Kit for simultaneously detecting multiple deletion type alpha-thalassemia genes and application thereof

Abstract

The invention relates to the field of biological detection, in particular to a kit for simultaneously detecting multiple deletion type alpha-thalassemia genes and application of the kit, the kit comprises a primer group and a probe, nucleotide sequences of the primer group are shown as SEQ ID NO.1-8, and nucleotide sequences of the probe are shown as SEQ ID NO.8-12; the deletion type alpha-thalassemia gene is selected from a-alpha 3.7 deletion mutant type, a-alpha 4.2 deletion mutant type, a-SEA deletion mutant type, a Thailand deletion type and the like. The kit is a fluorescent quantitative PCR kit or a digital PCR kit. The primer and the probe in the kit have good specificity and repeatability, and the stability and the accuracy of the detection kit are guaranteed; the method is not limited to detection of known variation, and various deletion type alpha-thalassemia deletion variation can be simultaneously detected in the same tube; operation is simple, short fragments are amplified, and consumed time is short; efficiency is high, cost is low, and flux is large.

Description

Technical Field

[0001] The present invention relates to the field of biological detection, and in particular to a kit for simultaneously detecting multiple deletion-type α-thalassemia genes and its application. Background Art

[0002] Thalassemia, also known as protein-producing anemia, is a hereditary hemolytic disease caused by the disorder of synthesis of one or several normal globin peptide chains. It is widely distributed around the world, affects a large number of people and causes serious harm. The pathogenic mechanism of thalassemia is that defects in the globin gene cause a reduction or loss of synthesis of one or several peptide chains encoded by it, resulting in an imbalance in the composition ratio of hemoglobin, which in turn leads to hemoglobin instability, thus manifesting related symptoms. Depending on the damage to the globin peptide chains in hemoglobin, it can be divided into α, β, γ, δ and other types, among which α and β thalassemia are the most common. The severity of thalassemia depends on the number of deletions / mutations of the four α-globin encoding genes and the two β-globin encoding genes.

[0003] The hereditary hemolytic anemia caused by the mutation of α-globin gene (HBA) is called α-thalassemia. More than 300 α-thalassemia mutations have been found in the world, mainly deletion type, widely distributed, especially in southern my country, where the carrier rate in some areas has exceeded 20%. The pathogenic gene of β-thalassemia is HBB, mainly point mutation, and the incidence rate is lower than α-thalassemia.

[0004] Thalassemia is difficult to treat but can be prevented. Screening, diagnosis and intervention of thalassemia in the childbearing population before marriage, before pregnancy and before birth can effectively reduce the birth of children with moderate and severe thalassemia. GAP-PCR is the main means of detecting deletion-type α-thalassemia on the market. The non-deletion type is determined by PCR amplification combined with probe hybridization or melting curve to determine the specific mutation type. This type of typing method generally has the problem of only being able to detect known mutant types, cumbersome operation, long time consumption, low detection throughput, and not being applicable to fluorescent quantitative PCR (qPCR) and digital PCR (dPCR) platforms. Summary of the invention

[0005] In view of the above-mentioned shortcomings of the prior art, the object of the present invention is to provide a kit for simultaneously detecting multiple deletion-type α-thalassemia genes and its use, so as to solve the problems in the prior art.

[0006] To achieve the above-mentioned purpose and other related purposes, the present invention provides a kit for detecting multiple deletion-type α-thalassemia genes in the same detection system, the kit comprising a primer set and a probe, the nucleotide sequence of the primer set is shown in SEQ ID NO.1 to 8, and the nucleotide sequence of the probe is shown in SEQ ID NO.8 to 12.

[0007] Preferably, the deletion type α-thalassemia gene is selected from -α 3.7 Deletion mutation, -α 4.2 Deletion mutation type, --SEA deletion mutation type, Thai deletion type, etc.

[0008] Preferably, each probe is labeled with a fluorescent reporter group at one end and a fluorescent quencher group at the other end.

[0009] Preferably, the fluorescent reporter group and the fluorescent quencher group of each probe are different from the fluorescent reporter group and the fluorescent quencher group of other probes.

[0010] Preferably, the primer set and the probe are mixed and packaged as a primer-probe mixture, and the concentrations of the primers and probes in the primer-probe mixture are the same.

