockout mice did not show insulin resistance ( Figure 3 e). More excitingly, through metabolic cage testing, we found that the respiratory gas exchange rate (RER, RER = VCO2 / VO2) of aged BAZ2B knockout mice was significantly higher than that of aged wild-type mice, suggesting that knocking out BAZ2B can improve the overall metabolic function of aged mice ( Figure 3 f).

[0145] These results suggest that BAZ2B protein regulates the process of age-related liver steatosis by regulating the expression of genes related to liver mitochondrial function, affecting liver lipid deposition and insulin resistance levels.

[0146] Example 5. BAZ2B knockout can inhibit liver fibrosis in CDAHFD model mice

[0147] The inventors then explored whether BAZ2B is involved in the development of NASH. The mouse NASH model was successfully established by feeding mice with A06071302 (choline-free high-fat diet, CDAHFD) for 8 consecutive weeks. Figure 4 a, b). Liver function tests showed that the levels of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) in wild-type mice fed with CDAHFD were significantly higher than those in the control group, while the levels of ALT and AST in BAZ2B knockout mice fed with CDAHFD were lower than those in the former group ( Figure 4 c, d), indicating that BAZ2B gene knockout can improve liver function in mice fed with CDAHFD. H&E and Sirius red staining results showed that CDAHFD-fed wild-type mice had significant fatty degeneration, inflammatory infiltration, and fibrosis in the liver, while CDAHFD-fed BAZ2B knockout mice also had significant fatty degeneration, but inflammatory infiltration / fibrosis were significantly improved compared with wild-type mice ( Figure 4 ei). These results indicate that BAZ2B knockout can significantly reduce the level of liver fibrosis in mice fed CDAHFD.

[0148] RNA-seq analysis was performed on the livers of six groups of mice with three genotypes (BAZ2B knockout heterozygous, homozygous, and wild-type) and two feeding methods (normal diet, CDAHFD diet). It was found that under CDAHFD feeding conditions, the expression levels of genes related to fat metabolism, redox, and PPARα pathway in the liver of BAZ2B knockout mice were significantly upregulated compared with wild-type mice, while the immune-related pathways were significantly downregulated ( Figure 5 ac). Previous studies have shown that PPARα and immune regulatory factor IRF7 play an important role in the pathological process of NAFLD / NASH [14-16]. By verifying the RNA-seq results through qPCR, the present inventors found that the expression changes of PPARα-related pathway genes (PPARα / Acsl1 / Acox1) and immune genes (Ifit2 / Ifit3 / IRF7 / TLR2) were consistent with the RNA-seq results ( Figure 5 dk). In addition, by analyzing the human liver gene expression database GSE130970, the inventors found that the expression of IRF7 in the liver of patients with severe NAFLD (NAFLD score greater than 3) was significantly higher than that in the healthy control group ( Figure 5 l). These results suggest that BAZ2B protein affects the occurrence and development of liver inflammation and fibrosis by simultaneously regulating PPARα and interferon signaling-related regulatory factors.

[0149] Example 6. Antisense oligonucleotides (ASOs) targeting BAZ2B can inhibit liver fibrosis in mice

[0150] The mouse BAZ2B and human BAZ2B gene sequences are highly similar ( Figure 6 a), therefore, the present inventors designed three antisense oligonucleotide (ASO) sequences based on the start codon region, the middle region and the terminal region of the full sequence of the BAZ2B gene:

[0151] Start codon region: ASO1:ATGGCAACAGTTCTCCAGACTCCAT;

[0152] Middle region: ASO2:AGCCTTCTGCTGCCTACCCATAGTC;

[0153] Terminal region: ASO3: GGATACCTGAAAGGAAACACATCGT.

[0154] BAZ2B-specific ASO was synthesized by GENE TOOLS, and then ASO was given to NASH model mice fed with CDAHFD by intraperitoneal injection every week. The pathological characteristics of NASH mice were detected after 8 consecutive weeks. H&E and Sirius red staining results showed that the inflammatory infiltration and fibrosis of mice treated with ASO1, ASO2 and ASO3 were significantly improved compared with wild-type mice ( Figure 6 eg), and the ALT and AST levels of BAZ2B ASO-1, 2, and 3 were significantly lower than those of the experimental group ( Figure 6 c, d). These results indicate that BAZ2BASO can inhibit the level of liver fibrosis in CDAHFD model mice.

