Process

Abstract

The present invention relates to modulating the function of a regulatory element in a nucleic acid, comprising delivering to a cell a catalytically inactivated Cas13 (dCas13) protein and CRISPRRNA (crRNA) wherein the crRNA recruits the dCas13 protein to the regulatory element such that the dCas13 protein spatially blocks the regulatory element.

Description

Technical Field

[0001] The present invention relates to compounds for modulating the function of regulatory elements in nucleic acids, and methods and uses thereof. Background Art

[0002] RNA molecules are composed of regulatory elements, and the function of these regulatory elements can be modulated by using target-specific gene regulation techniques.

[0003] For example, antisense oligonucleotides (ASOs) have been developed to degrade target RNA or as steric blockers for various applications. For example, ASOs can be used to induce splicing switches, inhibit translation initiation, interfere with upstream open reading frames (uORFs) that negatively regulate translation, inhibit nonsense-mediated decay by preventing the assembly of exon junction complexes, and affect polyadenylation signals to increase transcript stability. However, problems associated with off-target effects, insufficient target engagement, and poor delivery to target tissues have severely hampered the translation to clinical applications.

[0004] In recent years, type VI CRISPR-Cas13 systems that recognize, bind, and degrade target RNA have been used for RNA manipulation in various settings. For example, Zhang et al. (2020) used a CRISPR-Cas13a-based strategy to track and degrade toxic RNA in myotonic dystrophy type 1 (reference 1) Cox et al. (2017) generated a fusion protein between the catalytically inactive PspCas13b and the ADAR deaminase domain for targeted gene editing (reference 2). However, these systems result in degradation of the target RNA or alteration of the target RNA sequence and have undesirable off-target effects.

[0005] It is an object of the present invention to further identify and improve compounds and methods for modulating the function of regulatory elements in nucleic acids, in particular without degrading or editing the target RNA. Summary of the invention

[0006] The inventors have identified new methods for modulating the function of regulatory elements in nucleic acids. In particular, the inventors found that catalytically inactive Cas13 (dCas13) proteins, when recruited to regulatory elements in nucleic acids by CRISPR RNA (crRNA), can act as steric blockers at target sites, thereby modulating the function of regulatory elements.

[0007] The inventors identified Psp-dCas13b as an effective steric blocker. When programmed with crRNA to target RNA sequences, the inventors found that Psp-dCas13b was able to block the interaction of target RNA sequences with ribonucleoprotein complexes such as ribosomes and miRNA silencing complexes. In addition, the inventors found that this spatial blocking ability (a) was enhanced when the native length of the crRNA spacer sequence was reduced to about 18-24 nucleotides; and (b) was not affected by C-terminal truncation of Psp-dCas13b. Using crRNA with a spacer length of 21 nucleotides and a C-terminal truncated variant of Psp-dCas13b, the inventors demonstrated that Psp-dCas13b can reverse deregulated splicing in DM1 patient-derived cells and DM1 mouse models. In summary, these observations suggest that the present invention may be useful for treating diseases including, but not limited to, repeat expansion diseases (e.g., DM1, DM2, Fuchs' corneal endothelial dystrophy), diseases where miRNA dysregulation plays a role in pathology, diseases where translation dysregulation plays a role in pathology (e.g., Huntington's disease, amyotrophic lateral sclerosis), and RNA mis-splicing diseases (e.g., spinal muscular atrophy, Duchenne muscular dystrophy).

[0008] Compared to small RNA and RNA interference, which are difficult to design and limited by high off-target effects, CRISPR / dCas13 can be used to manipulate only the target RNA with little or no off-target effects in eukaryotes, and multiple crRNAs can be used to manipulate specific mRNA transcripts.

[0009] All Cas13 proteins are RNA-targeted, so they have the potential to be reused as dCas13 steric blockers. However, it is unknown which family of Cas13 proteins can achieve the highest steric hindrance when converted back to dCas13 steric blockers. Therefore, the inventors first compared the steric hindrance between three dCas13 orthologs Lwa-dCas13a, Psp-dCas13b, and Rfx-dCas13d. In an experiment, each ortholog was designed to target various regulatory sequences in a bidirectional fluorescent reporter transgene, and the inventors found that Psp-dCas13b was the most effective steric blocker for ribosomes and miRNA-related complexes (Fig. 1).

[0010] To further improve the steric hindrance effect of Psp-dCas13b, the inventors tested crRNA spacers of different lengths and found that 18–24 nt spacers (shorter than the natural length of 30 nt) mediated surprisingly higher steric hindrance efficiency ( Figure 2A ). Fluorescence reporter experiments then confirmed that the observed steric occlusion effect required both Psp-dCas13b and crRNA, but not each component alone (see Figure 2B ).

[0011] To investigate the general applicability of Psp-dCas13b in blocking miRNA function, the inventors then designed Psp-dCas13b to target three different miRNA binding sites encoded in the 3′UTR of a fluorescent reporter transgene. In this experiment, the inventors showed that Psp-dCas13b could block all three miRNA binding sites ( Figure 3A ). In addition, the inventors observed that blocking miRNA target sites by phenotypic copy ASO-mediated miRNA inhibition with Psp-dCas13b achieved derepression efficiency ( Figure 3B ).

[0012] After establishing the applicability of Psp-dCas13b to block ribosome and miRNA function, the inventors investigated the system for the treatment of DMPK1 gene induced by (CTG) n The expansion of repeat sequences causes the RNA-dominant disease myotonic dystrophy type 1 (DM1). Subsequently, the expanded sequence is transcribed into toxic RNA, which recruits cellular splicing factors, leading to widespread splicing lesions ( Figure 4A The inventors found that when Psp-dCas13b was programmed to target amplified sequences using crRNAs with spacer lengths of 21 nt or 24 nt, it could consistently and completely reverse disease-associated splicing patterns across six biomarker exons in DM1 patient-derived muscle cells ( Figure 4B –F).

[0013] The inventors prepared a truncated form of Psp-dCas13b, which not only has a steric hindrance effect similar to the full-length form, but is also small enough to be encoded by a single AAV vector (e.g., an AAV9 vector). In particular, the inventors prepared two C-terminal truncated variants of Psp-dCas13b, and observed in a fluorescent reporter molecule assay that the two truncated variants (one with a length of 1053 amino acid residues [1053-aa] and one with a length of 984 amino acid residues [984-aa]) had comparable ribosome steric hindrance and sensitivity to the length of the spacer region as the full-length variant (Figure 6).

