Method for detecting pathogen effect protein localization based on cotton root epidermal cells

Abstract

The invention relates to the technical field of biology, in particular to a method for detecting pathogen effect protein localization based on cotton root epidermal cells. The method comprises the following steps: constructing a recombinant vector carrying a pathogenic bacterium effect protein coding gene and a nuclear localization signal, and transferring the recombinant vector into an agrobacterium strain to obtain recombinant agrobacterium; co-culturing the recombinant agrobacterium and pathogenic bacteria, and screening to obtain an infected strain; infecting the epidermis of the root of the cotton seedling by using the infection strain, and then culturing for 2-3 days Cotton seedling root epidermis is dyed with a DAPI solution, green fluorescence signals are observed under a laser confocal microscope after flaking, and effect protein is positioned according to the green fluorescence signals. The method disclosed by the invention can be used for rapidly and efficiently detecting the positioning of the pathogenic bacterium effect protein in the epidermis of the cotton root, and determining that the effect protein is an extraplasm effect protein or a cytoplasm effect protein, thereby providing a technical support for the research on the function of the cotton pathogenic bacterium effect protein.

Description

Technical Field

[0001] The invention relates to the field of biological technology, and in particular to a method for detecting the location of pathogen effector proteins based on cotton root epidermal cells. Background Art

[0002] Mature proteins can only play a stable biological function in specific subcellular organelles. Subcellular structures provide relatively independent life activity sites for these proteins to perform their functions. In order to accurately understand the function of pathogen effector proteins, in addition to analyzing their protein structure, it is also necessary to clarify whether they are located in the apoplast or in the cell, so as to determine their biological functions and locations. Therefore, clarifying the location of pathogen effector proteins in the host is very important for studying the function of effector proteins.

[0003] Subcellular localization generally uses the unique fluorescent properties and sensitivity of fluorescent proteins such as green fluorescent protein GFP and red fluorescent protein RFP to track proteins in cells. The target protein is fused to the N-terminus or C-terminus of the fluorescent protein, and the fusion protein is expressed in the receptor material cell through transient transformation technology or stable genetic transformation technology. The target protein will pull the fluorescent protein to the target organelle. After laser irradiation with a laser confocal microscope, the fluorescent protein will emit a fluorescent signal. By observing the position of the fluorescent signal in the cell, the position of the protein can be accurately located. The nuclear localization signal NLS can guide the protein in the cell into the nucleus, so that the fluorescent signal diffused in the cell is concentrated in the nucleus, while the effector protein located in the apoplast cannot observe the fluorescent signal in the nucleus even if it is fused with NLS, so as to judge the localization of the protein.

[0004] Effector proteins are proteins secreted by pathogens that inhibit the host's immune function. Currently, in the study of the function of effector proteins of soil-borne cotton pathogens, the localization of effector proteins is mostly determined by methods such as infecting onion epidermis. However, this method cannot accurately reveal the localization of effector proteins of cotton pathogens in the host cotton roots. Summary of the invention

[0005] In view of the shortcomings of the existing methods, the present invention provides a method for localizing and detecting pathogen effector proteins based on the cotton root epidermis.

[0006] To achieve the above purpose, the technical solution adopted by the present invention is: A method for detecting the localization of pathogen effector proteins based on cotton root epidermal cells, comprising the following steps: S1. Construct a recombinant vector carrying a pathogen effector protein encoding gene and a nuclear localization signal, and transfer the recombinant vector into the EHA105 Agrobacterium strain to obtain a recombinant Agrobacterium; S2, co-culturing the recombinant Agrobacterium with the pathogenic bacteria strain to screen out the infectious strain; S3, infecting the root epidermis of cotton seedlings with the infectious strain and then culturing for 2 to 3 days; S4. The root epidermis of the cotton seedlings was stained with DAPI solution, and the green fluorescence signal was observed under a laser confocal microscope after slice preparation, and the effector protein was located according to the green fluorescence signal.

