Preparation and application of rabies virus circular RNA (Ribonucleic Acid) molecule

Abstract

The invention discloses preparation and application of a rabies virus circular RNA (Ribonucleic Acid) molecule. The circular RNA comprises a coding element for coding rabies virus G protein. Further, the encoding element encodes a wild type G protein, a G truncated protein, a G mutant protein and a G truncated and mutant protein; preferred coding elements encode G truncated plus muteins. Further, the encoding element encodes an optimized nucleotide sequence of rabies virus G truncated plus mutant protein. Further, the circular RNA comprises an optimized translation initiation element. Research shows that the circular RNA provided by the invention can induce protein expression, a higher-level neutralizing antibody and a more lasting drug effect can be generated by only one-time administration in an animal body, and a basis is provided for preparing a circular mRNA vaccine for preventing and / or treating rabies.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and relates to the preparation and application of a rabies virus circular RNA molecule, and specifically relates to the preparation and application of a rabies virus G protein-encoding circular RNA; comprising circular RNA, linear RNA, recombinant plasmid, recombinant Escherichia coli engineering bacteria encoding a rabies virus G truncated and mutant protein sequence, and a preparation method and application of the circular RNA. Background Art

[0002] Rabies is a fatal neurological disease caused by the rabies virus (RV). It is one of the most deadly zoonotic diseases known to date. There is currently no specific drug for rabies. Once clinical symptoms appear, the disease is almost 100% fatal. It can be controlled through vaccination through pre-exposure prophylaxis (PrEP) and timely and effective post-exposure prophylaxis (PEP). Humans are infected with rabies mainly through bites and scratches from infected animals such as dogs and cats. Vaccinating animals that have close contact with humans in advance to prevent rabies is an important strategy to reduce human rabies infection from animals.

[0003] RABV belongs to the Lyssavirus genus of the Rhabdoviridae family. RABV virus particles are bullet-shaped under an electron microscope. The RABV genome is about 12,000 nt and is a single-stranded negative-sense RNA virus that encodes five structural proteins: phosphoprotein (P), nucleoprotein (N), glycoprotein (G), polymerase (L) and matrix protein (M). Among them, G protein is the only protein exposed on the surface of the viral envelope, the only ligand of the cell receptor, and the only structural protein known to induce the host to produce virus neutralizing antibodies (VNAs).

[0004] The most effective means of preventing rabies is still vaccination. Currently, the rabies vaccine on the market is mainly an inactivated rabies virus vaccine, which is made from live virus strains through cell culture amplification, inactivation, emulsification and other processes, and plays an important role in the prevention of rabies. However, this vaccine also has many disadvantages in practical applications: (1) The use of cell culture to produce viruses has the risk of virus strain leakage and incomplete inactivation, which poses certain safety hazards. (2) High quality control and process amplification requirements and high production costs. (3) The use of completely inactivated viruses as antigens requires large doses of immunization, and multiple immunizations are required to exert lasting protection. There is still room for breakthroughs in the development of new rabies virus vaccines that are lower in cost, more durable and more effective.

[0005] mRNA vaccines are vaccines that directly introduce mRNA containing antigenic proteins into the body, so that it is directly translated in the body to complete the expression of the target protein, thereby causing a specific immune response in the body. They have played an important role in the prevention of major respiratory infectious diseases in humans. At present, the mRNA used in clinical or preclinical applications is mainly linear mRNA. The structure of linear mRNA includes 5' cap structure (5'Cap), 3' polyadenosine tail (PolyA tail), 5' untranslational sequence (5'untranslational region, 5'UTR), 3' untranslational sequence (3'untranslational region, 3'UTR) and open reading frame (Open reading frame, ORF). The 5' cap structure is a basic feature of eukaryotic mRNA, which is obtained by adding N7-methylguanosine to the 5' end of mRNA. The 5' cap structure and 3' polyadenosine tail are necessary components of linear RNA, which can effectively prevent mRNA degradation and promote the translation of mRNA into protein. The 5' cap structure promotes mRNA translation by binding to the translation initiation complex eIF4E, and can effectively prevent mRNA degradation and reduce the immunogenicity of mRNA. The main function of the 3' polyadenosine tail is to bind to PolyA binding protein (PABP), which interacts with eIF4G and eIF4E, mediates the formation of mRNA into a ring, promotes the translation process, and prevents mRNA degradation.

[0006] Circular RNA (circRNAs) is a common type of RNA in eukaryotes. Currently, the most efficient technology for constructing circular RNA in vitro is the self-cleavage circular system design technology (patent CN 114574483 A). The design principle of this technology is to connect the exon E1 and E2 sequences end to end through molecular cloning to form a continuous circular plasmid. The intron is cut and broken by restriction endonuclease to obtain a linear plasmid. Then, in vitro transcription is performed through the T7 promoter upstream of the inverted 3' intron to obtain a linear RNA containing a 3' intron-E2-E1-5' intron structure. Similar to the natural class I intron system, the specific conserved sequence of the splicing site of exon E1 is broken by the nucleophilic attack of the free guanosine 3' hydroxyl, and exon E1 produces a naked 3' hydroxyl, while guanosine binds to the broken 5' intron. Afterwards, the exposed 3'hydroxyl group of exon E1 attacks the conserved sequence between the 3'intron and exon E2, excises the 3'intron, and exons E2 and E1 undergo a circularization reaction to obtain a circular E1-E2 RNA. Compared with linear mRNA, circular mRNA molecules often have a longer half-life and better stability, and have important application prospects in protein expression and clinical treatment. In addition, the preparation process of circular RNA designed based on the self-cleaving circularization system is simpler and has lower process costs. After transcription, only circularization is performed, and there is no need to use expensive capping enzymes and tailing enzymes to modify additional 5' cap structures and 3' polyadenosine tail structures, nor is there a need for additional circularization processes using T4 RNA ligase as in traditional circular RNA. In addition, it can avoid the introduction of additional exon sequences in circular RNA, thereby improving the sequence accuracy of circular RNA molecules.

[0007] Currently, circular RNA is mainly used in human protein / vaccine expression research, and there are no reports on the optimized design and application of rabies virus circular RNA molecules. Summary of the invention

[0008] In view of the problems existing in the inactivated rabies vaccine currently in clinical use and the linear RNA vaccine under research, including the incomplete inactivation of the inactivated rabies vaccine, the risk of virus strain leakage, the high production cost, and the reported rabies linear RNA vaccine requiring multiple injections to maintain long-term protection (doi: 10.3389 / fimmu.2022.1099991), the present invention provides a preparation and application of a rabies virus circular RNA molecule. The circular RNA molecule contains an optimized coding element of the rabies virus G protein and an optimized translation initiation element, which can induce protein expression, induce animals to produce higher levels of neutralizing antibodies, and only requires one administration to maintain efficacy for 1 year, providing a basis for the preparation of a circular mRNA vaccine for the prevention and / or treatment of rabies.

[0009] Solutions used to solve the problem:

[0010] <circular RNA>

[0011] The present invention provides a circular RNA, the circular RNA comprises a coding element, the coding element encodes a polypeptide comprising a rabies virus G protein. Further, G wild-type protein, G truncated protein, G mutant protein, G truncated plus mutant protein; preferably, the coding element encodes a G truncated plus mutant protein. The circular RNA of the present invention can be prepared by a traditional PIE system or by a clean PIE system.

[0012] In some embodiments, the amino acid sequence of the rabies virus G protein encoded by the coding element comprises the sequence shown in SEQ ID NO.3, or a sequence having at least 90% sequence identity with the sequence shown in SEQ ID NO.3, and having or partially having G protein activity.