[0155] In addition to the above three ASO sequences, the inventors also designed 11 siRNA sequences for the full sequence of mouse BAZ2B mRNA (see Table 1), and performed knockdown verification in the AML12 mouse liver cell line. The results showed that all 11 siRNA sequences could effectively knock down the expression level of BAZ2B mRNA in the cell line ( Figure 7 ).

[0156] Table 1. siRNA targeting the complete sequence of mouse BAZ2B mRNA

[0157]

[0158] Example 7. Liver-specific knockdown of BAZ2B inhibits liver steatosis and fibrosis in CDAHFD model mice

[0159] The inventors then explored whether specific knockdown of liver BAZ2B could inhibit liver fibrosis in CDAHFD model mice. Liver-specific knockdown BAZ2B virus (TBG-Baz2b, sequence: cttaacttggagaaagagcct) or liver-specific knockdown control virus (TBG-NC, sequence: cacgtgacacgttcggagaat) was administered to 8-week-old mice by tail vein injection. Four weeks later, the mice were fed with A06071302 feed, and the pathological characteristics of NASH mice were detected after 8 consecutive weeks. H&E and Sirius red staining results showed that fatty degeneration, inflammatory infiltration and fibrosis in the TBG-Baz2b-treated group were significantly improved compared with wild-type mice ( Figure 8 dh), and the ALT and AST levels in the TBG-Baz2b-treated group were significantly lower than those in the experimental group ( Figure 8 b, c). These results indicate that liver-specific knockdown of BAZ2B can suppress hepatic steatosis and fibrosis in CDAHFD model mice.

[0160] discuss

[0161] By comparing the livers of normal and NAFLD patients, the inventors found that the expression level of BAZ2B in the liver of NAFLD patients increased significantly. During the aging process, the weight of wild-type mice gradually increased with age, and the weight of the liver also gradually increased. The liver weight of BAZ2B knockout mice was significantly lower than that of wild-type mice in the old stage, but the liver weight of BAZ2B knockout and wild-type mice was not much different in the young stage; in addition, knocking out BAZ2B can inhibit fatty changes in the liver of elderly mice. In the NASH mouse model constructed by feeding CDAHFD feed, knocking out BAZ2B can significantly inhibit the levels of inflammatory infiltration and fibrosis in the liver of mice. In particular, when BAZ2B expression in the liver was specifically knocked down, not only the levels of inflammatory infiltration and fibrosis in the liver were significantly improved, but also fatty lesions were significantly reduced. Mechanism studies have found that in the liver of elderly mice, BAZ2B can regulate the expression of genes related to mitochondrial function, thereby regulating the mitochondrial function of the liver, and further causing insulin resistance. In the liver of CDAHFD model mice, BAZ2B can regulate the expression of immune-related genes, activate interferon signal-related regulatory factors, and promote inflammatory response. These results reveal that BAZ2B plays an important role in the progression of NAFLD / NASH and BAZ2B can be used as a target to develop corresponding drugs and methods for the treatment and prevention of NAFLD / NASH.

[0162] Based on the above new discovery of the inventors, the present invention provides a use of a down-regulator of a BAZ2B protein or its encoding gene for preparing a pharmaceutical composition for treating and preventing NAFLD / NASH diseases. As used herein, the down-regulator of the BAZ2B protein or its encoding gene includes inhibitors, antagonists, blockers, blocking agents, etc., and these terms are used interchangeably. The down-regulator of the BAZ2B protein or its encoding gene refers to any substance that can reduce the activity of the BAZ2B protein, reduce the stability of the BAZ2B protein or its encoding gene, down-regulate the expression of the BAZ2B protein, reduce the effective action time of the BAZ2B protein, or inhibit the transcription and translation of the BAZ2B gene. These substances can be used in the present invention as substances useful for down-regulating BAZ2B, thereby being used to improve NAFLD / NASH diseases.