[0007] Proteins located in the apoplast, that is, outside the cell, cannot enter the cell, so the nuclear localization signal cannot play a role, that is, it cannot guide the protein into the nucleus; only proteins that can enter the cell will be guided into the nucleus by the nuclear localization signal. That is, if a protein cannot enter the cell, it naturally cannot enter the nucleus, because the nucleus is in the cell; only when this protein enters the cell will it have the opportunity to enter the nucleus. Through the method of the present invention, it can be directly concluded from the fluorescent photos that when the pathogen transformed and fused with the nuclear localization signal protein infects the cotton epidermis, the presence of green fluorescence in the nucleus indicates that the protein can enter the cell, on the contrary, the absence of green fluorescence in the nucleus indicates that the protein cannot enter the cell. Figure 1 and Figure 2 The Avr1b protein shown in the literature is a recognized effector protein in the art and has been confirmed in the literature to be able to enter host cells. In the method of the present invention, there is green fluorescence in the cell nucleus, which also verifies that it can enter the cell, which is consistent with the reported literature. The method of the present invention can more accurately reveal the location of the effector protein of Verticillium dahliae in the host cotton root, and has the advantages of short cycle, easy operation, strong practicality, etc.

[0008] Furthermore, the Agrobacterium is EHA105 Agrobacterium.

[0009] Furthermore, the pathogenic bacteria include Verticillium dahliae of cotton.

[0010] Furthermore, the effector protein includes Avr1b protein and VdEG1 protein.

[0011] Furthermore, the gene sequence encoding the Avr1b protein is shown as SEQ ID NO.1, and the gene sequence encoding the VdEG1 protein is shown as SEQ ID NO.3.

[0012] Furthermore, when the effector protein is Avr1b protein, the sequence of the nuclear localization signal is shown as SEQ ID NO.2; when the effector protein is VdEG1 protein, the sequence of the nuclear localization signal is shown as SEQ ID NO.4.

[0013] Furthermore, the basic vector of the recombinant vector carrying the pathogen effector protein gene and the nuclear localization signal is the pSUL-Tef plasmid.

[0014] Furthermore, the cotton variety is Hebei Cotton 11.

[0015] Furthermore, if there is no green fluorescence in the cell nucleus, it indicates that the effector protein cannot enter the cell, and if there is green fluorescence in the cell nucleus, it indicates that the effector protein can enter the cell.

[0016] The present invention has the following beneficial effects: The method of the present invention can accurately and efficiently reveal the location of the effector protein of Verticillium dahliae in the host cotton root. More importantly, the method of the present invention has identified an effector protein VdEG1 that can enter the nucleus of the epidermal cells of the cotton root. Based on this result, we can subsequently explore whether VdEG1 has the function of inhibiting cotton immunity and how to resist this inhibitory effect. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 The subcellular localization of Avr1b-GFP in the pSUL-Tef-Avr1b transformed strain of Example 1, wherein A is a DAPI staining image, B is a green fluorescence observation effect image, C is a bright field observation effect image, and D is a three-channel overlap effect image of A, B, and C, and the scale bar = 100 μm.

[0018] Figure 2 The subcellular localization of Avr1b-NLS-GFP in the pSUL-Tef-Avr1b-NLS transformed strain of Example 1, wherein A is a DAPI staining image, B is a green fluorescence observation effect image, C is a bright field observation effect image, and D is a three-channel overlap effect image of A, B, and C, and the scale bar = 100 μm.

[0019] Figure 3 The subcellular localization of VdEG1-GFP in the pSUL-Tef-VdEG1 transformed strain of Example 1, scale = 100 µm, wherein A is a DAPI staining image, B is a green fluorescence observation effect image, C is a bright field observation effect image, and D is an overlap effect image of the three channels A, B, and C.

[0020] Figure 4 The subcellular localization of VdEG1-NLS-GFP in the pSUL-Tef-VdEG1-NLS transformed strain of Example 1, scale = 100 µm, wherein A is a DAPI staining image, B is a green fluorescence observation effect image, C is a bright field observation effect image, and D is an overlap effect image of the three channels A, B, and C.