[0013] In some embodiments, the coding element encodes any one of the following: rabies virus G protein N-terminal truncation of 19 amino acids, N-terminal truncation of 19 amino acids / C-terminal truncation of 13 amino acids, N-terminal truncation of 19 amino acids / C-terminal truncation of 14 amino acids, comprising mutation W33Q, comprising mutation W33P, comprising mutation T335Y, comprising mutation E356F, comprising mutation E356I, comprising mutation W33Q / E356I, N-terminal truncation of 19 amino acids / W33Q / E356I, N-terminal truncation of 19 amino acids / C-terminal truncation of 13 amino acids / W33Q / E356I, wild-type G protein.

[0014] In the present invention, the truncation is continuous truncation.

[0015] As a preferred embodiment, the coding element comprises N-terminal truncation of 19 amino acids / C-terminal truncation of 13 amino acids / W33Q / E356I and has an amino acid sequence as shown in SEQ ID NO.11.

[0016] In some embodiments, the nucleotide sequence of the coding element encoding the rabies G protein comprises the sequence shown in SEQ ID NO.4, or has at least 90% sequence identity with the sequence shown in SEQ ID NO.4, and encodes a sequence of a polypeptide having or partially having rabies G protein activity;

[0017] In some embodiments, the coding element comprises a nucleotide sequence encoding any one of the following: rabies virus G protein N-terminal truncation of 19 amino acids, N-terminal truncation of 19 amino acids / C-terminal truncation of 13 amino acids, N-terminal truncation of 19 amino acids / C-terminal truncation of 14 amino acids, comprising mutation W33Q, comprising mutation W33P, comprising mutation T335Y, comprising mutation E356F, comprising mutation E356I, comprising mutation W33Q / E356I, N-terminal truncation of 19 amino acids / W33Q / E356I, N-terminal truncation of 19 amino acids / C-terminal truncation of 13 amino acids / W33Q / E356I, wild-type G protein.

[0018] In some embodiments, the coding element comprises any one of the following: a nucleotide sequence encoding rabies virus G protein with 19 amino acids truncated at the N-terminus / 13 amino acids truncated at the C-terminus / W33Q / E356I (numbered SEQ ID NO.12), nucleotide sequence 1 (numbered SEQ ID NO.13), nucleotide sequence 2 (numbered SEQ ID NO.14), and nucleotide sequence 3 (numbered SEQ ID NO.15).

[0019] As a preferred embodiment, the coding element comprises a nucleotide sequence 1 (SEQ ID NO.13) encoding rabies virus G protein with 19 amino acids truncated at the N-terminus / 13 amino acids truncated at the C-terminus / W33Q / E356I.

[0020] In some embodiments, the circular RNA of the present invention is prepared by a traditional PIE system, under which conditions, the circular RNA comprises elements arranged in the order shown in (a) or (b):

[0021] (a) the first exon, the second exon, the 5' spacer, the translation initiation element, the coding element and the 3' spacer;

[0022] (b) The first exon, the second exon, the translation initiation element and the coding element.

[0023] For the first exon, the second exon, the 5' spacer, and the 3' spacer, reference may be made to patent applications CN202011408937.4, CN202210200112.6, and CN202210200186.X, the entire contents of which are incorporated into this application by reference.

[0024] In other embodiments, the circular RNA of the present invention is prepared by a clean PIE system, under which conditions, the circular RNA comprises elements arranged in the order shown in (c) or (d):

[0025] (c) translation initiation elements and coding elements;

[0026] (d) Translation initiation elements, coding elements and insertion elements.

[0027] In some preferred embodiments, the circular RNA of the present invention is prepared by a clean PIE system, and the circular RNA comprises the elements arranged in the order shown in (d) above. The clean PIE system for preparing circular RNA can refer to the contents shown in patents CN202210200112.6 and CN202210200186.X, and the entire contents of the above patents are incorporated into this application by reference.

[0028] In some embodiments, the translation initiation element described herein can be any type of element that can initiate translation of a coding element in a circular RNA.

[0029] In some specific embodiments, the translation initiation element of the present invention comprises one or more of the following sequences with translation initiation activity: IRES sequence, 5'UTR sequence, Kozak sequence, m 6 A modified (N(6) methyladenosine modification) sequence, complementary sequence of ribosomal 18S rRNA.

[0030] In some preferred embodiments, the translation initiation element of the present invention comprises an IRES sequence. Exemplary, the IRES sequence includes but is not limited to an IRES sequence derived from Echovirus, Human poliovirus, Human Enterovirus, Coxsackievirus, Human rhinovirus, Canine picornavirus, Turdivirus 3, Hepatovirus, Passerivirus, Picornaviridae, Tremovirus A, Feline kobuvirus, Murine kobuvirus, Kobuvirus sewage Kathmandu, Ferret kobuvirus, Marmot kobuvirus, Humanparechovirus, Chicken picornavirus, Falcon picornavirus, Feline picornavirus, French Guiana picornavirus, etc.

[0031] In some embodiments, the insertion element described in the present invention can be used to regulate the transcription of recombinant nucleic acid molecules, to regulate the translation of circular RNA, to achieve specific expression of circular RNA in different tissues, or to purify circular RNA, etc.

[0032] In some specific embodiments, the insertion element described in the present invention comprises one or more of the following sequences: a non-translated region sequence, a polyN sequence, an adapter sequence, a ribosomal switch sequence, and a sequence that binds a transcriptional regulatory factor; in the polyN sequence, N is selected from at least one of A, T, G, and C.

[0033] In some preferred embodiments, the insertion element of the present invention comprises a stop codon and a polyAC sequence; preferably, the polyAC sequence comprises the sequence shown in SEQ ID NO.5.

[0034] In some preferred embodiments, the circular RNA described in the present invention has a sequence as shown in any one of SEQ ID NO.8, SEQ ID NO.10, SEQ ID NOs.16-18, and SEQ ID NOs.20-22.

[0035] In some preferred embodiments, the circular RNA comprises a nucleotide sequence of any one of the following: a nucleotide sequence as shown in SEQ ID NO.16, a nucleotide sequence as shown in SEQ ID NO.20, a nucleotide sequence as shown in SEQ ID NO.21, or a nucleotide sequence as shown in SEQ ID NO.22.

[0036] In some more preferred embodiments, the circular RNA described in the present invention has a sequence as shown in SEQ ID NO.22.

[0037] <Linear RNA>

[0038] The present invention provides a linear RNA, wherein the linear RNA undergoes a self-cleavage reaction and then cyclizes to form the above-mentioned circular RNA. Accordingly, the linear RNA is also called a cyclized precursor RNA.

[0039] In some embodiments, the linear RNA of the present invention is derived from the traditional PIE system, under which conditions, the linear RNA comprises elements arranged in the order shown in (e) or (f) below:

[0040] (e) 5' homology arm, intron fragment II, second exon, 5' spacer, translation initiation element, coding element, 3' spacer, first exon, intron fragment I and 3' homology arm;

[0041] (f) 5' homology arm, intron fragment II, second exon, translation initiation element, coding element, first exon, intron fragment I and 3' homology arm.

[0042] The linear RNA molecule having the above structure can utilize the ribozyme activity of the class I intron to undergo a self-cleavage cyclization reaction in vitro to obtain a circular RNA. Specifically, under the initiation of GTP, the junction between the 5' intron and the first exon is broken; the ribozyme cleavage of the first exon further attacks the junction between the 3' intron and the second exon, causing the junction to break, the 3' intron dissociates, and the first exon and the second exon are connected to obtain a circular mRNA.

[0043] In other embodiments, the linear RNA of the present invention is derived from the clean PIE system, under which conditions, the linear RNA comprises the elements arranged in the order shown in (g), (h) or (i):

[0044] (g) intron fragment II, translation initiation element truncation fragment II, coding element, translation initiation element truncation fragment I, intron fragment I;

[0045] (h) intron fragment II, translation initiation element truncation fragment II, coding element, insertion element, translation initiation element truncation fragment I, intron fragment I;

[0046] (i) Intron fragment II, translation initiation element truncation fragment II, coding element, stop codon, polyAC, translation initiation element truncation fragment I, intron fragment I.