[0163] As a selection method of the present invention, the down-regulator can be a variety of oligonucleotide drugs for BAZ2B, including antisense oligonucleotides (ASO), small interfering RNA (siRNA), microRNA (miRNA), and nucleic acid aptamers. For example, it is demonstrated in the examples that BAZ2B ASO can effectively inhibit the level of fibrosis in the liver of CDAHFD model mice. As a selection method of the present invention, the down-regulator can be a small molecule compound for BAZ2B. Those skilled in the art can use conventional screening methods in the art to screen such small molecule compounds. As a selection method of the present invention, the down-regulator can be a BAZ2B-specific interfering RNA molecule (shRNA), and those skilled in the art can understand that such interfering RNA molecules can be prepared according to the BAZ2B gene sequence provided in the present invention. There is no particular limitation on the preparation method of interfering RNA molecules, including but not limited to: chemical synthesis, in vitro transcription, etc. The interfering RNA can be delivered to cells by using an appropriate transfection reagent, or it can also be delivered to cells using a variety of techniques known in the art. As a preferred embodiment of the present invention, the CRISPR / Cas (such as Cas9) system can be used for targeted gene editing, thereby knocking out the BAZ2B gene in the region of the targeted disease. Common methods for knocking out the BAZ2B gene include: co-transferring sgRNA or a nucleic acid capable of forming the sgRNA, Cas9mRNA or a nucleic acid capable of forming the Cas9mRNA into a targeted region or a targeted cell. After the target site is determined, a known method can be used to introduce sgRNA and Cas9 into the cell. The nucleic acid capable of forming the sgRNA is a nucleic acid construct or an expression vector, or the nucleic acid capable of forming the Cas9mRNA is a nucleic acid construct or an expression vector, and these expression vectors are introduced into the cell, thereby forming active sgRNA and Cas9mRNA in the cell. Particularly preferably, the gene editing reagent is an sgRNA selected from the following group: SEQ ID NO: 1, SEQ ID NO: 2, which has very good targeting, and as verified by the examples, its effect on alleviating aging is very significant.

[0164] In the present invention, it is revealed that BAZ2B plays an important regulatory role in treating and preventing the occurrence and development of NAFLD / NASH diseases. For example, it is demonstrated in the examples that the expression level of BAZ2B in the liver of NAFLD patients is significantly increased. Based on the above new findings of the inventors, BAZ2B can be used as a marker for the diagnosis and prognosis evaluation of NAFLD / NASH diseases: (i) for the classification, differential diagnosis, and / or susceptibility analysis of NAFLD / NASH diseases; (ii) for the evaluation of NAFLD / NASH disease therapeutic drugs, drug efficacy, prognosis, and the selection of appropriate treatment methods. For example, a population with abnormal BAZ2B gene expression can be isolated, so that more targeted treatment can be carried out.

[0165] By judging the expression or activity of BAZ2B in the sample to be evaluated, the prognosis of NAFLD / NASH disease of the subject providing the sample to be evaluated can be predicted, and the appropriate drug can be selected for treatment. Generally, a threshold value of BAZ2B can be specified. When the expression of BAZ2B is higher than the specified threshold value, a scheme of inhibiting BAZ2B is considered for treatment. The threshold value is easy to determine for those skilled in the art. For example, the threshold value of abnormal BAZ2B expression can be obtained by comparing the expression of BAZ2B in normal human cells or tissues with the expression of BAZ2B in patient cells or tissues. Therefore, the present invention provides the use of BAZ2B protein or its encoding gene for the preparation of reagents or kits for the diagnosis or prognosis evaluation of NAFLD / NASH diseases. Various techniques known in the art can be used to detect the presence or absence of BAZ2B gene and its expression, and these techniques are all included in the present invention. For example, existing techniques such as Southern blotting, Western blotting, DNA sequence analysis, PCR, etc. can be used, and these methods can be used in combination.

[0166] References:

[0167] 1.Younossi, ZM, et al., Global epidemiology ofnonalcoholic fatty liverdisease-Meta-analytic assessment of prevalence, incidence, and outcomes. Hepatology, 2016.64(1):p.73-84.

[0168] 2.Loomba,R.,S.L.Friedman,and G.I.Shulman,Mechanisms and diseaseconsequences ofnonalcoholic fatty liver disease.Cell,2021.184(10):p.2537-2564.

[0169] 3.Powell,E.E.,V.W.Wong,and M.Rinella,Non-alcoholic fatty liverdisease.Lancet,2021.397(10290):p.2212-2224.

[0170] 4.Bessone,F.,M.V.Razori,and M.G.Roma,Molecular pathways ofnonalcoholic fatty liver disease development and progression.Cell Mol LifeSci,2019.76(1):p.99-128.