[0021] Figure 5It is the subcellular localization of Avr1b-NLS-GFP in the pSUL-Tef-Avr1b-NLS transformed strain of Comparative Example 1, wherein A is a DAPI staining image, B is a green fluorescence observation effect image, C is a bright field observation effect image, and D is a three-channel overlap effect image of A, B, and C, and the scale bar = 100 µm.

[0022] Figure 6 It is the subcellular localization of Avr1b-NLS-GFP in the pSUL-Tef-Avr1b-NLS transformed strain of Comparative Example 2, wherein A is a DAPI staining image, B is a green fluorescence observation effect image, C is a bright field observation effect image, and D is a three-channel overlap effect image of A, B, and C, and scale = 100 µm. DETAILED DESCRIPTION

[0023] The present invention is described in detail below in conjunction with the accompanying drawings and specific examples, but should not be construed as limiting the present invention. Unless otherwise specified, the technical means used in the following examples are conventional means well known to those skilled in the art, and the materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained from commercial sources.

[0024] Example 1: A method for localizing and detecting pathogen effector proteins based on the cotton root epidermis.

[0025] The pathogen effector proteins of this embodiment are the Verticillium dahliae effector proteins Avr1b and VdEG1. It is known that Avr1b can enter host cells, but it is unknown whether VdEG1 can enter host cells. The NCBI sequence number of Avr1b is XM_009533001.1, and the encoding gene sequence is shown in SEQ ID NO.1. The NCBI sequence number of VdEG1 is XM_009654101.1, and the encoding gene sequence is shown in SEQ ID NO.3.

[0026] The basic vector used to construct the recombinant vector in this example is pSUL-NEO-Tef-3GAGFP-TrpC, hereinafter referred to as pSUL-Tef plasmid, which was donated by Huishan Guo, a researcher at the Institute of Microbiology, Chinese Academy of Sciences, and was published in the paper "Secretory proteins are delivered to the septinorganized penetration interface during root infection by Verticillium dahliae 》.

[0027] 1. Test method.

[0028] (1) Construction of recombinant vector.

[0029] Will Avr1bThe gene was forward inserted between the BamHI and EcoRI sites of the pSUL-Tef plasmid containing the strong Tef promoter to obtain the recombinant vector pSUL-Tef-Avr1b.

[0030] Connect the nuclear localization signal NLS1 shown in SEQ ID NO.2 to Avr1b The 3′ end of the gene was cleaved to obtain fusion gene 1, which was positively inserted between the BamHI and EcoRI sites of the pSUL-Tef particle to obtain the recombinant vector pSUL-Tef-Avr1b-NLS.

[0031] Will VdEG1 The gene was inserted into the BamHI and EcoRI sites of the pSUL-Tef plasmid in the forward direction to obtain the recombinant vector pSUL-Tef-VdEG1.

[0032] Connect the nuclear localization signal NLS2 shown in SEQ ID NO.4 to VdEG1 The 3′ end of the gene was cleaved to obtain fusion gene 2, and the fusion gene 2 was forwardly inserted between the BamHI and EcoRI sites of the pSUL-Tef plasmid to obtain the recombinant vector pSUL-Tef-VdEG1-NLS.

[0033] SEQ ID NO.1: ATGCGTCTATCTTTTGTGCTTTCTCTTGTCGTGGCCATTGGCTACGTCGTGACCTGCAACGCAACTGAGTACTCCGACGAAACCAATATCGCCATGGTGGAATCTCCAGATCTCGTCCGTCGCTCGCTCAGGAACGGCGACATTGCCGGTGGAAGATTTCTTCGAGCTCATGAAGAGGACGATGCGGGGGAGCGGACCTTCAGCGTGAC TGACCTGTGGAACAAGGTGGCGGCCAAAAAGTTGGCCAAGGCGATGCTGGCGGACCCTTCAAAGGAGCAGAAAGCGTACGAGAAGTGGGGCAAAGAAGGGGTACAGCCTGGATAAGATCAAGAACTGGTTGGCAATCGCGGACCCCAAGCAGAAGGGGAAGTACGACCGTATCTACAACGGATACACCTTTCACCTGTATCAGAGCTGA.