[0011] Preferably, the kit further comprises a negative control substance and / or a positive control substance.

[0012] Preferably, the kit also includes a sample genomic DNA extraction reagent, a DNA polymerase, a PCR buffer, a dNTP mixture, Mg 2+ and aqueous media.

[0013] Preferably, the kit is a fluorescent quantitative PCR kit or a digital PCR kit.

[0014] The present invention also provides the use of the kit in preparing products for simultaneously detecting multiple deletion-type α-thalassemia genes.

[0015] As described above, the kit for simultaneously detecting multiple deletion-type α-thalassemia genes and its use of the present invention have the following beneficial effects:

[0016] (1) The primers and probes of the present invention have good specificity and repeatability, and the stability and accuracy of the detection kit are guaranteed;

[0017] (2) It is not limited to detecting known variants, and can simultaneously detect various deletion-type α-thalassemia variants in the same tube;

[0018] (3) Simple operation, high efficiency, low cost and high throughput;

[0019] (4) It can be applied to both fluorescent quantitative PCR (qPCR) and digital PCR (dPCR) platforms, and has considerable market application prospects.

[0020] (5) Compared with the traditional gap-PCR method for detecting deletion-type α-thalassemia, the present invention can use shorter PCR amplicons to save detection time; and there is no crossover between the amplicons in the present invention, so single-tube PCR can be achieved; at the same time, the present invention can detect other rare deletion mutations that gap-PCR cannot detect, and the missed detection rate is lower. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 Shown is the amplification curve diagram of each channel of qPCR of the present invention.

[0022] Figure 2 The digital PCR detection of the present invention is shown as a 1-dimensional scatter plot of 4 channels.

[0023] Figure 3 Shown is a graph showing the copy number detection results of the digital PCR of the present invention. DETAILED DESCRIPTION

[0024] The present invention provides a kit for detecting multiple deletion-type α-thalassemia genes in the same detection system. The kit comprises a primer set and a probe. The nucleotide sequence of the primer set is shown in SEQ ID NOs. 1 to 8, and the nucleotide sequence of the probe is shown in SEQ ID NOs. 8 to 12.

[0025] The deletion type α-thalassemia gene is selected from -α 3.7 Deletion mutation, -α 4.2 Deletion mutation, --SEA deletion mutation, Thai deletion, -α 27.6 、-- 11.1 、-- MC 、-- BRIT 、-- MED 、-- HW 、-- FIL , -α 2.7 wait.

[0026] For the specific base sequences of the primer sets and probes exemplified above, as long as they can specifically recognize their respective specific recognition regions under the conditions for PCR implementation (preferably, annealing and self-annealing do not occur between the primers used in a single reaction vessel), one or more bases can be replaced with other bases, or one or more bases can be added to the 3' end or the 5' end. Here, the so-called multiple bases are, for example, 2 to 3. When one or more bases are added to the primer, it is preferably added to the 5' end of the primer.

[0027] The base sequence obtained by replacing one or more bases in the specific base sequences of the primer sets and probes exemplified above with other bases preferably has an identity of 70% or more with the base sequence before substitution (i.e., the base sequence shown in the sequence number), more preferably 75% or more, more preferably 80% or more, more preferably 85% or more, more preferably 90% or more, and more preferably 95% or more.

[0028] As for the length of each primer and probe, as long as it can specifically recognize the corresponding specific recognition region and no hybridization occurs between primers, there is no particular limitation, and it is preferably 15 bases or more and 40 bases or less. More preferably, the lower limit of the length of the primer is 16 bases or more, more preferably 17 bases or more, and more preferably 18 bases or more. More preferably, the upper limit of the length of the primer is 39 bases or less, more preferably 38 bases or less, and more preferably 37 bases or less.

[0029] In certain embodiments of the present invention, one end of each probe is labeled with a fluorescent reporter group, and the other end is labeled with a fluorescent quencher group.

[0030] In certain embodiments of the present invention, the fluorescent reporter group and the fluorescent quencher group of each probe are different from the fluorescent reporter group and the fluorescent quencher group of other probes.

[0031] Specifically, the fluorescent reporter group is selected from one of the following: FAM, HEX, VIC, CY3, ROX, 610, TEXASRED, CY5. Specifically, the fluorescent quenching group corresponds to the fluorescent reporter group and can quench the corresponding fluorescent reporter group. For example, when the fluorescent reporter group is FAM, the fluorescent quenching group is selected from one of the following: BHQ1, Dabcyl, TAMRA, MGB.