[0171] 5.Buzzetti,E.,M.Pinzani,and E.A.Tsochatzis,The multiple-hitpathogenesis ofnon-alcoholic fatty liver disease(NAFLD).Metabolism,2016.65(8):p.1038-48.

[0172] 6.Bayoumi,A.,et al.,The Epigenetic Drug Discovery Landscape forMetabolic-associated Fatty Liver Disease.Trends Genet,2020.36(6):p.429-441.

[0173] 7.Hunt,N.J.,et al.,Hallmarks ofAging in the Liver.Comput StructBiotechnol J,2019.17:p.1151-1161.

[0174] 8.Papatheodoridi,A.M.,et al.,The Role ofSenescence in the Developmentof Nonalcoholic Fatty Liver Disease and Progression to NonalcoholicSteatohepatitis.Hepatology,2020.71(1):p.363-374.

[0175] 9.Meijnikman,A.S.,et al.,Evaluating causality ofcellular senescencein non-alcoholic fatty liver disease.JHEP Rep,2021.3(4):p.100301.

[0176] 10.Zaware,N.and M.M.Zhou,Bromodomain biology and drug discovery.NatStruct Mol Biol,2019.26(10):p.870-879.

[0177] 11.Jia,Y.,et al.,In vivo CRISPR screening identifies BAZ2 chromatinremodelers as druggable regulators ofmammalian liver regeneration.Cell StemCell,2022.29(3):p.372-385e8.

[0178] 12.Yuan,J.,et al.,Two conserved epigenetic regulators prevent healthyageing.Nature,2020.579(7797):p.118-122.

[0179] 13.Quek,J.,et al.,Global prevalence ofnon-alcoholic fatty liverdisease and non-alcoholic steatohepatitis in the overweight and obesepopulation:asystematic review and meta-analysis.Lancet Gastroenterol Hepatol,2023.8(1):p.20-30

[0180] 14.Liu,H.,et al.,TLR3 / 4signaling is mediated via the NFkappaB-CXCR4 / 7pathway in human alcoholic hepatitis and non-alcoholic steatohepatitis whichformed Mallory-Denk bodies.Exp Mol Pathol,2014.97(2):p.234-40.

[0181] 15.Siddiqui,M.S.,et al.,A Phase 2Double Blinded,Randomized ControlledTrial of Saroglitazar in Patients With Nonalcoholic Steatohepatitis.ClinGastroenterol Hepatol,2021.19(12):p.2670-2672.

[0182] 16.Pawlak,M.,P.Lefebvre,and B.Staels,Molecular mechanism of PPARalphaaction and its impact on lipid metabolism,inflammation and fibrosis in non-alcoholic fatty liver disease.J Hepatol,2015.62(3):p.720-33.

[0183] Although multiple embodiments of the present invention have been described and illustrated herein, a person of ordinary skill in the art will readily conceive of various other means and / or structures for implementing the functions described herein and / or obtaining the results and / or one or more advantages, and each such change and / or modification is considered to be included within the scope of the present invention. More generally, it will be readily understood by those skilled in the art that all parameters, dimensions, materials and configurations described herein are intended to be examples, and the actual parameters, dimensions, materials and / or configurations will depend on the specific application for which the teachings of the present invention are used. Those skilled in the art will recognize or be able to determine many equivalents to the specific inventive embodiments described herein using only routine experiments. Therefore, it should be understood that the foregoing embodiments are presented only by way of example, and within the scope of the appended claims and their equivalents; the present invention can be implemented in a manner different from that specifically described and claimed. The present invention relates to each individual feature, system, article, material and / or method described herein. In addition, if these features, systems, articles, materials and / or methods do not contradict each other, any combination of two or more of these features, systems, articles, materials and / or methods is also included within the scope of the invention disclosed herein.

[0184] All definitions, as defined and used herein, should be understood to control over dictionary definitions, definitions in documents incorporated by reference, and / or ordinary meanings of the defined terms.

[0185] In this specification and claims, nouns without quantifiers should be understood as "at least one" unless explicitly mentioned to the contrary.