[0014] We then packaged an AAV9 vector encoding the pCMV-driven 984-aa variant (mini-Psp-dCas13b) and phU6-driven targeted amplification (CTG) n The 21nt spacer crRNA of the repeat sequence. When injected into the DM1 mouse model, mini-Psp-dCas13b was found to reverse splicing deregulation (Figure 7).

[0015] Therefore, the present invention provides a method for regulating the function of a regulatory element in a target RNA, comprising delivering dCas13 and crRNA to a cell, wherein the crRNA recruits the dCas13 protein to the regulatory element, thereby regulating the function of the regulatory element.

[0016] The present invention also provides a method for regulating the availability, expression and / or activity of a target nucleic acid or protein, comprising regulating the function of a regulatory element in a target RNA according to the method of the present invention, wherein the target RNA encodes or regulates the target nucleic acid or protein, so that the availability, expression and / or activity of the target nucleic acid or protein is increased or decreased.

[0017] The present invention also provides a method for blocking miRNA binding sites, comprising regulating the function of a regulatory element in a target RNA according to the method of the present invention, or regulating the availability, expression and / or activity of a target nucleic acid or protein according to the method of the present invention, wherein the crRNA includes a spacer region complementary to the miRNA binding site, so that miRNA-mediated target RNA silencing is reduced.

[0018] The present invention also provides a method for blocking ribosome attachment or translation, comprising regulating the function of a regulatory element in a target RNA according to the method of the present invention, or regulating the availability, expression and / or activity of a target nucleic acid or protein according to the method of the present invention, wherein the crRNA comprises a spacer region complementary to the start codon of an open reading frame or the start codon of an upstream open reading frame (uORF), such that translation of the target RNA is reduced.

[0019] The present invention also provides a method for inducing splicing switching, comprising regulating the function of a regulatory element in a target RNA according to the method of the present invention, or regulating the availability, expression and / or activity of a target nucleic acid or protein according to the method of the present invention, wherein the crRNA comprises a spacer region complementary to the splicing element, such as an RNP binding site, so that the splicing of the target RNA is regulated.

[0020] The present invention also provides a dCas13b-specific crRNA, comprising: (i) a dCas13b-specific direct repeat, and (ii) a spacer region that can specifically hybridize to a target RNA sequence and has a length between 18 and 24 nucleotides.

[0021] The present invention also provides a dCas13b protein, consisting of an amino acid sequence having a sequence identity of ≥85% with SEQ ID NO: 2 or 3, provided that the amino acid residue corresponding to the 133rd amino acid residue of SEQ ID NO: 2 or 3 is alanine.

[0022] The present invention also provides a polynucleotide or vector encoding a crRNA according to the present invention or a dCas13b protein according to the present invention, optionally wherein the vector is AAV or a lentivirus.

[0023] The present invention also provides a delivery vector, comprising a crRNA according to the present invention, a dCas13b protein according to the present invention, or a polynucleotide or a vector according to the present invention.

[0024] The present invention also provides a pharmaceutical composition comprising: (i) crRNA according to the present invention or dCas13b protein according to the present invention, and (ii) a pharmaceutically acceptable carrier.

[0025] The present invention also provides crRNA or dCas13b protein according to the present invention, for use in a therapeutic method implemented on a human or animal body.

[0026] The present invention also provides crRNA or dCas13b protein according to the present invention, for use in a method for treating a repeat expansion disease, optionally wherein the expansion disease is myotonic dystrophy type 1 (DM1), myotonic dystrophy type 2, or Fuchs' corneal endothelial dystrophy.

[0027] The present invention also provides a method for treating or preventing a repeat expansion disease in a subject, wherein the method comprises administering a therapeutically effective amount of a dCas13 protein and a crRNA to the subject, wherein the method comprises modulating the function of a regulatory element in a nucleic acid according to the method of the present invention, or modulating the availability, expression and / or activity of a target nucleic acid or protein according to the method of the present invention, wherein the crRNA comprises a spacer region complementary to the expanded repeat sequence, and optionally wherein the expansion disease is myotonic dystrophy type 1 (DM1), myotonic dystrophy type 2, or Fuchs' corneal endothelial dystrophy.

[0028] The present invention also provides dCas13 protein for use in a method for treating a repeat expansion disease, wherein the method comprises administering a dCas13 protein and crRNA to a subject, wherein the crRNA comprises a spacer region complementary to the expanded repeat sequence, and optionally wherein the expansion disease is myotonic dystrophy type 1 (DM1), myotonic dystrophy type 2, or Fuchs' corneal endothelial dystrophy.

[0029] The present invention also provides dCas13 protein for use in a method for treating a repeat expansion disease, wherein the method comprises administering a therapeutically effective amount of dCas13 protein and crRNA to a subject, wherein the method comprises regulating the function of a regulatory element in a nucleic acid according to the method of the present invention, or regulating the availability, expression and / or activity of a target nucleic acid or protein according to the method of the present invention, wherein the crRNA comprises a spacer region complementary to the expanded repeat sequence, and optionally wherein the expansion disease is myotonic dystrophy type 1 (DM1), myotonic dystrophy type 2, or Fuchs' corneal endothelial dystrophy.

[0030] The present invention also provides the use of crRNA or dCas13b protein according to the present invention in the preparation of a medicament for treating a repeat expansion disease, optionally wherein the expansion disease is myotonic dystrophy type 1 (DM1), myotonic dystrophy type 2 or Fuchs' corneal endothelial dystrophy. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 shows that Psp-dCas13b can be reused as an effective RNA steric blocker. A) Schematic diagram of the design of ribosome and miRNA blocking experiments. HEK293T cells were co-transfected with plasmids encoding Lwa-dCas13a, Psp-dCas13b, or Rfx-dCas13d, plasmids encoding corresponding crRNAs, and plasmids encoding bidirectional reporters expressing ECFP and mIFP. In the ribosome blocking experiment, dCas13 orthologs were targeted by corresponding crRNAs to bind to the 5′UTR or TSS (upper right) of the ECFP transcript. In the miRNA blocking experiment, dCas13b orthologs were targeted by corresponding crRNAs to bind to the miR-17 binding site of the 3′UTR (lower right) of the ECFP transcript. B) and C) Comparison of the steric effect of Lwa-dCas13a, Psp-dCas13b, and Rfx-dCas13d when targeted by corresponding crRNAs to bind to different sites of the ECFP transcript. Six crRNAs were tested for each dCas13b ortholog, three targeting the 5′UTR or TSS of ECFP transcripts and three targeting the miR-17 binding site of ECFP transcripts. The expression level of ECFP was quantified by flow cytometry and normalized to the expression level of mIFP. P values ​​were generated by two-tailed Student's t-test.