[0047] When the linear RNA molecule having the above structure is used to prepare circular RNA, the ribozyme recognizes the connection position between the translation initiation element truncated fragment I (IRES fragment I) and the intron fragment I and breaks it first, releasing the intron fragment I; then the ribozyme recognizes the connection position between the translation initiation element truncated fragment II (IRES fragment II) and the intron fragment II and breaks it, releasing the intron fragment II. The 3' end of the translation initiation element truncated fragment I and the 5' end of the translation initiation element truncated fragment II are connected to form a circular molecule.

[0048] In some preferred embodiments, the linear RNA of the present invention is derived from the clean PIE system, and the linear RNA comprises the elements arranged in the order shown in (i) above.

[0049] In some specific embodiments, the intron fragment II of the present invention comprises a sequence as shown in SEQ ID NO. 1. In some specific embodiments, the intron fragment I of the present invention comprises a sequence as shown in SEQ ID NO. 7. The nucleotide sequence of the intron fragment I is connected with the nucleotide sequence of the intron fragment II to obtain an intron sequence.

[0050] In some specific embodiments, the translation initiation element truncated fragment II of the present invention comprises a sequence as shown in any one of SEQ ID NO.23, SEQ ID NO.25, SEQ ID NO.27, and SEQ ID NO.2. In some specific embodiments, the translation initiation element truncated fragment I of the present invention comprises a sequence as shown in any one of SEQ ID NO.24, SEQ ID NO.26, SEQ ID NO.28, and SEQ ID NO.6. The nucleotide sequence of the translation initiation element truncated fragment I is connected with the nucleotide sequence of the translation initiation element truncated fragment II to obtain a translation initiation element sequence.

[0051] In some preferred embodiments, the translation initiation element truncated fragment II of the present invention is the sequence shown in SEQ ID NO.27; the translation initiation element truncated fragment I of the present invention is the sequence shown in SEQ ID NO.28.

[0052] In some specific embodiments, the coding element of the present invention comprises a sequence as shown in any one of SEQ ID NOs. 12-15.

[0053] In some specific embodiments, the stop codon of the present invention is represented by (TAA)x(TAG)y(TGA)z, wherein x+y+z≥1, x, y, z are each independently an integer greater than or equal to 0, and the preferred sequence is TGA.

[0054] In some specific embodiments, the polyAC of the present invention is a sequence as shown in SEQ ID NO.5.

[0055] <Recombinant Nucleic Acid Molecule>

[0056] The present invention provides a recombinant nucleic acid molecule, which forms the above-mentioned linear RNA after transcription.

[0057] In some embodiments, the recombinant nucleic acid molecule of the present invention may contain a regulatory sequence in addition to the elements contained in the linear RNA described above. Exemplarily, the regulatory sequence is a T7 promoter.

[0058] <Recombinant Escherichia coli engineered bacteria>

[0059] The present invention provides a recombinant Escherichia coli engineering bacterium, wherein the engineering bacterium is obtained by transforming E. coli with the above-mentioned recombinant nucleic acid molecule.

[0060] <Nucleic acid lipid nanoparticle composition>

[0061] The present invention provides a nucleic acid lipid nanoparticle composition, which comprises lipid nanoparticles and the above-mentioned circular RNA.

[0062] By encapsulating the above circular RNA into lipid nanoparticles, the body's uptake efficiency of circular RNA can be improved, while the storage stability of circular RNA is improved, providing assistance for the development and application of rabies vaccines.

[0063] <Medical Use>

[0064] The circular RNA, linear RNA, recombinant nucleic acid molecule and / or nucleic acid lipid nanoparticle composition provided by the present invention can be used to prevent and / or treat rabies.

[0065] The present invention provides use of the circular RNA, linear RNA, recombinant nucleic acid molecule, recombinant Escherichia coli engineered bacteria, and / or nucleic acid lipid nanoparticle composition in the preparation of a drug for preventing and / or treating rabies.

[0066] The present invention provides a method for preventing and / or treating rabies, comprising administering an effective amount of the above-mentioned circular RNA, linear RNA, recombinant nucleic acid molecule and / or nucleic acid lipid nanoparticle composition to a subject; preferably, the administration is performed by injection.

[0067] Compared with the prior art, the present invention has the following beneficial effects:

[0068] 1) The present invention provides a preferred truncated and mutant protein sequence of rabies virus G protein (amino acid sequence shown in SEQ ID NO.11) and a circular RNA molecule encoding the protein (numbered CKV-G-752, nucleotide sequence shown in SEQ ID NO.10). The vaccine corresponding to the preferred RNA molecule successfully increases the rabies virus neutralizing antibody titer in mice.

[0069] 2) Further, for the G truncated mutant protein, the present invention provides a preferred nucleotide sequence (see SEQ ID NO.13) and a circular RNA molecule encoding the preferred nucleotide sequence (numbered CKV-G-834, nucleotide sequence see SEQ ID NO.16), which significantly increases the expression level of the target protein in 293T cells.

[0070] 3) Furthermore, for the preferred nucleotide sequence of G truncated plus mutant protein (see SEQ ID NO.13), the present invention provides a circular RNA molecule constructed with a preferred translation initiation element (numbered LTE-G-834, nucleotide sequence see SEQ ID NO.22), and the vaccine corresponding to the preferred RNA molecule successfully increases the rabies virus neutralizing antibody titer in dogs.

[0071] 4) Compared with the linear RNA molecule encoding rabies virus (numbered linear-G) and the commercially available inactivated rabies vaccine, the LNP-encapsulated RNA vaccine prepared using the above-mentioned preferred circular RNA molecule (numbered LTE-G-834, nucleotide sequence see SEQ ID NO.22) can produce higher levels of neutralizing antibodies and more lasting efficacy with only one administration, providing a basis for the preparation of rabies virus RNA vaccine. BRIEF DESCRIPTION OF THE DRAWINGS

[0072] Other features, objects and advantages of the present invention will become more apparent from the detailed description of non-limiting embodiments made with reference to the following drawings:

[0073] Figure 1 A schematic diagram of a precursor sequence and a schematic diagram of a circular mRNA sequence for generating rabies virus circular mRNA;

[0074] Figure 2 It is the duration of antibodies after dog immunization. DETAILED DESCRIPTION

[0075] The present invention is described in detail below in conjunction with the accompanying drawings and specific embodiments. The following examples are implemented on the premise of the technical solution of the present invention, provide detailed implementation methods and specific operation processes, and will help those skilled in the art to further understand the present invention. It should be pointed out that the protection scope of the present invention is not limited to the following embodiments, and several adjustments and improvements made under the premise of the concept of the present invention all belong to the protection scope of the present invention.

[0076] In the present invention, the term "a" or "an" or "the" may mean "one", and may also mean "one or more", "at least one" and "one or more than one".

[0077] In the present invention, the terms "comprising", "having", "including" or "containing" may mean inclusive or open-ended, and do not exclude additional, uncited elements or method steps. At the same time, "comprising", "having", "including" or "containing" may also mean closed, excluding additional, uncited elements or method steps.

[0078] In the present invention, the word "may" includes both performing a certain process and not performing a certain process.

[0079] In the present invention, "optional" or "optionally" means that the subsequently described event or circumstance may or may not occur, and the description includes instances where the event occurs and instances where it does not occur.

[0080] In the present invention, the term "about" may mean that a value includes the standard deviation of the error of the device or method used to determine the value. Unless otherwise explicitly stated, it should be understood that all ranges, quantities, values ​​and percentages used in the present invention are modified by "about".