[0186] The phrase "and / or" used herein in the specification and claims should be understood to mean "either or both" of the connected elements, that is, in some cases the elements are present simultaneously, and in other cases they are present alone. In addition to the elements explicitly mentioned in the "and / or" clause, other elements may optionally be present, whether related or unrelated to the elements explicitly mentioned, unless explicitly mentioned to the contrary.

[0187] All references, patents and patent applications, and publications cited or referenced in this application are hereby incorporated by reference in their entirety.

Claims

1. An agent for regulating BAZ2B expression or activity, wherein the agent is a downregulator for the BAZ2B gene or the protein encoded by it. 2 . The agent according to claim 1 , wherein the down-regulator is selected from the group consisting of an agent that down-regulates the expression level of the BAZ2B gene and an agent that down-regulates the function of the BAZ2B protein.

3. The agent according to claim 2, wherein the reagent for down-regulating the expression level of the BAZ2B gene is selected from a gene editing reagent that specifically knocks out the BAZ2B encoding gene and an interfering molecule that specifically interferes with the expression of the BAZ2B encoding gene, and the reagent for down-regulating the function of the BAZ2B protein is selected from an antibody or ligand that specifically binds to the BAZ2B protein.

4. The agent according to claim 2, wherein the down-regulator is a gene editing agent that specifically knocks out the BAZ2B encoding gene.

5. The agent according to claim 4, wherein the down-regulator comprises a CRISPR / Cas system, the system comprising sgRNA or a nucleic acid capable of forming the sgRNA, and mRNA encoding a Cas protein or a nucleic acid capable of forming the mRNA.

6. The agent according to claim 5, wherein the Cas protein is Cas9 protein.

7. The agent according to claim 5, wherein the gene editing reagent comprises an sgRNA or a nucleic acid capable of forming the sgRNA selected from the following: SEQ ID NO: 1 and SEQ ID NO:

2.

8. The agent according to claim 2, wherein the down-regulator is an interfering molecule that specifically interferes with the expression of the BAZ2B encoding gene, and the interfering molecule is selected from antisense oligonucleotides (ASO), small interfering ribonucleic acid (siRNA), micro RNA (miRNA) and nucleic acid aptamers. 9 . The agent according to claim 8 , wherein the down-regulator is an antisense oligonucleotide targeting BAZ2B.

10. The agent according to claim 9, wherein the down-regulator has an antisense oligonucleotide sequence selected from the group consisting of: ATGGCAACAGTTCTCCAGACTCCAT; AGCCTTCTGCTGCCTACCCATAGTC; and GGATACCTGAAAGGAAACACATCGT. The agent according to claim 9 , wherein the down-regulator has an antisense oligonucleotide sequence selected from siRNA ID NOs: 1 to 11.

12. A composition for modulating BAZ2B expression or activity, comprising an agent according to any one of claims 1 to 11.

13. The composition of claim 12, further comprising a pharmaceutically acceptable carrier for delivering the agent.

14. The composition of claim 12 or 13, wherein the vector comprises a virus, including a lentivirus, a retrovirus, an adenovirus, and an adeno-associated virus.

15. The composition of claim 12 or 13, wherein the carrier comprises a liposome.

16. The composition according to claim 12 or 13, further comprising a targeting agent for targeting the agent to a diseased area or cell.

17. Use of an agent according to any one of claims 1 to 11 or a composition according to any one of claims 12 to 16 for the preparation of a medicament for the treatment and / or prevention of a disease or disorder.

18. The use according to claim 17, wherein the disease or disorder is a disease or disorder related to liver lipid metabolism.

19. The use according to claim 18, wherein the metabolic-related disease or condition is selected from overweight, weight gain, obesity, nonalcoholic fatty liver disease, diabetes, insulin resistance, alcoholic fatty liver disease, dyslipidemia, steatosis, hepatic steatosis, cardiac steatosis, renal steatosis, muscle steatosis, abetalipoproteinemia, glycogen storage disease, Weil-Crutchberg disease, lipodystrophy; liver disease, liver inflammation, hepatitis, steatohepatitis, hepatitis C, genotype 3 hepatitis C, alpha 1-antitrypsin deficiency, acute fatty liver, Wilson's disease; kidney disease; heart disease, hypertension, ischemia, heart failure, cardiomyopathy; poisoning; HIV; neurodegenerative diseases, Parkinson's disease, Alzheimer's disease; cancer; exercise-induced conditions; high cholesterol; eating disorders, anorexia, starvation, malnutrition, total parenteral nutrition, severe weight loss, underweight, refeeding syndrome; metabolic changes mediated by gastrointestinal surgery, jejuno-iliac bypass, gastric bypass; and inflammatory / infectious conditions, jejunal diverticulosis with bacterial overgrowth, or inflammatory bowel disease.