[0032] Figure 2 shows that shortening the crRNA spacer increases the steric hindrance effect of Psp-dCas13b. The expression level of ECFP was quantified by flow cytometry and normalized to the expression level of mIFP. A) The effect of varying the spacer length of three different crRNAs targeting the 5′UTR or TSS of the ECFP transcript. Shorter spacer sequences of 18–24 nt showed the most effective inhibition of ECFP expression. B) A graph comparing the steric hindrance effect of Psp-dCas13b alone, crRNA alone, and Psp-dCas13b in combination with crRNA. Both Psp-dCas13b and the corresponding crRNA are required to achieve effective blockade of ECFP expression. SCR, scrambled non-target control.

[0033] Figure 3 shows that Psp-dCas13b is able to completely and specifically interfere with miRNA function. The expression level of ECFP was quantified by flow cytometry and normalized to the expression level of mIFP. A) Positional effect of crRNA on derepression of ECFP expression. A total of 45 crRNAs were designed to guide Psp-dCas13b toward the target site of miR-17, miR-92A or miR-222 in the 3′UTR of ECFP transcripts. B) A graph comparing the extent of Psp-dCas13b-mediated miRNA derepression for antagomiR-17. SCR, scrambled non-target control.

[0034] Figure 4 shows reversal of pathological splicing patterns by Psp-dCas13b in a DM1 cell model. Scr, scrambled non-target crRNA. A) is a schematic diagram of DM1 pathology. The wild-type DMPK1 allele contains 5–37 CTG repeats, while up to 4,000 repeats can be found in DM1 mutants. B) Schematic diagram of the plasmid encoding the NLS-dCas13b-NLS-P2A-EGFP and crRNA sequences. Five different crRNAs with different spacer lengths were designed. C) RT-PCR and gel analysis demonstrate reversal of splicing lesions in DM1 cells. A schematic diagram of exon exclusion and exon inclusion is provided on the right side of the gel image. D) Quantification of the gel image shown in C) by densitometry demonstrates complete reversal of the splicing pattern in five of the six disease biomarkers. E) RNaseq data are represented on the UCSC genome browser track for TEAD1 exon 5 and KIF13A exon 38, showing DM1-associated mis-splicing events in myotubes from unaffected individuals (WT) or DM1 patients (DM1), which are untransfected, transfected with dCas13 and scrambled control crRNA, or transfected with dCas13 and crRNA3, as indicated. F) RNaseq data are represented on the UCSC genome browser track for MBNL1 exon 6, MBNL2 exon 6, and DMD exon 78, showing DM1-associated mis-splicing events in myotubes from unaffected individuals (WT) or DM1 patients (DM1), which are untransfected, transfected with dCas13 and control crRNA, or transfected with dCas13 and crRNA3, as indicated.

[0035] Figure 5 shows that Psp-dCas13b is superior to antisense oligonucleotides in reversing DM1-related mis-splicing as shown in RNaseq data. A) and D) are scatter plots showing the relative inclusion level (PSI; Ψ) of mis-splicing events in WT or DM1 myotubes transfected with dCas13b / Scr-ctrl (A) or ASO / ctrl (D). B) and E) are scatter plots showing the relative inclusion rate (PSI; Ψ) of mis-splicing events in WT and DM1 myotubes transfected with dCas13b / crRNA3 (B) or ASO / CAG7 (E). C) and F) are pie charts showing the proportion of mis-splicing events that are completely reversed, partially reversed, or not reversed after transfection with dCas13 / crRNA3 (C) or with ASO / CAG7 (F). Scr-ctrl, scrambled non-target control crRNA. ASO, antisense oligonucleotide.

[0036] Figure 6 shows that the C-terminal truncated Psp-dCas13b retains its steric hindrance effect. A) Schematic diagram of the full-length and C-terminal truncated variants of Psp-dCas13b. B) Comparison of the steric hindrance effect and sensitivity of the full-length and truncated variants of Psp-dCas13b to the length of the crRNA spacer. The full-length and truncated variants of Psp-dCas13b are equally effective in blocking and are equally sensitive to the length of the crRNA spacer. The expression level of ECFP is quantified by flow cytometry and normalized relative to the expression level of mIFP. Scr, scrambled non-target crRNA.

[0037] Figure 7 shows that treatment of adult skeletal muscle of the HSA-LR DM1 mouse model with Psp-dCas13b corrects splicing dysregulation. Splicing patterns were determined by RT-PCR. A) Schematic diagram showing single vector administration of Psp-dCas13b and corresponding crRNA. Treatment or control vectors were injected into the TA of 8-week-old HSALR mice. B) Quantification of splicing patterns of four disease biomarkers four weeks after treatment with pCMV-driven EGFP control or pEFS-driven full-length Psp-dCas13b treatment vectors (n=3). C) Quantification of splicing patterns of disease biomarkers four weeks after treatment with pCMV-driven EGFP control or pCMV-driven mini-Psp-dCas13b treatment vectors (n=5).

[0038] Brief Description of Sequence Listing

[0039] SEQ ID NO: 1 shows the polypeptide sequence of Psp-dCas13b.

[0040] SEQ ID NO: 2 shows the polypeptide sequence of a C-terminal truncated variant of Psp-dCas13b having a length of 984 amino acid residues (984-aa), i.e., mini-Psp-dCas13b.

[0041] SEQ ID NO: 3 shows the polypeptide sequence of a C-terminal truncated variant of Psp-dCas13b with a length of 1053 amino acid residues.

[0042] SEQ ID NO:4 shows Figure 2A The polyribonucleotide sequence of crRNA compatible with Psp-dCas13b is shown.

[0043] SEQ ID NO: 5 shows Figure 3A The polynucleotide sequence of the ECFP transgene containing the miRNA target site is shown.

[0044] SEQ ID NO: 6 shows Figure 3A The poly(A) tail sequence of the ECFP transgene is shown.