[0081] In the present invention, the terms "polypeptide", "peptide" and "protein" are used interchangeably herein and are amino acid polymers of any length. The polymer may be linear or branched, it may contain modified amino acids, and it may be interrupted by non-amino acids. The term also includes amino acid polymers that have been modified (e.g., disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation, such as conjugation with a labeling component).

[0082] In the present invention, the term "circular RNA" refers to an RNA molecule in a closed circular shape. In the present invention, the circular RNA used has protein translation activity and can also be called "circular mRNA".

[0083] In the present invention, the term "linear RNA" refers to an RNA precursor that can be circularized to form a circular RNA, which is generally transcribed from a linear DNA molecule and can also be called "linear mRNA".

[0084] In the present invention, the term "linear RNA" refers to RNA with translation function including a 5' cap structure (5' Cap), a 3' polyadenosine tail (PolyA tail), a 5' untranslational region (5' UTR), a 3' untranslational region (3' UTR) and an open reading frame (Open reading frame, ORF) and other structures, which can also be called "linear mRNA".

[0085] In the present invention, the term "recombinant nucleic acid molecule" refers to a polynucleotide having sequences that are not linked together in nature. The recombinant polynucleotide may be included in a suitable vector, and the vector may be used to transform into a suitable host cell. The polynucleotide is then expressed in a recombinant host cell to produce, for example, a "recombinant polypeptide", "recombinant protein", "fusion protein", etc. In the present invention, the recombinant nucleic acid molecule comprises a coding element encoding a target polypeptide, and a translation initiation element connected upstream of the coding element.

[0086] In the present invention, the term "translation initiation element" refers to any sequence that can recruit ribosomes and initiate the translation process of RNA molecules. Exemplary, the translation initiation element includes an IRES sequence, an m6A modification sequence, or a rolling circle translation initiation sequence, etc.

[0087] In the present invention, the term "IRES" (Internal ribosome entry site, IRES) is also called internal ribosome entry site, "internal ribosome entry site" (IRES) belongs to the translation control sequence, which is usually located at the 5' end of the gene of interest and enables the translation of RNA in a cap-independent manner. The transcribed IRES can directly bind to the ribosomal subunit so that the mRNA start codon is properly oriented in the ribosome for translation. The IRES sequence is usually located in the 5'UTR of the mRNA (just upstream of the start codon). IRES functionally replaces the need for various protein factors that interact with the eukaryotic translation machinery.

[0088] In the present invention, the term "expression" includes any step involved in the production of the polypeptide including, but not limited to, transcription, post-transcriptional modification, translation, post-translational modification, and secretion.

[0089] In the present invention, the term "wild type" is synonymous with "naturally occurring", and refers to an object that can be found in nature and has not been modified by humans.

[0090] In the present invention, the terms "variant" and "mutant" are used interchangeably and refer to nucleotides or amino acids that contain changes (i.e., substitutions, insertions and / or deletions) at one or more (e.g., several) positions relative to a "wild-type" polynucleotide or polypeptide. Substitution refers to replacing a nucleotide / amino acid occupying a position with a different nucleotide / amino acid. Deletion refers to the removal of a nucleotide / amino acid occupying a position. Insertion refers to the addition of a nucleotide / amino acid adjacent to and immediately following the nucleotide / amino acid occupying the position.

[0091] In the present invention, the terms "sequence identity" and "percentage of identity" refer to the percentage of nucleotides or amino acids that are identical (i.e., identical) between two or more polynucleotides or polypeptides. The sequence identity between two or more polynucleotides or polypeptides can be determined by the following method: the nucleotide or amino acid sequences of the polynucleotides or polypeptides are aligned and the number of positions containing the same nucleotide or amino acid residue in the aligned polynucleotides or polypeptides is scored, and compared with the number of positions containing different nucleotides or amino acid residues in the aligned polynucleotides or polypeptides. The polynucleotides may differ at one position, for example, by containing different nucleotides (i.e., substitutions or mutations) or missing nucleotides (i.e., nucleotide insertions or nucleotide deletions in one or two polynucleotides). The polypeptides may differ at one position, for example, by containing different amino acids (i.e., substitutions or mutations) or missing amino acids (i.e., amino acid insertions or amino acid deletions in one or two polypeptides). The sequence identity can be calculated by dividing the number of positions containing the same nucleotide or amino acid residue by the total number of amino acid residues in the polynucleotide or polypeptide. For example, percent identity can be calculated by dividing the number of positions containing the identical nucleotide or amino acid residue by the total number of nucleotides or amino acid residues in the polynucleotide or polypeptide and multiplying by 100.

[0092] In the present invention, the term "individual", "patient" or "subject" includes mammals. Mammals include, but are not limited to, domestic animals (e.g., cows, sheep, cats, dogs and horses), primates (e.g., humans and non-human primates such as monkeys), rabbits, and rodents (e.g., mice and rats).

[0093] In the present invention, "treatment" means: after suffering from a disease, the subject is exposed to (e.g., administered) the RNA molecule described in the present invention, thereby alleviating the symptoms of the disease compared to when the subject is not exposed, and does not necessarily mean that the symptoms of the disease are completely suppressed. Suffering from a disease means: the body has symptoms of the disease.

[0094] In the present invention, "prevention" means that before contracting a disease, by exposing a subject to the RNA molecule described in the present invention, the probability of contracting a disease and / or the symptoms after contracting a disease are reduced compared to when the subject is not exposed, and it does not mean that the disease must be completely suppressed.

[0095] Unless otherwise defined, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art. Unless otherwise specified, the units used in this specification are all international standard units, and the numerical values ​​and numerical ranges appearing in the present invention should be understood to include inevitable systematic errors.

[0096] In the examples, if the specific conditions are not specified, the conditions are carried out according to normal conditions or the conditions recommended by the manufacturer. If the manufacturer is not specified for all reagents or instruments, they are all conventional products that can be purchased commercially. In order to better illustrate the present invention, numerous specific details are provided in the specific embodiments below. It should be understood by those skilled in the art that the present invention can be implemented equally without certain specific details. In other embodiments, methods, means, equipment and steps well known to those skilled in the art are not described in detail to highlight the gist of the present invention.

[0097] Example 1 Design and amino acid sequence optimization of rabies virus circular RNA

[0098] G protein is the only structural protein on the surface of viral particles and is the only structural protein known to induce virus neutralizing antibodies. However, there may be problems in designing RNA vaccines using the amino acid sequence of wild-type G protein: there may be decoy epitopes on the surface of viral proteins, which consume the body's immune resources, leading to insufficient effective immune response and antibody-dependent infection enhancement (ADE); in addition, direct expression of wild-type protein is prone to low antigen expression and insufficient vaccine effect due to structural instability, toxicity, and the formation of non-natural aggregates. This study analyzed the spatial structure and antigenicity of rabies virus G protein through molecular dynamics, dominant B cell epitope prediction, and T cell epitope prediction, and screened the correct amino acid sequence.

[0099] 1.1 Gene design and synthesis

[0100] The vector DNA of circular RNA was designed for rabies virus G protein. The design mainly refers to patent CN 114574483A, in which the translation initiation element is a Caprine kobuvirus IRES sequence in which the 80th G is mutated to T, the 81st A is mutated to C, and the 82nd G is mutated to T to obtain a mutant sequence (numbered CKV). Specifically, each DNA vector contains the following elements from 5' to 3': intron fragment II, translation initiation element truncated fragment II (numbered CKV-II respectively), protein coding element, insertion element, translation initiation element truncated fragment I (numbered CKV-I respectively), intron fragment I. Among them:

[0101] The nucleotide sequence of intron fragment II is shown in SEQ ID NO.1;

[0102] The nucleotide sequence of the translation initiation element truncation fragment II (CKV-II) is shown in SEQ ID NO. 2;

[0103] The protein coding element includes: a nucleotide sequence encoding a wild-type rabies virus G protein (as shown in SEQ ID NO.4) or other 11 G protein mutants obtained by pre-screening (corresponding nucleotide information is shown in Table 1), and a stop codon (as shown in (TAA)x(TAG)y(TGA)z, wherein x+y+z≥1, x, y, z are independently integers greater than or equal to 0, and the preferred stop codon is TGA);

[0104] The nucleotide sequence of the insertion element (polyAC) is shown in SEQ ID NO.5;

[0105] The nucleotide sequence of the translation initiation element truncation fragment I (CKV-I) is shown in SEQ ID NO.6;

[0106] The nucleotide sequence of intron fragment I is shown in SEQ ID NO.7.