20. Use according to claim 17 or 18, wherein the disease or condition is selected from non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH) and obesity.

21. Use of a reagent for detecting BAZ2B expression or activity in the preparation of a kit for disease diagnosis and prognosis assessment.

22. The use according to claim 21, wherein the disease is a disease or disorder related to liver lipid metabolism.

23. The use according to claim 22, wherein the metabolic-related disease or condition is selected from overweight, weight gain, obesity, nonalcoholic fatty liver disease, diabetes, insulin resistance, alcoholic fatty liver disease, dyslipidemia, steatosis, hepatic steatosis, cardiac steatosis, renal steatosis, muscle steatosis, abetalipoproteinemia, glycogen storage disease, Weil-Crutchberg disease, lipodystrophy; liver disease, liver inflammation, hepatitis, steatohepatitis, hepatitis C, genotype 3 hepatitis C, alpha 1-antitrypsin deficiency, acute myeloid leukemia during pregnancy fatty liver, Wilson's disease; kidney disease; heart disease, hypertension, ischemia, heart failure, cardiomyopathy; poisoning; HIV; neurodegenerative diseases, Parkinson's disease, Alzheimer's disease; cancer; exercise-induced conditions; high cholesterol; eating disorders, anorexia, starvation, malnutrition, total parenteral nutrition, severe weight loss, underweight, refeeding syndrome; metabolic changes mediated by gastrointestinal surgery, jejuno-iliac bypass, gastric bypass; and inflammatory / infectious conditions, jejunal diverticulosis with bacterial overgrowth, or inflammatory bowel disease.

24. Use according to claim 21 or 22, wherein the disease or condition is selected from non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH) and obesity.

25. The use according to claim 21 or 22, wherein the kit is used for typing, differential diagnosis, and / or susceptibility analysis of NAFLD / NASH diseases.

26. The use according to claim 21 or 22, wherein the kit is used to evaluate NAFLD / NASH disease therapeutic drugs, drug efficacy, prognosis, or to select a suitable treatment method.

27. A method for treating a disease or disorder, the method comprising administering to a subject in need thereof a medicament according to any one of claims 1 to 11 or a composition according to any one of claims 12 to 16.

28. The method of claim 27, wherein the disease is a disease or disorder associated with hepatic lipid metabolism.

29. The method of claim 28, wherein the metabolic-related disease or condition is selected from the group consisting of overweight, weight gain, obesity, nonalcoholic fatty liver disease, diabetes, insulin resistance, alcoholic fatty liver disease, dyslipidemia, steatosis, hepatic steatosis, cardiac steatosis, renal steatosis, muscle steatosis, abetalipoproteinemia, glycogen storage disease, Weil-Crutchberg disease, lipodystrophy; liver disease, liver inflammation, hepatitis, steatohepatitis, hepatitis C, genotype 3 hepatitis C, alpha 1-antitrypsin deficiency, acute myeloid leukemia during pregnancy, fatty liver, Wilson's disease; kidney disease; heart disease, hypertension, ischemia, heart failure, cardiomyopathy; poisoning; HIV; neurodegenerative diseases, Parkinson's disease, Alzheimer's disease; cancer; exercise-induced conditions; high cholesterol; eating disorders, anorexia, starvation, malnutrition, total parenteral nutrition, severe weight loss, underweight, refeeding syndrome; metabolic changes mediated by gastrointestinal surgery, jejuno-iliac bypass, gastric bypass; and inflammatory / infectious conditions, jejunal diverticulosis with bacterial overgrowth, or inflammatory bowel disease.

30. The method of claim 27 or 28, wherein the disease or condition is selected from non-alcoholic fatty liver disease (NAFLD), non-alcoholic steatohepatitis (NASH), and obesity.

31. A method for regulating the expression level or activity of BAZ2B in a cell, the method comprising administering to a subject in need thereof an agent according to any one of claims 1 to 11 or a composition according to any one of claims 12 to 16.

Images