[0045] SEQ ID NO:7-11 shows Figure 4B The polynucleotide sequence of the crRNA shown.

[0046] SEQ ID NO:12–69 show the sequences of the Cas13 proteins shown in Table 1.

[0047] SEQ ID NOs: 70 and 71 show nuclear localization signals.

[0048] SEQ ID NO: 72 shows the Kozak sequence.

[0049] SEQ ID NOs:73–80 show the crRNA spacer sequences shown in Table 2.

[0050] SEQ ID NO: 81 shows the repeat motif of Winfrich-Lundberg disease shown in Table 3. DETAILED DESCRIPTION

[0051] dCas13 protein

[0052] The present invention relates to a catalytically inactivated Cas13 protein (dCas13). Therefore, compared with unmodified Cas13, the dCas13 protein does not trigger the cleavage of the target RNA sequence, but retains other biological activities of the dCas13 protein, such as binding affinity and blocking activity with RNA.

[0053] Although it is not desired to be bound by theory, dCas13 is recruited to the target site in the RNA molecule, as determined by CRISPR RNA (crRNA). This promotes the steric hindrance of the target site of dCas13 and / or crRNA in the RNA molecule, and in this way it does not induce target cleavage. For example, when the repeat amplification sequence in dCas13 targeting RNA molecules (such as DMPK mRNA), dCas13 and / or crRNA physically mask the repeat amplification sequence to prevent it from interacting with the protein. As another example, when dCas13 targets the upstream start codon (such as the start codon of uORF), dCas13 and / or crRNA physically mask uATG.

[0054] It is known that Cas13 protein only includes a single multi-domain effector (Class II) and a target RNA (Type VI), and Cas13 protein can be determined according to a computational method known in the art. Table 1 lists examples of naturally occurring Cas13 proteins, and indicates the mammalian cell compatibility and nuclease activity of each Cas13 protein. The mammalian cell compatibility of Cas13 protein measures whether Cas13 protein can be expressed, correctly folded, and displayed in mammalian cells. For example, some Cas13 proteins, including LweCas13a and LbfCas13a, cannot display functional biological activity in mammalian cells, and are therefore considered to be incompatible with mammalian cells. Nuclease activity can be used as a representative of the binding affinity to its target RNA sequence, because RNA degradation cannot occur in the absence of interaction between Cas13 protein and its target RNA sequence. Based on the system occurrence of Cas13, the CRISPR-Cas13 system can be classified as Cas13a (formerly known as C2C2), Cas13b, Cas13c, Cas13d, Cas13X and Cas13Y, all of which require crRNA for specific recognition of target RNA sequences.

[0055] The dCas13 proteins useful in the present invention can be derived from naturally occurring or modified Cas13 proteins. The modification of Cas13 proteins is further explained below.

[0056] The naturally occurring Cas13 protein has good mammalian cell compatibility and high binding affinity to its target RNA sequence, and is considered to exhibit good steric hindrance, and is therefore particularly useful in the present invention. For example, a Cas13 protein that exhibits nuclease activity in mammalian cells and binds to its target RNA sequence with high affinity is particularly useful in the present invention, and the high affinity, such as K D The value is ≤100 nM, ≤50 nM, ≤10 nM, ≤5 nM, ≤1 nM, ≤0.5 nM, or ≤0.1 nM. Binding affinity (K D ) can be analyzed by any suitable method known in the art, such as ELISA or surface plasmon resonance. The nuclease activity of the Cas13 protein can be determined in a fluorescent reporter assay, such as an ECFP / mIFP bidirectional reporter assay, performed in cell culture under physiological conditions. Cas13 proteins that reduce the expression of fluorescent reporters by at least 25% relative to negative controls (e.g., cells not transfected with Cas13 proteins) are particularly useful in the present invention.

[0057] The Cas13 protein that can be used in the present invention can be a member of the Cas13b, Cas13A, Cas13d, Cas13X, Cas13Y or Cas13bt family.

[0058] Cas13 can be PspCas13b, LshCas13a, LwaCas13a, LbmCas13a, LbnCas13a, LbfCas13a, RcsCas13a, RcrCas13a, RcdCas13 a, LbuCas13a, HheCas13a, LspCas13a, BzoCas13b, PinCas13b, PbuCas13b, PsmCas13b, RanCas13b, PauCas13b, Pin 2Cas13b, PguCas13b, PgiCas13b, Pin3Cas13b, Cas13bt1, Cas13bt3, FnbCas13c, AspCas13c, UrCas13d, P1E0Cas13d, AdmCas13d, RfxCas13d, Cas13X.1, Cas13X.2, Cas13Y.1, Cas13Y.2, Cas13Y.3, Cas13Y.5, Cas13bt1, or Cas13bt3. These Cas13 proteins have good human cell compatibility and high binding affinity (see, for example, Table 1).

[0059] Cas13 can be PspCas13b, LshCas13a, LwaCas13a, LbmCas13a, LbnCas13a, LbfCas13a, RcsCas13a, RcrCas13a, Rcd Cas13a, LbuCas13a, HheCas13a, LspCas13a, BzoCas13b, PinCas13b, PbuCas13b, PsmCas13b, RanCas13b, PauC As13b, Pin2Cas13b, PguCas13b, PgiCas13b, Pin3Cas13b, Cas13bt1, Cas13bt3, FnbCas13c, AspCas13c, UrCas13d, P1E0Cas13d, AdmCas13d, RfxCas13d, Cas13X.1, Cas13X.2, Cas13Y.1, Cas13Y.2, Cas13Y.3, or Cas13Y.5. These Cas13 proteins have good human cell compatibility and high binding affinity (see, for example, Table 1).

[0060] Cas13 can be PspCas13b, PinCas13b, PguCas13b, PgiCas13b, Cas13X.1, Cas13X.2, Cas13Y.1, Cas13Y.2 or Cas13Y.3. These Cas13 proteins have good human cell compatibility and high binding affinity (see, for example, Table 1).

[0061] Cas13 protein can be a member of the Cas13b family, i.e., Cas13b protein. Cas13b proteins are particularly useful in the present invention because they have good human cell compatibility and high binding affinity (e.g., see Table 1), and therefore have good steric hindrance. In addition, these proteins interact with shorter crRNA to increase steric hindrance, and can be truncated to optimize vector packaging, as further explained below.

[0062] The Cas13 protein may be Psp-Cas13b (Accession No. WP_044065294).