[0032] In the present invention, the primer set and the probe may be packaged separately or mixed in one or more systems. For example, each primer and each probe in the primer set may be packaged separately, or all primers in the primer set may be mixed and packaged as a primer mixture, and all probes may be mixed and packaged as a probe mixture, or the primer set and the probe may be mixed and packaged as a primer-probe mixture.

[0033] In certain embodiments of the present invention, the primer set and the probe are mixed and packaged as a primer-probe mixture, and the concentrations of the primers and probes in the primer-probe mixture are the same. The concentrations of the primers and probes in the primer-probe mixture are not specifically limited, as long as they can meet the concentrations during use.

[0034] In certain embodiments of the present invention, based on the PCR reaction system, the final concentration of each primer or each probe in the primer set (i.e., the concentration when used) is 10 to 1000 nM. For example, the final concentration of each primer or each probe in the primer set is 10 to 100 nM, 100 to 200 nM, 200 to 400 nM, 400 to 600 nM, 600 to 800 nM, or 800 to 1000 nM.

[0035] In certain embodiments of the present invention, the kit further includes a negative control and / or a positive control. The negative control is, for example, gDNA with a normal HBA copy number. The positive control is gDNA with a known deletion variation.

[0036] In certain embodiments of the present invention, the kit further comprises a sample genomic DNA extraction reagent, a DNA polymerase, a PCR buffer, a dNTP mixture, Mg 2+ These reagents can be obtained commercially.

[0037] The PCR buffer can usually provide the most suitable conditions for the enzyme-catalyzed reaction to the PCR system. The buffer only needs to play the above-mentioned role.

[0038] The dNTP mixture is usually used as a raw material in DNA synthesis, and specifically may include dATP, dGTP, dTTP, dCTP, and the like.

[0039] The aqueous medium can usually be used to adjust the concentration of each component in the PCR system, and can usually be used as a dilution solvent. The aqueous medium is, for example, water.

[0040] The DNA polymerase, PCR buffer, dNTP mixture, Mg 2+ It can be a purchased individual reagent or a PCR mixed reagent (PCR Mix), such as 2×Superstart Direct Premix (Probe qPCR) (Cat. No. MD201) from BioRay Biotechnology.

[0041] Since such commonly used PCR reagents can be purchased separately from the market or prepared by oneself, the specific reagents that need to be assembled into the kit can be configured according to actual needs. For convenience, all reagents can be assembled into the kit.

[0042] The kit of the present invention may include the above reagents in various independent packages, or may be a prepared PCR detection mixture containing the primer set and the probe. The PCR detection mixture may be prepared by itself, or may be obtained by directly adding the primer set and the probe to a commercially available universal PCR mixture reagent without primers.

[0043] The kit of the present invention is a fluorescent quantitative PCR kit or a digital PCR kit.

[0044] The basic principle of the primer set of the present invention for detecting deletion-type α-thalassemia gene mutation is the same as the α-globin gene copy number variation typing method disclosed in the patent application number 202310338692X. A brief description is as follows:

[0045] By detecting the copy number of multiple specific segments on the α-globin gene (HBA1, HBA2) and the copy number of the specific internal reference segment on the reference gene, the mutation type of the α-globin gene is obtained based on the matching relationship between the copy number and the mutation type of the α-globin gene.

[0046] The specific segments on the α-globin gene are marked as Y, Z, and X, respectively, wherein X is located in the non-homologous region upstream of the HBA2 gene, and the genomic position of X is chr16: 170800-171520; Y is located between the HBA1 and HBA2 genes, located upstream of the HBA2 gene, and the genomic position is chr16: 175048-175797; Z is located in the non-homologous region upstream of HBA2 and downstream of the HBA1 gene, and the genomic position of Z is chr16: 165401-169452, chr16: 177538-183301 (all the above genomic positions use the GRCH38 version). The specific sequence segment of the reference gene RPP30 in the human genome is selected and marked as IC.