[0034] SEQ ID NO.2: AAGAAACGACTGGCAAAGCTAAAAAGGAAGAGG。

[0035] SEQ ID NO.3: ATGAAGGTCGCAGCCCTCCTCGCCCTGCCCCTCGCCGTGCTGGCCTCGCCCCTGACCTCGCCCCTGAGCGCCCGCCAGTCCTCGACCTTCTGCGACGACTGGGGCAGCGCCGTCGCGGGGCCGTACACGGTGTACAACAACCTCTGGGGCAAGGGCTCCGCGACGTCGGGCCAGCAGTGCACGACGCTCTCGGGCCTGTCGGGCAACGCCGTGTCGTGGTCGACGTCGTGGAGCTGGGCCGGCGGCCAGAACAACGTAAAGTCGTACCCCAACGCCCTGCTGGCCATTACCAAGCGGCCGCTGAGCCAGGTGTCGTCGATCCCGTCGTCGTGGTCCTGGTCCTACACGGGCTCGAGCCTCGTCGCCAACGTCGCCTACGACCTCTTCACCGGCAACACGGCCGACAGCGCGCCGGCCTACGAGATCATGATCTGGCTCGGCTCCCTCGGCGGCGCCGGCCCCATCAGCGCCACCGGCAGCACCATTGCCAACCCCACCATTGCCGGCACCACCTGGAGGCTGTACCAGGGCAGCCACAGCCAGATGAACGTCTTCAGCTTCGTCGCGCCCTCCAACATTCGCAGCTTCAACGCTGACCTGTACGCCTTTGTCAACTACCTCGCGGCCAACCACGGCCTGCCGAAGACCCAGATCCTGCAGAGCGTCGGCGCTGGCACGGAGCCGTTCACGGGGTCCAACGCCGTCTTCACGACCAGCTCGTACCAGGTTTCTGTTTCTTGA。

[0036] SEQ ID NO.4: ATGGCGAAGCGTGAGCGCGTGGAGATGGGCAACATGGCTCCGACCATGAAGAAGACTAAGGGC。

[0037] (2) Obtaining of Agrobacterium strains.

[0038] Take 2 μL of the recombinant vectors pSUL-Tef-Avr1b, pSUL-Tef-Avr1b-NLS, pSUL-Tef-VdEG1 and pSUL-Tef-VdEG1-NLS carrying the target gene and its nuclear localization signal into the thawed EHA105 Agrobacterium competent medium, and gently pipette to mix; let stand on ice for 5 min, liquid nitrogen for 5 min, 37°C water bath for 5 min, and ice bath for 5 min in sequence; add 700 μL of sterile liquid LB culture medium without antibiotics to a 1.5 mL centrifuge tube, mix well, and resuscitate at 28°C and 200 rpm for 2 to 3 h; pipette 100 μL and spread it on the LB plate with kanamycin and rifampicin resistance, place the plate upside down in a 28°C incubator and culture for 2 to 3 days to obtain Agrobacterium colonies, pick the colonies for PCR verification, and after obtaining the correct colonies, shake and culture them in LB liquid culture medium at 28°C for 12 to 24 h, and pipette 1 mL of the stored bacteria.

[0039] (3) Obtaining infectious strains.

[0040] The Agrobacterium strains into which the recombinant vector was transferred were co-cultured with the wild type XJ592 of cotton Verticillium dahliae, and the infective strains were obtained after screening. The specific steps were as follows: the Agrobacterium cultured at 28°C was shaken and centrifuged at 6000 rpm, and the cells were collected, and the cells were washed twice with IM liquid medium, and then washed once with IM liquid medium supplemented with 200 μM acetosyringone, and finally the cells were suspended with 1.5 mL of IM liquid medium supplemented with acetosyringone, and the concentration was adjusted to OD 600 =0.6~0.8; pick the wild-type XJ592 bacterial cake of cotton Verticillium wilt pathogen cultured for 3 days and put it into the Agrobacterium suspension, shake and mix, and adjust the spore count to 1×10 7 spores / mL, aspirate 200μL of the mixture and apply it on the IM solid culture medium covered with glass paper, and culture it in a 25℃ constant temperature incubator for 36-48h; rinse the bacteria on the IM culture medium with 1-2mL sterile water, and apply 800μL / plate on the PDA culture medium containing 100μg / mL carbenicillin, 200μg / mL cephalosporin, and 100μg / mL geneticin resistance, and place it upright to dry, then invert it in a 25℃ constant temperature incubator for 5-7d. Pick the monoclonal colonies on the resistance culture medium for PCR verification and fluorescence observation to ensure that the vector is correctly expressed in the bacteria, and activate and preserve the correct strain in time.