[0063] The Cas13 protein may not be a Cas13a protein. For example, the Cas13 protein may not be LshCas13a (WP_018451595.1). The Cas13 protein may not be LbuCas13a (WP_015770004.1). The Cas13 protein may not be LbCas13a (see reference 3)

[0064] The Cas13 protein may not be a Cas13d protein. For example, the Cas13 protein may not be a Cas RxCas13d (see reference 3).

[0065] Naturally occurring Cas13 proteins can be modified to inactivate their ribonuclease activity by mutating one or more amino acid residues in the RxxxxxH motif (where x is any amino acid) of the two HEPN RNA enzyme domains responsible for ribonuclease activity, thereby eliminating RNA cleavage without affecting crRNA array processing or target RNA binding. Therefore, dCas13 proteins may include mutations of one or more amino acid residues (e.g., 1, 2, 3, 4, 5, or 6 amino acid residues) in the RxxxxH motif of the HEPN-1 domain relative to the wild type and in the RxxxxH motif of the HEPN-2 domain relative to the wild type. Mutations may be at any residue in the RxxxxH motif of the HEPN-1 domain and the RxxxxH motif of the HEPN-2 domain. Mutations may be substitutions, replacements, or deletions. For example, the first R residue or the last H residue in the RxxxxxxH motif may be substituted by different amino acids, such as alanine (A). The substitution is typically performed with non-conservative amino acids.

[0066] For example, PspCas13b can be modified to inactivate its ribonuclease activity by replacing the histidine residues at positions 133 and 1058 with alanine residues, forming Psp-dCas13b (SEQ ID NO: 1), wherein the histidine residues correspond to the histidine residues of the two RxxxxxH motifs.

[0067] dCas13 useful in the present invention may include or consist of an amino acid sequence having ≥85%, ≥90%, ≥95%, ≥96%, ≥97%, ≥98%, ≥99%, or 100% sequence identity to SEQ ID NO: 1, provided that: (a) one or more amino acid residues corresponding to amino acid residues 128 to 133 of SEQ ID NO: 1 are mutated; and (b) one or more amino acid residues corresponding to amino acid residues 1053 to 1058 of SEQ ID NO: 1 are mutated. dCas13 useful in the present invention may include or consist of an amino acid sequence having ≥85%, ≥90%, ≥95%, ≥96%, ≥97%, ≥98%, ≥99%, or 100% sequence identity to SEQ ID NO: 1, provided that the amino acid residues corresponding to amino acid residues 133 and 1058 of SEQ ID NO: 1 are mutated. The dCas13 useful in the present invention may include or consist of an amino acid sequence having a sequence identity of ≥85%, ≥90%, ≥95%, ≥96%, ≥97%, ≥98%, ≥99%, or 100% with SEQ ID NO: 1, provided that the amino acid residues corresponding to amino acid residues 133 and 1058 of SEQ ID NO: 1 are alanine. The dCas13 useful in the present invention may consist of SEQ ID NO: 1.

[0068] Methods for determining the nuclease activity, binding affinity to its target RNA sequence, and blocking activity of Cas13 or dCas13 proteins are known in the art and described in the Examples herein, such as fluorescent reporter assays, endogenous RNA blocking assays, or electrophoretic mobility shift assays.

[0069] dCas13 may have a size of about 700 to about 1200 amino acids.

[0070] The naturally occurring Cas13 protein can be modified to reduce its size while retaining its steric effect. This smaller dCas13 protein is advantageous because the size of the nucleic acid sequence encoding the dCas13 protein will be minimized to be packaged in a vector for cell delivery, particularly in a vector with limited transgenic packaging capacity. For example, AAV (packaging capacity of about 4.7 kb) has limited capacity to contain a nucleic acid sequence (about 3 kb in length) encoding a full-length dCas13 protein in addition to other essential elements in the expression cassette.

[0071] The size of the dCas13 protein can be reduced by C-terminal truncation, such as truncation of the HEPN-2 domain located in the C-terminal region of the dCas13 protein. Therefore, the present invention provides a dCas13 protein, which includes a truncation at the C-terminus compared to the unmodified protein. The dCas13 protein can be truncated from the C-terminus by ≤50, ≤100, ≤150, ≤200, ≤250, or ≤300 amino acid residues compared to the unmodified protein. For example, the size of the dCas13 protein can have a size of ≤1050, ≤1000, ≤950, ≤900, ≤850, ≤800, ≤750, or ≤700 amino acids.

[0072] The truncation does not substantially change the steric hindrance effect of the dCas13 protein. Therefore, compared with the unmodified dCas13, the truncated dCas13 protein retains its binding affinity for the target RNA sequence and its blocking activity. The truncated dCas13 protein can be used in the methods and uses described herein.

[0073] The dCas13 protein may lack a complete HEPN-2 domain. The dCas13 protein may substantially lack a HEPN-2 domain. The position and length of the HEPN-2 domain in a given Cas13 protein or ortholog may be determined using several bioinformatics tools known in the art (e.g., ThreaDom) before truncation. The HEPN-2 domain of the dCas13 protein may be dispensable, with minimal effect on its activity such as steric hindrance. In particular, the inventors have shown that truncating the C-terminal domain of the HEPN-2 domain containing Psp-dCas13b does not result in a reduction in steric hindrance. It is also shown that the establishment and maintenance of the interaction between crRNA, dCas13b, and the target RNA sequence does not require a complete HEPN-2 domain. Considering the high sequence similarity between the Cas13b family members, truncating the HEPN-2 domain in any one of the Cas13b members may result in a modified protein with minimal effect on its steric hindrance. Therefore, the Cas13 protein of the truncated dCas13 protein may be a member of the Cas13b family. The Cas13 protein can be Psp-Cas13b, Bzo-Cas13b, Pin-Cas13b, Pbu-Cas13b, Asp-Cas13b, Psm-Cas13b, ran-Cas13b, pau-Cas13b, psa-Cas13b, Pin2-Cas13b, Cca-Cas13b, Pgu-Cas13b, Fbr-Cas13b, Pgi-Cas13b or Pin3-Cas13b. The Cas13 protein can be Psp-Cas13b.