[0047] The matching relationship between the copy number of each selected region X, Y, Z, and IC and the mutation type of the α-globin gene is shown in the following table, where: αα represents the wild type, that is, the HBA2 and HBA1 genes are not deleted; -α 3.7 , -α 4.2 、-- SEA Representing 3.7, 4.2, SEA deletion mutant, ααα anti3.7 and ααα anti4.2 Represents α-globin gene triad; other rare mutations with double deletion (i.e., HBA2 and HBA1 genes are both missing on one chromosome) (such as Thai type) have the same typing results as "-- SEA "Type consistent.

[0048]

[0049] The present invention also provides the use of the kit in preparing products for simultaneously detecting multiple deletion-type α-thalassemia genes.

[0050] The following describes the embodiments of the present invention through specific examples, and those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and the details in this specification can also be modified or changed in various ways based on different viewpoints and applications without departing from the spirit of the present invention.

[0051] Before further describing the specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terms used in the examples of the present invention are for describing the specific embodiments rather than for limiting the scope of protection of the present invention; in the present specification and claims, unless otherwise expressly stated herein, the singular forms "a", "an" and "the" include plural forms.

[0052] When the embodiments give numerical ranges, it should be understood that, unless otherwise specified in the present invention, both endpoints of each numerical range and any numerical value between the two endpoints can be selected. Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those generally understood by those skilled in the art. In addition to the specific methods, equipment, and materials used in the embodiments, according to the grasp of the prior art by those skilled in the art and the record of the present invention, any methods, equipment, and materials of the prior art similar or equivalent to the methods, equipment, and materials described in the embodiments of the present invention can also be used to realize the present invention.

[0053] Example 1: Accuracy evaluation of primer sets and kits applied to fluorescent quantitative PCR (qPCR) platform

[0054] 1.1 Evaluation of the accuracy of primer sets and kits for α-deletion standards

[0055] 1.1.1 Composition of the kit:

[0056] (1) The primer sets and probes are as follows:

[0057] Tha_X_F:AGGAGAGTGTTCCTCTTCCTGTC(SEQ ID NO.1)

[0058] Tha_X_R:AGAGCCTGTGGCAGTAGTTG(SEQ ID NO.2)

[0059] Tha_Y_F:CCTTGAATGCCTCGTCCACA(SEQ ID NO.3)

[0060] Tha_Y_R:GGGAGGTAGGCAGTCCTCTAA(SEQ ID NO.4)

[0061] Tha_Z_F:CACTGGTTTCCCAGAGGTCC(SEQ ID NO.5)

[0062] Tha_Z_R:CTGGGAGGTTTTACGGAGACT(SEQ ID NO.6)

[0063] RPP-F:ACCAGGTTAGCTGGCACTTT(SEQ ID NO.7)

[0064] RPP-R:AGCCTCTTGGGGGAGCATTA(SEQ ID NO.8)

[0065] Tha_X_P:CATCCCATGCTGAGGGAACA(SEQ ID NO.9)

[0066] Tha_Y_P:CTCCAGACTTCCTCAGGGCCTGTGA(SEQ ID NO.10)

[0067] Tha_Z_P:GCCATGCTGGAGTGGGACTT(SEQ ID NO.11)

[0068] CT-IC-P:CAACCCAGAGTCACCCAAGGA(SEQ ID NO.12)

[0069] The present invention performs relative quantification on a total of four targets, X, Y, Z and internal standard IC, wherein X, Y and Z are target gene HBA related sequences; IC is RPP30, which is a reference gene. The fluorescent groups used by the fluorescent probes of targets X, Y and Z are HEX, ROX and CY5, respectively, and the fluorescent group used to detect RPP30 is FAM.

[0070] (2) Other components of PCR reaction: Superstart PCR Mix from BioRay Biotechnology.

[0071] 1.1.2 Sample source and variation information: α-deletion standard products were purchased from Jingliang Technology (Shenzhen) Co., Ltd. The specific information is as follows:

[0072]

[0073]

[0074] 1.1.3 Prepare PCR reaction solution: 20μL PCR reaction system includes: 10μL 2*Pre Mix (Baorui Biotechnology), 5μL primer premix system, 3μL H2O and 2μL DNA template. The primer premix system consists of the following:

[0075]

[0076] In the experiment, GW-TGTM101 was used as the negative control, and three wells were repeated. The arithmetic mean of its CT value was used for calculation during analysis.