[0107] The numbers of the vector DNAs containing the above elements and gene fragments are shown in Table 1. Linear RNAs are transcribed from each vector DNA, and circular RNAs are further formed from the linear RNAs according to the following mechanism: ribozyme recognizes the junction between the translation initiation element truncated fragment I (IRES fragment I) and the intron fragment I to generate a break, thereby releasing the intron fragment I; then ribozyme recognizes the junction between the translation initiation element truncated fragment II (IRES fragment II) and the intron fragment II to generate a break, thereby releasing the intron fragment II. The 3' end of the translation initiation element truncated fragment I is connected to the 5' end of the translation initiation element truncated fragment II to form a circular molecule ( Figure 1 ).

[0108] The above gene fragment was commissioned to Suzhou Genewise Biotechnology Co., Ltd. to synthesize and clone into the pUC57 vector, and was verified to be correct by gene sequencing.

[0109] Table 1 Optimization of DNA vectors and G protein amino acid sequences

[0110]

[0111] 1.2 Preparation of circular RNA

[0112] The DNA vector obtained in step 1.1 of this example is prepared into circular RNA.

[0113] (1) Test method

[0114] a) Preparation of bacterial strains: The synthesized DNA vectors were transformed into DH5α competent cells, spread on LB medium plates containing 100 μg / ml ampicillin, and cultured at 37°C. When the colonies on the plates were clearly visible, single colonies were picked and placed in 3 ml LB liquid culture medium containing 100 μg / ml ampicillin, cultured at 37°C, and 1 ml of the bacterial solution was added to glycerol with a final concentration of 8%, and stored at -80°C to obtain engineered bacteria as seeds for subsequent experiments.

[0115] b) Plasmid extraction: Activate the externally constructed puncture bacteria at 37°C / 220rpm for 3-4h; take the activated bacterial solution for expansion culture, culture conditions: shake overnight culture at 37°C / 220rpm; extract the plasmid using a commercial kit (Tiangen Endotoxin-Free Plasmid Extraction Kit).

[0116] c) Plasmid digestion and purification: The plasmid was digested by restriction endonuclease BsaI (nearshore protein) / BsaI (Takara), and the digestion system was as follows: 10× buffer: 100 μl, plasmid: 5 mg, BsaI: 150 μl (5000 U), water was added to 1000 μl, and digestion was carried out at 37°C overnight. After digestion, the digestion product was purified by column using a commercial DNA recovery kit (TIANGEN) to obtain a linearized plasmid.

[0117] d) In vitro transcription: The transcription system is configured as shown in Table 2 below:

[0118] Table 2

[0119] Reagents volume 10× Reaction Buffer 2ml ATP(100mM) 2ml CTP (100 mM) 2ml UTP(100mM) 2ml GTP (100 mM) 2ml Linearized plasmid (1.5 mg / ml) 600μl T7 RNA Polymerase (25U / μl) 2ml RNase inhibitor (10U / μl) 2ml Nuclease free water Total 20ml

[0120] Reaction conditions: Constant temperature shaking reaction at 37°C / 220rpm for 2-4h, then add 2ml of deoxyribonuclease I (DNaseI) to the transcription system, and constant temperature shaking reaction at 37°C / 220rpm for 15min.

[0121] e) Precipitation of transcription product mRNA: Add LiCl solution to the transcription product obtained in a) above, and place at -20°C for overnight precipitation; centrifuge the overnight treatment solution to obtain mRNA precipitate, dry at room temperature, and resuspend the precipitate in enzyme-free water to obtain a linear mRNA aqueous solution.

[0122] f) mRNA cyclization and concentration: The cyclization system and conditions are shown in Table 3 below

[0123] Table 3

[0124]

[0125] The above solutions were mixed thoroughly and heated at 55°C for 15 min. The circularized mRNA product was concentrated by ultrafiltration tube centrifugation, and the filtrate was discarded; and the ultrafiltration liquid was transferred to a new centrifuge tube.

[0126] g) Circular mRNA HPLC purification: A certain amount of circular mRNA was separated by chromatographic column SEC-1000 (SEPAX) in 150 mM phosphate buffer mobile phase, and the main peak component was collected.

[0127] h) Ultrafiltration and concentration of the purified circular mRNA: The circular mRNA tube is subjected to ultrafiltration centrifugation and concentration, and the filtrate is discarded; enzyme-free water is added to the ultrafiltration tube, and the circular mRNA is repeatedly washed twice, and the circular mRNA is concentrated to a desired concentration; the ultrafiltration liquid is transferred to a new centrifuge tube.

[0128] (2) Test results

[0129] Through the above process, various circular mRNA molecules were successfully prepared (see Table 4), among which the nucleotide sequence of CKV-G-501 is shown in SEQ ID NO.8, and the remaining groups are the wild-type G protein nucleotide sequence in CKV-G-501 (see SEQ ID NO.4) replaced with the nucleotide sequence of G mutation or truncated protein (see Table 1).

[0130] Table 4 Circular mRNA molecules and amino acid sequence optimization

[0131]

[0132] 1.3 In vitro expression verification

[0133] Each circular mRNA prepared in step 1.2 of this example was transfected into 293T cells, and the expression of the target protein was verified by flow cytometry 24 hours after transfection.

[0134] (1) Test method

[0135] 1) Cell culture: 293T cells were cultured at 1×10 5 Cells were inoculated into 24-well cell culture plates, and cultured in a 37°C, 5% CO2 incubator using DMEM high-glucose medium containing 10% fetal bovine serum and 1% double antibody. Cell transfection was performed when the cells reached 70% confluence.

[0136] 2) Cell transfection: 0.75-1.5 μL of MessengerMax (Thermo Fisher Scientific) was diluted to 25 μL with Opti-MEM (Thermo Fisher Scientific) per well and reacted at room temperature for 10 min. 0.5 μg of each circular RNA was diluted to 25 μL with Opti-MEM per well. 25 μL of MessengerMax / Opti-MEM diluted solution reacted at room temperature was mixed with 25 μL of circular mRNA / Opti-MEM diluted solution in a 1:1 ratio and incubated at room temperature for 5 min.

[0137] 3) Expression detection: Add 50 μL of the incubated mixed reagent to each 24-well cell culture plate, culture in a 37°C, 5% CO2 incubator, harvest the cells after 24 hours, label the cells with rabies virus monoclonal antibody (#3R7, HyTest) and FITC-labeled goat anti-mouse IgG (Life technologies), and analyze the fluorescence intensity of FITC-positive cells by flow cytometry to verify the expression of G protein. Untransfected 293T cells were used as the negative control group.

[0138] (2) Test results

[0139] The results are shown in Table 5. After 24 hours of transfection, the target protein was significantly expressed in each group.