[0041] (4) Obtaining spore suspension.

[0042] The infective strain was activated on PDA medium. After 3 to 4 days, the bacterial cake was placed in a 2 mL centrifuge tube. Sterile water was added and shaken to form a spore suspension. The spore count was adjusted to 1 × 10 7 spores / mL.

[0043] (5) Preparation of culture medium and infection of cotton epidermis.

[0044] Prepare water agar medium: weigh 20 g agar powder into 1 L pure water, mix well and sterilize in a high temperature and high pressure steam sterilizer at 121°C for 20 min, add 100 μg / mL streptomycin sulfate and 100 μg / mL ampicillin and pour onto the plate.

[0045] Planting Hebei Cotton 11 cotton, take 3-week-old cotton seedlings to clean the roots, take 2 cm upward from the fibrous root, gently peel off the cotton root epidermis with tweezers and wash it in sterile water, then disinfect it in 75% alcohol for 1 min, and finally put it in sterile water for 1 min, and wash it twice with sterile water; spread the cleaned cotton root epidermal cells on water agar medium, dry them in a sterile operating table, use a pipette to drop the fungal spore suspension from one side to the vicinity of the cotton root epidermis, dry it, seal it, and culture it upside down in a constant temperature incubator at 25℃ for 3 days.

[0046] (6) Fluorescence observation.

[0047] The infected cotton root epidermis was stained with a 10 μg / mL DAPI solution at room temperature in the dark for 10-15 min. After preparation, the GFP and DAPI fluorescence signals were observed under a laser confocal microscope at excitation wavelengths of 488 nm and 340 nm, respectively.

[0048] 2. Test results.

[0049] According to literature reports, the effector protein Avr1b enters plant cells to exert its function. First, the cotton root epidermis was infected with Verticillium dahliae expressing Avr1b-GFP, and the subcellular localization of Avr1b-GFP in the cotton root epidermis was analyzed. Since Avr1b-GFP is dispersed in the cytoplasm and has weak fluorescence, no strong green fluorescence was observed in the cotton root epidermal cells. Figure 1 When the cotton root epidermis was infected with Verticillium dahliae expressing Avr1b-NLS-GFP, Avr1b-NLS-GFP accumulated in the nucleus due to the nuclear localization signal, so strong green fluorescence was observed in the nuclei of the cotton root epidermal cells, overlapping with the nuclear dye DAPI, as shown in Figure 2. Figure 2 As shown, Avr1b can enter plant cells, which is consistent with literature reports. When the cotton root epidermis was infected with cotton Verticillium dahliae expressing VdEG1-GFP or VdEG1-NLS-GFP, no strong VdEG1-GFP green fluorescence was observed in the nuclei of cotton root epidermal cells, such as Figure 3 As shown in Figure 2, strong VdEG1-NLS-GFP green fluorescence was observed in the nuclei of cotton root epidermal cells, and overlapped with the nuclear dye DAPI, as shown in Figure 2. Figure 4 As shown, VdEG1 can enter the epidermal cells of cotton roots to exert its function. This method can be used to explore whether the effector proteins secreted by pathogens can enter plant cells and exert their functions during the infection of the host.

[0050] Comparative Example 1: The influence of cotton growth period on the test results.

[0051] The root epidermis of cotton seedlings planted for 5 weeks was infected with cotton Verticillium dahliae expressing Avr1b-NLS-GFP, and the infected root epidermis was stained with a DAPI solution having a concentration of 10 μg / mL at room temperature in the dark for 10 to 15 minutes. After preparation, the GFP and DAPI fluorescence signals were observed under a laser confocal microscope at excitation wavelengths of 488 nm and 340 nm, respectively. The rest of the operations were the same as in Example 1.