[0074] The present invention also provides a dCas13 protein, comprising or consisting of an amino acid sequence having a sequence identity of ≥85%, ≥90%, ≥95%, ≥96%, ≥97%, ≥98%, ≥99%, or 100% with SEQ ID NO: 2 or 3, provided that: (a) one or more amino acid residues corresponding to amino acid residues at positions 128 to 132 are mutated; and (b) the amino acid residue at position 133 is histidine. The present invention also provides a dCas13 protein, comprising or consisting of an amino acid sequence having a sequence identity of ≥85%, ≥90%, ≥95%, ≥96%, ≥97%, ≥98%, ≥99%, or 100% with SEQ ID NO: 2 or 3, provided that the amino acid residue corresponding to the amino acid residue at position 133 of SEQ ID NO: 2 or 3 is alanine or not histidine. The dCas13 protein may consist of SEQ ID NO: 2. The dCas13 protein may consist of SEQ ID NO: 3. dCas13 proteins can be used with the methods and uses described herein.

[0075] The dCas13 protein that can be used in the present invention may contain a modification relative to any one of SEQ ID NOs: 1 to 3, such as an amino acid substitution, addition or deletion, provided that: (a) one or more of the amino acid residues corresponding to amino acid residues 128 to 133 of SEQ ID NO: 1 are mutated, and one or more of the amino acid residues corresponding to amino acid residues 1054 to 1058 of SEQ ID NO: 1 are mutated; (b) the amino acid residues corresponding to amino acid residues 133 and 1058 of SEQ ID NO: 1 are alanine; (c) one or more amino acid residues corresponding to amino acid residues 128 to 132 are mutated, and amino acid residue 133 is histidine; or (d) the amino acid residue corresponding to amino acid residue 133 of SEQ ID NO: 2 or 3 is alanine or not histidine. For example, the dCas13 protein may include 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more replaced, deleted or added amino acid residues, in any combination.

[0076] The dCas13 protein may include further mutations. For example, the dCas13 protein may have additions, deletions or substitutions of amino acid residues that do not substantially change the steric hindrance effect of the dCas13 protein. Individual sites or regions of the Cas13 protein that may be altered without affecting the steric hindrance effect can be determined, for example, by examining the structure of the dCas13 domain. Alternatively, regions that tolerate amino acid substitutions can be determined by alanine scanning mutagenesis (4). In this method, the selected amino acid residues are substituted with neutral amino acids (eg, alanine) to determine the effect on the steric hindrance effect.

[0077] The dCas13 protein may contain conservative amino acid changes that are least likely to interfere with the structure and / or function of the protein. For example, a variant may include one or more conservative amino acid changes within any one of SEQ ID NOs: 1 to 3. Conservative amino acid changes typically involve substitution of one amino acid with another amino acid that is similar in structure and / or function (e.g., an amino acid with a side chain that is similar in size, charge, and shape). Amino acid residues with similar side chains are known in the art. These include amino acids with basic side chains (e.g., lysine, arginine, histidine), amino acids with acidic side chains (e.g., aspartic acid, glutamic acid), amino acids with uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, tryptophan), amino acids with non-polar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine), amino acids with β-branched side chains (e.g., threonine, valine, isoleucine) and amino acids with aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Therefore, one or more amino acid residues in the dCas13 protein can be replaced with other amino acid residues with similar side chains, and the altered protein can be tested for retained function using functional tests described herein. Modifications can be introduced by standard techniques known in the art, such as site-specific mutagenesis (5) and PCR-mediated mutagenesis, provided that activity is retained, such as the ability to bind to the target RNA sequence, and thus steric hindrance is retained.

[0078] The dCas13 protein can be codon-optimized to increase the expression level of the corresponding protein in the host cell compared to the unmodified sequence. Methods for codon optimization are known in the art, for example, GeneScript OptimumGene TM algorithm.

[0079] It is also within the teachings of this article that the dCas13 protein can be fused to a peptide for purification or detection. The peptide can be an affinity tag, such as an HA tag corresponding to amino acids 98 to 106 of human influenza hemagglutinin, polyhistidine (His) (H6; SEQ ID NO: 82), c-myc and / or FLAG. The peptide can be a reporter protein, such as a fluorescent reporter molecule. For example, the peptide can be fused to the N-terminus or C-terminus of the dCas13 protein.

[0080] The dCas13 protein can be fused with a localization signal peptide, for example, for transport to a specific location in a cell. The signal peptide may be a nuclear localization signal (NLS) peptide. The nuclear localization signal peptide may be fused to or located near the N and / or C terminus of dCas13 (e.g., within 5 amino acids). For example, the nuclear localization signal may be fused to the N terminus of the dCas13 protein for optimal expression and cytoplasmic targeting in eukaryotic cells such as human cells. Exemplary nuclear localization signals are the nuclear localization signal of the SV40 large T antigen (PKKKRRV; SEQ ID NO: 70) and the nuclear localization signal of the nuclear plasmid (KRPAATKKAGQAKKKK; SEQ ID NO: 71). Other nuclear localization signals are known in the art, for example, see references 6, 7, 8.

[0081] The present invention also relates to polynucleotides encoding the dCas13 protein described herein.

[0082] In one embodiment, the dCas13 protein may not be fused to a biologically active entity, such as a peptide comprising an ADAR deaminase domain.

[0083] CRISPR RNA

[0084] CRISPR RNA (crRNA) that can be used in the present invention includes dCas13 specific direct repeats and spacers that can specifically hybridize with target RNA sequences. dCas13 specific direct repeats selectively bind to dCas13 proteins described herein with sufficient affinity and recruit them to target sites in RNA molecules, as determined by spacers. This promotes steric hindrance of dCas13 and / or crRNA in target RNA sequences.

[0085] The dCas13 specific direct repeats that can be used in the present invention depend on the specific protein of dCas13. For example, Cas13b from different species may have different direct repeat sequences and / or secondary structures. The dCas13 specific direct repeat sequences in the crRNA provided herein can be selected based on the specific dCas13 used. By bioinformatics analysis of sequence repeats present in each CRISPR / Cas operon, and by experimental binding studies of Cas13 proteins with target sequences flanked by inferred direct repeat sequences, direct repeat sequences that work with Cas13 proteins of various bacterial species can be identified.

[0086] The dCas13-specific direct repeat can be about 30 to about 90 (e.g., about 30, 40, 50, 60, 70, 80, or 90) nucleotides in length.

[0087] crRNA can include more than one (e.g., at least two, three, four, five, six, or seven) direct repeats. Two or more direct repeats can have the same or different lengths.