[0140] Table 5 G protein expression verification (FITC mean fluorescence intensity MFI)

[0141] mRNA molecule number MFI mRNA molecule number MFI CKV-G-501 <![CDATA[2.2×10 3 ]]> CKV-G-747 <![CDATA[3.0×10 3 ]]> CKV-G-742 <![CDATA[1.8×10 3 ]]> CKV-G-748 <![CDATA[1.4×10 3 <!-- 12 -->]]> CKV-G-743 <![CDATA[2.4×10 3 ]]> CKV-G-749 <![CDATA[1.7×10 3 ]]> CKV-G-744 <![CDATA[2.7×10 3 ]]> CKV-G-750 <![CDATA[2.6×10 3 ]]> CKV-G-745 <![CDATA[1.2×10 3 ]]> CKV-G-751 <![CDATA[3.1×10 3 ]]> CKV-G-746 <![CDATA[1.6×10 3 ]]> CKV-G-752 <![CDATA[4.3×10 3 ]]> Untransfected control <![CDATA[<0.1×10 2 ]]> \ \

[0142] 1.4 LNP-mRNA preparation

[0143] Each circular RNA molecule obtained in step 1.3 was prepared into LNP-encapsulated RNA using commercial LNP to prepare for further animal experiments.

[0144] (1) Test method

[0145] The main reference for LNP-mRNA preparation is DOI: 10.1016 / j.cell.2022.03.044. The specific process is as follows:

[0146] a) Dilute the circular RNA to a final concentration of 170 μg / mL using PNI formulation buffer (Precision NanoSystems, Cat. No. NWW0043).

[0147] b) On a NanoAssembler Ignite (Precision NanoSystems), commercial LNP (Precision NanoSystems) and circular RNA were mixed at a volume ratio of 1:3 using Ignite NxGenCartridge (Precision NanoSystems, Catalog No. NIT0002).

[0148] c) The buffer environment was replaced with PBS at pH 7.4 using tangential flow technology to remove ethanol, and LNP-mRNA was prepared. The LNP-mRNA was filtered, sterilized, and quantified for later use. A total of 12 groups of test vaccines were obtained, numbered LNP / CKV-G-501, LNP / CKV-G-742, LNP / CKV-G-743, LNP / CKV-G-744, LNP / CKV-G-745, LNP / CKV-G-746, LNP / CKV-G-747, LNP / CKV-G-748, LNP / CKV-G-749, LNP / CKV-G-750, LNP / CKV-G-751, and LNP / CKV-G-752.

[0149] d) Using Quant-iT TM RiboGreen TM RNA Assay Kit (Invitrogen TM The particle size, PDI and surface potential of LNP particles were measured by dynamic light scattering method on a Zeta potential laser particle size analyzer Malvern Zetasizer Nano-ZEN 3600 (Malvern).

[0150] (2) Test results

[0151] The mRNA-encapsulated LNPs prepared in this step passed the inspection: the particle size distribution was uniform (average 72 nm), the encapsulation rate was greater than 90%, the surface potential was electronegative, avoiding the cytotoxicity caused by the positive charge on the surface of the nanoparticles, and the biosafety was good.

[0152] 1.5 Mouse immunization and antibody determination

[0153] (1) Experimental methods

[0154] Female BABL / c mice aged 6 to 8 weeks were randomly divided into 12 groups, with 4 mice in each group. The 12 groups of LNP-encapsulated circular mRNA vaccines prepared in step 1.4 of this example were immunized with mice muscle at a dose of 10 μg / mouse. At the same time, mice vaccinated with LNP were used as negative controls. Blood was collected on the 21st day after immunization to separate serum, and rabies virus G protein IgG titer and virus neutralizing antibody were detected, respectively. The specific operation method mainly refers to the literature (DOI: 10.3389 / fimmu.2022.1099991).

[0155] (2) Experimental results

[0156] The results are shown in Table 6. Compared with the control group (CKV-G-501 group, mRNA nucleotide sequence is shown in SEQ ID NO.8, which encodes wild-type G protein (amino acid sequence is shown in SEQ ID NO.3, nucleotide sequence is shown in SEQ ID NO.4)), the difference in amino acids has a significant effect on the neutralizing antibody titer: N-terminal truncation of 19 amino acids / C-terminal truncation of 13 amino acids (CKV-G-743 group) significantly increases the neutralizing antibody titer, and the remaining truncation results in the inability to produce neutralizing antibodies or no obvious changes. In addition, W33Q mutation (CKV-G-745 group) and E356I mutation (CKV-G-749 group) significantly increase the neutralizing antibody titer. It was further observed that the increase in neutralizing antibody titer was positively correlated with the decrease in G protein-specific antibody titer, which may be related to the destruction of the dominant epitope after optimization to better expose the effective epitope and to a more uniform protein structure expressed. After further screening, the optimal molecule CKV-G-752 was finally successfully obtained (mRNA nucleotide sequence see SEQ ID NO.10, which encodes G truncation mutation 2 (N-terminal truncation of 19 amino acids / C-terminal truncation of 13 amino acids / W33Q / E356I (amino acid sequence see SEQ ID NO.11, nucleotide sequence see SEQ ID NO.12)). Compared with the CKV-G-501 control group, the neutralizing antibody titer increased by 1.9 times, indicating that the optimization of G protein amino acids is effective and necessary.

[0157] Table 6 Antibody response in mice

[0158]

[0159]

[0160] Example 2 Nucleotide sequence optimization

[0161] In theory, a protein can be encoded by countless nucleotides, and it is difficult to select the optimal nucleotide sequence from them. This study analyzed the high-level structure of RNA through molecular dynamics calculations and other methods, and thus made a correct design of the nucleotide sequence encoding the target protein.

[0162] 2.1 Gene design and circular RNA preparation

[0163] For the G truncation mutation 2 obtained in Example 1 (N-terminal truncation of 19 amino acids / C-terminal truncation of 13 amino acids / W33Q / E356I, amino acid sequence shown in SEQ ID NO.11, nucleotide sequence shown in SEQ ID NO.12), three nucleotide sequences were obtained by computational screening: nucleotide sequence 1 (SEQ ID NO.13), nucleotide sequence 2 (SEQ ID NO.14), and nucleotide sequence 3 (SEQ ID NO.15), and the corresponding DNA vectors were designed according to the method of step 1.1 of Example 1. Each DNA vector was commissioned to Suzhou Jinweizhi Biotechnology Co., Ltd. for synthesis and cloning, and the corresponding circular RNA was prepared according to the method of step 1.2 of Example 1 (see Table 7).

[0164] Table 7 Circular mRNA molecules and nucleotide sequence optimization

[0165]

[0166] 2.2 In vitro expression verification

[0167] The circular mRNA molecules were transfected into 293T cells, and the expression of the target protein was verified by flow cytometry on the 1st, 2nd, 3rd, 4th and 5th day after transfection, with the untransfected group as a negative control. The operation method is shown in step 1.3 of Example 1.

[0168] The results are shown in Table 8. The optimization of nucleotide sequence has a significant effect on the expression level and expression duration: compared with the control CKV-G-752, CKV-G-834 and CKV-G-835 both significantly increased the expression level and expression duration of the target protein, among which the CKV-G-834 group (mRNA nucleotide sequence see SEQ ID NO.16) had the largest increase and was preferred.

[0169] Table 8 G protein expression verification (FITC mean fluorescence intensity MFI)

[0170] Group Day 1 Day 2 Day 3 Day 4 Day 5 CKV-G-752 <![CDATA[4.3×10 3 ]]> <![CDATA[6.2×10 3 ]]> <![CDATA[5.4×10 3 ]]> <![CDATA[3.3×10 3 ]]> <![CDATA[2.8×10 3 ]]> CKV-G-834 <![CDATA[4.1×10 4 ]]> <![CDATA[5.8×10 4 ]]> <![CDATA[5.4×10 4 ]]> <![CDATA[4.7×10 4 ]]> <![CDATA[2.9×10 4 ]]> CKV-G-835 <![CDATA[2.7×10 4 ]]> <![CDATA[4.1×10 4 ]]> <![CDATA[3.8×10 4 ]]> <![CDATA[3.2×10 4 ]]> <![CDATA[2.1×10 4 ]]> CKV-G-836 <![CDATA[3.5×10 3 ]]> <![CDATA[5.4×10 3 ]]> <![CDATA[5.2×10 3 ]]> <![CDATA[4.1×10 3 ]]> <![CDATA[2.9×10 3 ]]> Untransfected control <![CDATA[<0.1×10 2 ]]> <![CDATA[<0.1×10 2 ]]> <![CDATA[<0.1×10 2 ]]> <![CDATA[<0.1×10 2 ]]> <![CDATA[<0.1×10 2 ]]>

[0171] Example 3 Preparation of control RNA

[0172] In order to compare the effects of circular RNA and linear RNA, this study prepared linear RNA encoding rabies virus G protein (numbered linear-G, nucleotide sequence see SEQ ID NO.19) according to the reference (doi: 10.1186 / s12985-022-01919-7), and the specific steps included in vitro transcription and purification process.