[0077] 1.1.4 After mixing evenly, the above PCR reaction solution was placed on a fluorescent quantitative PCR instrument (Shanghai Hongshi, equipment model SLAN-96S) for amplification. The specific program was: 50℃, 2min, 95℃ pre-denaturation for 3min, 98℃ pre-denaturation for 2min; 98℃ denaturation for 10sec, 60℃ annealing + extension for 45sec, 40 cycles. After the program was completed, the fluorescence signal was collected at 60℃ and the CT value was derived.

[0078] 1.1.5 Data analysis and result judgment: The amplification curves of each channel of qPCR detection are attached. Figure 1

[0079] After the PCR reaction is completed, the derived CT value is as follows:

[0080]

[0081]

[0082] The relative copy number RQ was calculated and evaluated using the 2^(-ΔΔCT) method. The specific calculation method is as follows:

[0083] ΔCT=CT(3 targets)-CT(IC)

[0084] ΔΔCT = ΔCT (3 targets for each sample) - ΔCT (3 targets for the negative reference)

[0085] RQ (relative copy number) = 2^(-ΔΔCT)

[0086] The copy number is obtained by rounding off RQ×2.

[0087] The calculated RQ (relative copy number) value and copy number are as follows:

[0088]

[0089] The analysis and comparison results showed that the test results of the 6 columns of positive reference products were consistent with the theoretical values, with an accuracy of 100%.

[0090] 1.2 Evaluation of the accuracy of primer sets and kits in clinical samples

[0091] 1.2.1 Sample preparation: 46 peripheral blood samples preserved with clinical EDTA anticoagulants were collected, including 28 negative samples and 18 positive samples, and the variant types of the positive samples were known. The Tiangen columnar peripheral blood genomic DNA extraction kit / Novozyme automated extraction kit was used to extract sample gDNA, which was used for verification experiments after quality inspection.

[0092] 1.2.2 Prepare PCR reaction solution, including primer mix and reaction solution mix, use 20 μL of PCR system for amplification and collect fluorescence signals. The details are the same as in Example 1.1.

[0093] 1.2.3 Data analysis and result judgment: According to the derived CT value, the relative copy number was calculated using the 2^(-ΔΔCT) method. The test results and analysis of 46 gDNA samples are summarized as follows, where numbers 1-28 are negative samples and 29-46 are positive samples:

[0094]

[0095]

[0096]

[0097] The above data show that the primer set and kit of the present invention have an accuracy of 100% when testing 46 samples in this batch. And regarding the testing of positive samples, the test results of No. 29, 30, 32 and 35 are shown as follows: SEA / αα, the test result of No. 37 is -α 4.2 / -- SEA , the test results for No. 31, 36, 38, 40 and 46 are -α 3.7 / αα, the test results for No. 33, 34, 39 are -α 4.2 / αα, the test results of No. 41 and 42 are -α 3.7 / -- SEA , the test results of No. 43 and 44 are shown as ααα anti4.2 / αα, the test result of No. 45 is ααα anti3.7 / αα, the results are consistent with the expected values.

[0098] Example 2: Accuracy evaluation of primer sets and kits applied to digital PCR (dPCR) platform

[0099] 2.1 Sample preparation: A normal human gDNA (NC1) and α-deletion standard (purchased from Jingliang Technology (Shenzhen) Co., Ltd.) were used. After the sample was diluted to a concentration of about 5 ng / μL, it was digested with HindIII enzyme (enzyme site: A / AGCTT), and 0.5 μL HindIII enzyme was used for every 6 μL DNA sample, and the digestion was carried out at 37°C for 15 min.

[0100] 2.2 Preparation of PCR reaction solution: The primer set and probe are the same as those used in qPCR in Example 1; the PCR mix is ​​the Superstart PCR Mix of Baorui Biotechnology. Considering the requirements of the digital PCR instrument, CY5.5 dye is added to the reaction system for channel positioning. The specific reaction system is as follows:

[0101] Table 1 Premixed system of reaction solution for dPCR reaction using the kit of the present invention

[0102]

[0103] 2.3 Running the digital PCR instrument experimental program: The digital PCR instrument used was the digital PCR integrated machine (Sniper DQ24) of Sinafo Medical Technology Co., Ltd. The running program was: 60℃ droplet tiling for 5min, 95℃ pre-denaturation for 3min, 98℃ pre-denaturation for 2min; 98℃ denaturation for 30sec, 60℃ annealing + extension for 45sec, 45 cycles. Locate channel CY5.5. Collect the fluorescence signal after the operation.