[0088] The direct repeats form a hairpin structure that can interact with the Cas13 protein to form a complex.

[0089] The dCas13-specific direct repeats in the crRNA described herein may be Cas13b-specific direct repeats.

[0090] The spacer can be designed to target any sequence in the target RNA. The spacer is designed to be complementary to the target RNA sequence. The RNA targeting sequence in the crRNA can be fully complementary, substantially complementary, or partially complementary to the target RNA sequence.

[0091] The crRNA may include more than one (e.g., at least two, three, four, five, six, or seven) spacers. The spacers may bind to the same or different target sequences in the same target RNA, or may bind to different target RNAs. Two or more spacers may have the same or different lengths.

[0092] The spacer region may have a length of between 9 and 45 (eg, 9 to 15, 15 to 30, 18 to 24, 25 to 40, 25 to 35, 25 to 30) nucleotides.

[0093] A spacer having a length of 18 to 24 (e.g., 18, 19, 20, 21, 22, 23 or 24) nucleotides is particularly advantageous because it can increase the steric hindrance effect of a dCas13 protein such as a dCas13b protein that interacts with the crRNA protein. In particular, the inventors found that when the length of the PspCas13b-specific crRNA spacer sequence is reduced from a native length of about 30 nucleotides to 18 to 24 nucleotides, the steric hindrance effect increases (see Examples).

[0094] This improved steric effect may be due to the improved binding affinity of dCas13 and target RNA sequence. It is not desirable to be bound by theory, and it is believed that crRNA:Cas13b hybridization requires HEPN1 and spiral-2 domains to be open (for example, see reference 9). After crRNA hybridizes with target RNA, HEPN1 and spiral-2 domains are both restored to their closed state to stabilize crRNA: target RNA interactions. The reduced base pairing between crRNA and its target RNA sequence enables more effective closure of HEPN1 and spiral-2 domains, thereby mediating a more spatially favorable combination. On the contrary, the increased base pairing between crRNA and its target RNA can spatially block the closure of HEPN1 and spiral-2 domains, resulting in an open conformation, which is known to be less stable. In fact, recent structural studies show that crRNA hybridizes with Cas13b proteins by entering the central channel between HEPN1 and spiral-2 domains. All members of the Cas13b family obey the short crRNA effect because they need conformational rearrangement to establish a strong binding with the target RNA sequence.

[0095] Therefore, the present invention provides a dCas13b-specific crRNA, comprising: (i) dCas13b-specific direct repeats, and (ii) a spacer region capable of specifically hybridizing to a target RNA sequence and having a length between 18 and 24 nucleotides. This crRNA is particularly useful for the methods and uses of the present invention.

[0096] The crRNA sequence may include conservative mutations that do not change the length and extension of the hairpin loop in the direct repeat region and retain the function and activity of the crRNA.

[0097] The crRNA may comprise or consist of any one of SEQ ID NOs: 4 or 7 to 11.

[0098] The crRNA may be a modified crRNA, i.e., it includes at least one modified nucleoside (e.g., at least one modified sugar moiety and / or at least one modified nucleobase moiety) and / or at least one modified internucleoside bond. The crRNA may be modified so that the stability of the modified crRNA in human cells is improved relative to that of the unmodified crRNA. For example, the crRNA may be modified by capping the 3′ end with a reverse thymidine, adding 2′-O-methylation, and / or adding a phosphorothioate bond at the 3′ end.

[0099] Regulatory elements and target RNA

[0100] The present invention relates to any regulatory element in a target RNA, wherein the regulatory element regulates the expression or activity of a target gene. The regulatory element can regulate when, where and how a gene is expressed in the form of RNA or protein, and / or its activity.

[0101] The regulatory element is in the target RNA. The target RNA can be any RNA molecule endogenous or exogenous to a eukaryotic cell, and can be protein-encoding or non-coding. For example, the target RNA can be messenger RNA (mRNA), ribosomal RNA (rRNA), signal recognition particle RNA (SRP RNA), transfer RNA (tRNA), small nuclear RNA (snRNA), small nucleolar RNA (snoRNA), antisense RNA (aRNA), long non-coding RNA (IncRNA), pseudogene, circular RNA (circular RNA), long intergenic non-coding RNA (lincRNA), microRNA (miRNA), piwi-interacting RNA (piRNA), small interfering RNA (siRNA), short hairpin RNA (shRNA), reverse transcription transposon RNA, viral genomic RNA, or viral non-coding RNA.

[0102] The target RNA is usually a mature messenger RNA (mRNA), but may also be a precursor mRNA (pre-mRNA). Pre-mRNA may have undergone partial splicing, i.e., a partially processed mRNA transcript.

[0103] For example, the target RNA is a repeat-expanded mRNA, such as CSTB, XYLT1, GLS, PPP2R2B, AFF2, CBL2, AFF3, DIP2B, FMR1, FMR1, FMR1, NOTCH2NLC, LRP12, GIPC1, LOC642361, and NUTM2B-AS1b, RFC1, ATXN10, TAF1, CNBP, ZNF713, TCF4, FXN, NOP56, C9orf72, BEAN1 / TK 2b, SAMD12, STARD7, Mar-06, YEATS2, TNRC6A, RAPGEF2, DAB1, ATN1, HTT, AR, ATXN1, ATXN2, ATXN3, CACNA1A, AT XN7, TBP, COMP, FOXL2, RUNX2, PHOX2B, HOXA13, ZIC2, PABPN1, HOXD13, SOX3, ARX, ATXN8OS and ATXN8b, DMPK, or JPH3 mRNA.

[0104] The target RNA may be DMPK, TCF4, CNBP, JPH3, C9orf72, FMR1, FMR1, NOP56, or BEAN1 / TK2b mRNA.

[0105] The regulatory element may be a cis-regulatory element or a trans-regulatory element. The regulatory element may be a microsatellite repeat sequence, a splicing factor binding site, a snRNP binding site, an exon splicing enhancer, an exon splicing silencer, a protein binding site, an internal ribosome entry site (IRES), a hairpin structure, a stem-loop structure, a pseudoknot, the start codon of an open reading frame, the start codon of an upstream open reading frame (uORF), a Kozak sequence, a miRNA binding site, a siRNA binding site, or a piRNA binding site.