[0173] In order to compare the effects of the circular RNA prepared in this study with those of molecules constructed using commercial circular RNA elements, this study used a circular RNA cloning construction kit (Shanghai Kewei Chuang) to prepare a control circular RNA molecule (number HM-G-834), which encodes rabies virus G truncated mutant protein 2 (amino acid sequence see SEQ ID NO.11, nucleotide sequence see SEQ ID NO.13). The specific method refers to the kit instructions.

[0174] Example 4 Optimization of translation initiation elements

[0175] The circular RNA molecules disclosed in the prior art use preferred translation initiation elements including Caprine kobuvirus IRES sequence (numbered CKV in the present invention) and Echovirus E29 IRES sequence (numbered EVE in the present invention), etc. The circular RNA containing these translation initiation elements is expressed at high levels in human cell lines (lung cancer human alveolar basal epithelial cells A549 cells or human kidney epithelial cell line 293T cells), but the effect in canine cells is unknown. On the other hand, there are at least thousands of known translation initiation elements, and it is very difficult to select the optimal element from them. This study designed a combinatorial library, a nucleotide site-directed mutagenesis modification library and other methods to analyze and compare the translation initiation element sequences, so that a better translation initiation element was matched to the optimized rabies virus G protein nucleotide sequence.

[0176] 4.1 Translation initiation element design and circular RNA preparation

[0177] Two candidate translation initiation elements (numbered PSV and LTE, respectively) were obtained by pre-screening. The vector DNA was prepared according to the method of step 2.1 of Example 2, specifically, the translation initiation element (numbered CKV) in the preferred circular RNA molecule (numbered CKV-G-834, nucleotide sequence SEQ ID NO.16) was replaced with candidate translation initiation elements (numbered PSV, LTE and EVE, respectively) and further prepared to obtain circular RNA molecules (see Table 9).

[0178] Table 9 Optimization of circular mRNA molecules and translation initiation elements

[0179]

[0180] The nucleotide sequence of translation initiation element truncated fragment II (EVE-II) is shown in SEQ ID NO. 23;

[0181] The nucleotide sequence of translation initiation element truncation fragment I (EVE-I) is shown in SEQ ID NO. 24;

[0182] The nucleotide sequence of the translation initiation element truncation fragment II (PSV-II) is shown in SEQ ID NO. 25;

[0183] The nucleotide sequence of the translation initiation element truncation fragment I (PSV-I) is shown in SEQ ID NO. 26;

[0184] The nucleotide sequence of the translation initiation element truncation fragment II (LTE-II) is shown in SEQ ID NO. 27;

[0185] The nucleotide sequence of the translation initiation element truncation fragment I (LTE-I) is shown in SEQ ID NO.28.

[0186] 4.2 LNP-mRNA preparation

[0187] Each circular mRNA molecule prepared in this example and the control RNA molecule prepared in Example 3 were prepared into lipid nanoparticle / RNA compositions using commercial LNPs, and the specific steps are shown in step 1.4 of Example 1, respectively, to obtain LNP-encapsulated CKV-G-834, LNP-encapsulated EVE-G-834, LNP-encapsulated PSV-G-834, LNP-encapsulated LTE-G-834, LNP-encapsulated linear-G, and LNP-encapsulated HM-G-834. The results of the tests showed that the LNPs encapsulated mRNA in each group had uniform particle size distribution, and the encapsulation rate was greater than 90%; the surface potential was electronegative, avoiding the cytotoxicity caused by the positive charge on the surface of the nanoparticles, and the biosafety was good.

[0188] 4.3 Animal immunization and neutralizing antibody detection

[0189] Twenty-four rabies antibody-negative beagles (~3 months old, 5-6 kg) were randomly divided into 6 groups, 4 in each group, and vaccinated intramuscularly:

[0190] Groups 1 to 5 were inoculated with LNP-encapsulated CKV-G-834, LNP-encapsulated EVE-G-834, LNP-encapsulated PSV-G-834, LNP-encapsulated LTE-G-834, and LNP-encapsulated HM-G-834, respectively, by intramuscular injection into the outer thigh of the hind limb, with an inoculation dose of 20 μg / mouse.

[0191] Group 6: PBS control group, inoculated with sterile PBS, the dose was 1 ml / head.

[0192] After a single dose, blood was collected on the 14th and 21st days to prepare serum for virus neutralizing antibody detection. The test results are shown in Table 10. There was no neutralizing antibody in the PBS group, and the antibodies in the other groups were significantly different: the neutralizing antibody levels of the LTE-G-834 group and PSV-G-834 were significantly better than those of CKV-G-834 and EVE-G-834, among which the LTE-G-834 group was better, indicating that the optimization of the translation initiation element was effective and necessary. Furthermore, the neutralizing antibody level in the LTE-G-834 group was higher than that in the HM-G-834, indicating that the circular RNA molecules prepared in this study were superior to the circular RNA molecules prepared using a commercial circular RNA kit.

[0193] Table 10 Virus neutralizing antibody levels in animals (IU / ml) VNT values ​​above 0.5 IU / ml are considered immune-compliant

[0194]

[0195] Example 5 Different administration methods and antibody duration

[0196] Twenty-five rabies antibody-negative beagles (~3 months old, 5-6 kg) were randomly divided into 5 groups, 5 in each group, and vaccinated: LNP-encapsulated LTE-G-834, injected intramuscularly into the lateral thigh of the hind limb, with a vaccination dose of 20 μg / animal. LNP-encapsulated LTE-G-834, injected intradermally into the thigh of the hind limb, with a vaccination dose of 20 μg / animal. LNP-encapsulated linear-G, injected intramuscularly into the thigh of the hind limb, with a vaccination dose of 20 μg / animal. Commercially available inactivated rabies vaccine (containing the inactivated rabies virus HCP-SAD strain, not less than 10 days before inactivation) was administered. 6.3 FAID 50 / ml), injected into the lateral thigh muscle of the hind limb, with a dose of 1ml / mouse. The PBS control group was inoculated with sterile PBS, with a dose of 1ml / mouse.

[0197] After one dose, neutralizing antibodies and antibody duration tests were performed: blood was collected to prepare serum and virus neutralizing antibodies were tested by conventional methods at 2 weeks, 4 weeks, 8 weeks, 12 weeks, 16 weeks, 20 weeks, 24 weeks, 28 weeks, 32 weeks, 36 weeks, 40 weeks, 44 weeks, 48 ​​weeks, and 52 weeks after administration. The test results are shown in Figure 2. Compared with the commercially available inactivated rabies vaccine and the linear RNA molecule corresponding vaccine (linear-G group), the circular RNA molecule corresponding vaccine prepared in this study produced a higher level of neutralizing antibodies, and only one dose was required to keep the neutralizing antibodies above the standard within 1 year. In contrast, the effective antibodies of the control linear RNA vaccine group (linear-G group) can only be maintained for 40 weeks after a single dose. If more durable antibodies are required, multiple doses or a single high-dose dose may be required. In addition, this study found that for the LTE-G-834 group, intradermal injection produced a stronger immune response than intramuscular injection, so it may be a better way of administration. Achieving longer-lasting immune protection with a single dose can effectively reduce vaccine costs, improve vaccination compliance, and is beneficial to the prevention and control of rabies epidemics and long-term purification.