[0104] 2.4 Data quality control: See the attached one-dimensional graph of digital PCR test results Figure 2 , the positive and negative of each target can be clearly distinguished, indicating that the test results are highly reliable. The effective droplet count is summarized in the following table:

[0105]

[0106]

[0107] The number of effective droplets of the eight samples in this batch was close to the expected value of 20,000, and the CV value was in line with the expected "less than 5%", which was 2.5%-3.8% in this batch. The quality control of the experimental data was qualified.

[0108] 2.5 Data analysis and result judgment: The absolute copy number detection values ​​of the target to be tested in each sample are compared in the attached Figure 3 The comparison of absolute copy number detection value and relative copy number analysis results is shown in the table below. The relative copy number is calculated as follows: the absolute copy number detection value of the X, Y, and Z specific segments is divided by the absolute copy number detection value of the specific sequence segment IC of the reference gene, and then multiplied by 2. The result is rounded to get the relative copy number.

[0109]

[0110] 2.6 Comprehensive analysis of all standard digital PCR test results, all standard test results are expected, and the detection accuracy is 100%. Digital PCR detection of α-thalassemia deletion typing does not require the use of control substances, and α-thalassemia deletion typing can be directly obtained by analyzing the absolute copy number detection results of a single sample itself. The absolute copy number detection value per unit volume of the Y-specific segment of STD3 and the X-specific segment of STD6 is 0, proving that the primers and probes of the present invention have good specificity. Therefore, the present invention can be used for α-thalassemia deletion typing detection on a digital PCR platform.

[0111] The above examples are for the purpose of illustrating the embodiments disclosed by the present invention and are not to be construed as limiting the present invention. In addition, the various modifications listed herein and the variations of the methods in the invention are obvious to those skilled in the art without departing from the scope and spirit of the present invention. Although the present invention has been specifically described in conjunction with various specific preferred embodiments of the present invention, it should be understood that the present invention should not be limited to these specific embodiments. In fact, various modifications as described above that are obvious to those skilled in the art to obtain the invention should be included within the scope of the present invention.

Claims

1. A kit for detecting multiple deletion-type α-thalassemia genes in the same detection system, characterized in that: The kit comprises a primer set and a probe, the nucleotide sequence of the primer set is shown as SEQ ID NOs. 1 to 8, and the nucleotide sequence of the probe is shown as SEQ ID NOs. 8 to 12.

2. The kit according to claim 1, characterized in that The deletion type α-thalassemia gene is selected from -α 3.7 Deletion mutation, -α 4.2 Deletion mutation, --SEA deletion mutation, -α 27.6 、-- 11.1 、-- MC 、-- BRIT 、-- MED 、-- HW 、-- FIL , -α 2.7 and / or Thai deletion type.

3. The kit according to claim 1, characterized in that Each probe is labeled with a fluorescent reporter group at one end and a fluorescent quencher group at the other end.

4. The kit according to claim 3, characterized in that The fluorescent reporter group of each probe is different from the fluorescent reporter groups of other probes.

5. The kit according to claim 3, characterized in that The fluorescent reporter group is selected from one of the following: FAM, HEX, VIC, CY3, ROX, 610, TEXAS RED or CY5.

6. The kit according to claim 1, characterized in that The primer set and the probe are mixed and packaged into a primer-probe mixture, and the concentrations of the primers and probes in the primer-probe mixture are the same.

7. The kit according to claim 1, characterized in that The primer set and probe in the kit can be prepared into the following final concentrations: based on the PCR reaction system, the final concentration of each primer or each probe in the primer set is 10-1000 nM.

8. The kit according to claim 1, characterized in that The kit also includes a sample genomic DNA extraction reagent, a DNA polymerase, a PCR buffer, a dNTP mixture, Mg 2+ , aqueous medium, negative control or positive control.

9. The kit according to claim 1, characterized in that The kit is a fluorescent quantitative PCR kit or a digital PCR kit.

10. Use of the kit according to any one of claims 1 to 9 in the preparation of a kit for simultaneously detecting multiple deletion-type α-thalassemia gene products.

Images