[0052] The results are as follows Figure 5 As shown, if the cotton growth period is too long, it will cause incomplete formation of the root epidermis or excessive growth of the root epidermis, which is not conducive to the infection of pathogens and subsequent observation.

[0053] Comparative Example 2: Effect of DAPI solution concentration on detection results.

[0054] The root epidermis of cotton seedlings planted for 3 weeks was infected with cotton Verticillium dahliae expressing Avr1b-NLS-GFP, and the infected root epidermis was stained with a DAPI solution having a concentration of 100 μg / mL at room temperature in the dark for 10 to 15 minutes. After preparation, the GFP and DAPI fluorescence signals were observed under a laser confocal microscope at excitation wavelengths of 488 nm and 340 nm, respectively. The rest of the operations were the same as in Example 1.

[0055] The results are as follows Figure 6 As shown in the figure, the fluorescence intensity of DAPI is related to the concentration of DAPI solution. A higher concentration of DAPI solution will result in a stronger fluorescence signal. Too high a concentration of DAPI solution will also lead to increased nonspecific binding and background fluorescence, thus affecting the accuracy of the experimental results. Therefore, when using DAPI for cell nucleus staining, it is necessary to optimize the concentration of DAPI solution to obtain the best fluorescence signal intensity and exposure effect.

[0056] Although the preferred embodiments of the present invention have been described, those skilled in the art may make additional changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

Claims

1. A method for detecting the location of pathogen effector proteins based on cotton root epidermal cells, characterized in that: The following steps are involved: S1. Construct a recombinant vector carrying a pathogen effector protein encoding gene and a nuclear localization signal, and transfer the recombinant vector into an Agrobacterium strain to obtain a recombinant Agrobacterium; S2, co-culturing the recombinant Agrobacterium with the pathogenic bacteria strain to screen out the infectious strain; S3, infecting the root epidermis of cotton seedlings with the infectious strain and then culturing for 2 to 3 days; S4. The root epidermis of the cotton seedlings was stained with DAPI solution, and the green fluorescence signal was observed under a laser confocal microscope after slice preparation, and the effector protein was located according to the green fluorescence signal.

2. The method for detecting the localization of pathogen effector proteins based on cotton root epidermal cells according to claim 1, characterized in that: The Agrobacterium is EHA105 Agrobacterium.

3. The method for detecting the localization of pathogen effector proteins based on cotton root epidermal cells according to claim 1, characterized in that: The pathogenic bacteria include Verticillium dahliae of cotton.

4. The method for detecting the localization of pathogen effector proteins based on cotton root epidermal cells according to claim 3, characterized in that: The effector proteins include Avr1b protein and VdEG1 protein.

5. The method for detecting the localization of pathogen effector proteins based on cotton root epidermal cells according to claim 4, characterized in that: The coding gene sequence of the Avr1b protein is shown in SEQ ID NO.1, and the coding gene sequence of the VdEG1 protein is shown in SEQ ID NO.

3.

6. The method for detecting the localization of pathogen effector proteins based on cotton root epidermal cells according to claim 5, characterized in that: When the effector protein is Avr1b protein, the sequence of the nuclear localization signal is shown as SEQ ID NO.2; when the effector protein is VdEG1 protein, the sequence of the nuclear localization signal is shown as SEQ ID NO.

4.

7. The method for detecting the localization of pathogen effector proteins based on cotton root epidermal cells according to claim 6, characterized in that: The basic vector of the recombinant vector carrying the pathogen effector protein gene and the nuclear localization signal is the pSUL-Tef plasmid.

8. The method for detecting the localization of pathogen effector proteins based on cotton root epidermal cells according to claim 1, characterized in that: The cotton variety is Jimian 11.

9. The method for detecting the location of pathogen effector proteins based on cotton root epidermal cells according to claim 1, characterized in that: If there is no green fluorescence in the cell nucleus, it indicates that the effector protein cannot enter the cell. If there is green fluorescence in the cell nucleus, it indicates that the effector protein can enter the cell.

Images