[0198] Example 6 Background immunogenicity in canine cells

[0199] In order to preliminarily explore the mechanism of effect improvement, the expression of immune-related cytokine IFN-beta induced by each RNA molecule in canine kidney cells MDCK was detected to evaluate the background immunogenicity of each molecule. The operation method refers to patent CN114574483A, as follows:

[0200] Each mRNA was transfected into MDCK cells by Lipofectamine Messenger Max (Invitrogen), and the specific implementation process is as follows:

[0201] MDCK cells were inoculated in DMEM high-glucose medium containing 10% fetal bovine serum and 1% double antibody and cultured in a 37°C, 5% CO2 incubator. The cells were subcultured every 2-3 days.

[0202] (1) Cell transfection:

[0203] Before transfection, MDCK cells were cultured at 1×10 5 Each well was inoculated in a 24-well plate and cultured in a 37°C, 5% CO2 incubator. After the cells reached 70-90% confluence, the mRNA was transfected into MDCK cells at 500 ng / well using Lipofectamine MessengerMax (Invitrogen) transfection reagent according to the reagent operating instructions. The cells expressing for 8 hours were harvested, lysed, and the expression level of immune response proteins was verified by fluorescent quantitative PCR.

[0204] (2) Fluorescence quantitative PCR

[0205] The primer sequences used are as follows:

[0206] IFNb-F: CCAGTTCCAGAAGGAGGACA (SEQ ID NO.9)

[0207] IFNb-R: TGTCCCAGGTGAAGTTTTCC (SEQ ID NO.29)

[0208] The results are shown in Table 11. The background immunogenicity of circular RNA molecules is generally lower than that of linear RNA molecules, but the difference in the circular elements has a greater impact on the results: although the corresponding circular elements of CKV-G-834 and EVE-G-834 have low background immunogenicity in human cell lines, they show high background immunogenicity in canine cells, indicating that the two cell response mechanisms are different and cannot be simply applied. The optimized LTE-G-834 molecule significantly reduces the background immunogenicity in canine cells, which is beneficial to improve the stability and expression efficiency of RNA molecules, and may be an important mechanism for the vaccine to maintain high and medium neutralizing antibody levels in dogs for a long time.

[0209] Table 11 Induction of expression of immune-related cytokine IFN-beta in canine cells

[0210]

[0211]

[0212] The above describes the specific embodiments of the present invention. It should be understood that the present invention is not limited to the above specific embodiments, and those skilled in the art may make various modifications or variations within the scope of the claims, which do not affect the essence of the present invention.

Claims

1. A circular RNA, characterized in that The circular RNA comprises a coding element, which encodes a polypeptide comprising rabies virus G protein.

2. The circular RNA according to claim 1, characterized in that The amino acid sequence of the rabies virus G protein encoded by the coding element comprises the sequence shown in SEQ ID NO.3, or a sequence having at least 90% sequence identity with the sequence shown in SEQ ID NO.3 and having or partially having G protein activity.

3. The circular RNA according to claim 1 or 2, characterized in that The coding element encodes any one of the following: rabies virus G protein N-terminal truncation of 19 amino acids, N-terminal truncation of 19 amino acids / C-terminal truncation of 13 amino acids, N-terminal truncation of 19 amino acids / C-terminal truncation of 14 amino acids, including mutation W33Q, including mutation W33P, including mutation T335Y, including mutation E356F, including mutation E356I, including mutation W33Q / E356I, N-terminal truncation of 19 amino acids / W33Q / E356I, N-terminal truncation of 19 amino acids / C-terminal truncation of 13 amino acids / W33Q / E356I, and wild-type G protein.

4. The circular RNA according to claim 1, characterized in that The nucleotide sequence of the coding element encoding the rabies G protein comprises the sequence shown in SEQ ID NO.4, or has at least 90% sequence identity with the sequence shown in SEQ ID NO.4, and encodes a sequence of a polypeptide having or partially having rabies G protein activity.

5. The circular RNA according to claim 1 or 4, characterized in that The coding element comprises a nucleotide sequence encoding any one of the following: rabies virus G protein N-terminal truncation of 19 amino acids, N-terminal truncation of 19 amino acids / C-terminal truncation of 13 amino acids, N-terminal truncation of 19 amino acids / C-terminal truncation of 14 amino acids, comprising mutation W33Q, comprising mutation W33P, comprising mutation T335Y, comprising mutation E356F, comprising mutation E356I, comprising mutation W33Q / E356I, N-terminal truncation of 19 amino acids / W33Q / E356I, N-terminal truncation of 19 amino acids / C-terminal truncation of 13 amino acids / W33Q / E356I, wild-type G protein.

6. The circular RNA according to claim 1, characterized in that The coding element comprises any one of the following nucleotide sequences encoding rabies G protein with 19 amino acids truncated at the N-terminus / 13 amino acids truncated at the C-terminus / W33Q / E356I: the nucleotide sequence shown in SEQ ID NO.12, the nucleotide sequence 1 shown in SEQ ID NO.13, the nucleotide sequence 2 shown in SEQ ID NO.14, and the nucleotide sequence 3 shown in SEQ ID NO.

15.

7. The circular RNA according to claim 1, characterized in that The circular RNA comprises the elements arranged in the order shown in any one of the following (a) to (d): (a) the first exon, the second exon, the 5' spacer, the translation initiation element, the coding element and the 3' spacer; (b) first exon, second exon, translation initiation element and coding element; (c) translation initiation elements and coding elements; (d) Translation initiation elements, coding elements and insertion elements.

8. The circular RNA according to claim 7, characterized in that The translation initiation element comprises one or more of the following sequences with translation initiation activity: an IRES sequence, a 5'UTR sequence, a Kozak sequence, a sequence comprising m 6 A modified sequence, a complementary sequence of ribosomal 18S rRNA; the insertion element comprises one or more of the following sequences: a non-translated region sequence, a polyN sequence, an adapter sequence, a ribosomal switch sequence, and a sequence binding to a transcriptional regulatory factor; in the polyN sequence, N is selected from at least one of A, T, G, and C.

9. The circular RNA according to claim 7 or 8, characterized in that The coding element comprises a nucleotide sequence of any one of the following: a nucleotide sequence as shown in SEQ ID NO.8, a nucleotide sequence as shown in SEQ ID NO.10, a nucleotide sequence as shown in SEQ ID NO.16, a nucleotide sequence as shown in SEQ ID NO.17, a nucleotide sequence as shown in SEQ ID NO.18, a nucleotide sequence as shown in SEQ ID NO.20, a nucleotide sequence as shown in SEQ ID NO.21, and a nucleotide sequence as shown in SEQ ID NO.

22.

10. A linear RNA, characterized in that The linear RNA undergoes self-cleavage reaction and then circularizes to form the circular RNA according to any one of claims 1 to 9.

11. A recombinant nucleic acid molecule, characterized in that The recombinant nucleic acid molecule forms a linear RNA after transcription; the linear RNA is as shown in claim 10.

12. A recombinant Escherichia coli engineered bacterium, characterized in that: The engineered bacteria are obtained by transforming E. coli with the recombinant nucleic acid molecule as claimed in claim 11.

13. Use of the circular RNA according to any one of claims 1 to 9, or the linear RNA according to claim 10, or the recombinant nucleic acid molecule according to claim 11, or the recombinant Escherichia coli engineered bacteria according to claim 12 in the preparation of a drug for preventing and / or treating rabies.

Images