[0106] For example, the expanded repeat sequence may be a repeat sequence shown in Table 2 or Table 3. The expanded repeat sequence may be (CTG) in DMPKmRNA 3′-UTR n 、(CTG) in the intron of TCF4 mRNA n 、(CCTG) in the intron of CNBP mRNA n 、(CTG) in the 3′-UTR of JPH2 mRNA n 、(GGGGCC) in the intron of C9orf72 mRNA n 、(CGG) in FMR1 5′-UTR n 、(GGCCTG) in the NOP56 intron n , BEAN1 / TK2b intron (TGGAA / TTCCA) n or intron ATXN10 (ATTCT) n .

[0107] For example, the protein binding site may be a HuR binding site having the consensus motif 5'-NNUUNUUU-3'.

[0108] For example, the snRNP binding site may be a U2 snRNP binding site. The U2 snRNP binding site may include the 3' splice site consensus sequence CAG|G and / or the 5' splice site consensus sequence MAG|GTRAGT in the pre-mRNA.

[0109] For example, the Kozak sequence may be the sequence 5′-(gcc)gccRcc AUG G-3' (SEQ ID NO: 72).

[0110] Therefore, the spacer region of the crRNA may include: SEQ ID NO: 73, 74, or 76, or consist of them, as shown in Table 2. For example, see the spacer region of the crRNA shown in SEQ ID NO: 4 and 7 to 11.

[0111] Polynucleotides, vectors and host cells

[0112] The present invention also relates to polynucleotides comprising sequences encoding dCas13 proteins and / or crRNAs as described herein. The polynucleotides may include sequences encoding dCas13 proteins and crRNAs as described herein. The polynucleotides encoding dCas13 proteins and / or crRNAs may be obtained by methods well known to those skilled in the art.

[0113] The polynucleotides of the present invention can be provided in the form of an expression cassette, comprising a control sequence operably linked to an insertion sequence, so that the dCas13 protein or crRNA described herein can be expressed in vivo. Therefore, the present invention provides an expression cassette comprising a polynucleotide encoding the crRNA and / or dCas13 protein of the present invention.

[0114] For example, the sequence encoding the dCas13 protein or crRNA can be operably connected to a promoter. Suitable promoters are known in the art and described herein, such as polymerase III promoters, such as polymerase-3U6 (U6:3) promoters. The sequence encoding dCas13 can be operably connected to a nuclear localization signal, such as a nuclear localization signal described herein. The sequence encoding the dCas13 protein or crRNA can be further operably connected to a sequence encoding one or more reporter genes. Suitable reporter genes are well known in the art, such as fluorescent reporter genes.

[0115] These expression cassettes are generally provided in vectors. Therefore, the present invention provides vectors encoding polypeptides or expression cassettes described herein. The vector may be a vector (e.g., a plasmid) for cloning the destination vector. The vector may be a vector for expressing polynucleotides in cells. The vector may be a viral vector, such as an adeno-associated viral vector (AAV), such as AAV9, or a lentiviral vector. The vector may include any virus that targets dCas13 protein and crRNA to a specific cell type. The polynucleotides encoding dCas13 protein and crRNA may be packaged into one or more vectors (e.g., plasmids or viral vectors). The general method for constructing a vector, the transfection method, and the culture method are well known to those skilled in the art (e.g., see reference 10).

[0116] The dCas13 protein and crRNA described herein are delivered to cells. The dCas13 protein can be delivered in the form of a protein or a polynucleotide, for example in an expression cassette or vector. The crRNA is delivered in the form of a polynucleotide.

[0117] Therefore, the present invention also provides host cells comprising dCas13 proteins, crRNA, polynucleotides, expression cassettes or vectors as described herein. dCas13 proteins, crRNA, polynucleotides, expression cassettes or vectors can be transiently or permanently introduced into host cells so that oligonucleotides or coupled oligonucleotides can be expressed from expression cassettes or vectors. Cells may be eukaryotic cells, such as mammalian cells (e.g., rodent cells, human cells, non-human primate cells). Suitable cells include naturally occurring cells; genetically modified cells (e.g., cells genetically modified in the laboratory); and cells operated in vitro in any manner. In some cases, cells are isolated.

[0118] Composition

[0119] The present invention provides a composition, including dCas13 protein, crRNA, polynucleotide, expression cassette or vector as described herein. The composition may include a combination of one or more crRNAs of the present invention. Each crRNA can target different (but possibly overlapping) sequences in the same target RNA. Alternatively, each crRNA can target different target RNAs.

[0120] The composition may be a pharmaceutical composition. The pharmaceutical composition may also include a carrier (e.g., water, saline, ethanol, glycerol, lactose, sucrose, calcium phosphate, gelatin, dextran, agar, pectin, peanut oil, sesame oil, etc.), a diluent, a pharmaceutically acceptable carrier (e.g., phosphate buffered saline), a pharmaceutically acceptable excipient, and / or other materials known to those skilled in the art. These substances are generally non-toxic and do not interfere with the efficacy of the active ingredient. The precise nature of the carrier or other materials can be determined by the technician according to the route of administration.

[0121] The pharmaceutical composition may further include one or more pharmaceutically acceptable salts (eg, inorganic acid salts such as hydrochlorides, hydrobromides, phosphates, sulfates, etc.) and salts of organic acids (eg, acetates, propionates, malonates, benzoates, etc.).

[0122] Pharmaceutical compositions may include delivery systems such as liposomes and emulsions. In certain embodiments, organic solvents such as dimethyl sulfoxide are used.

[0123] The pharmaceutical composition may include one or more tissue-specific delivery molecules designed to deliver the dCas13 protein, crRNA, polynucleotide, expression cassette or vector described herein to a specific tissue or cell type. For example, the delivery molecule may include a liposome coated with a tissue-specific antibody.

[0124] For delayed release, the carrier can be included in a pharmaceutical composition formulated for slow release, for example, in microcapsules formed from biocompatible polymers or in a lipid carrier system according to methods known in the art.

[0125] The pharmaceutical compositions of the invention may include additional active agents, such as drugs or prodrugs.

[0126] The pharmaceutical composition can be formulated to be administered by any route of administration, such as described herein. The pharmaceutical composition is usually administered by injection. In such an embodiment, the pharmaceutical composition includes a carrier and is formulated in an aqueous solution, such as water or a physiologically compatible buffer, such as Hanks solution, Ringer's solution, or a physiological saline buffer. In certain embodiments, other ingredients (e.g., ingredients that contribute to solubility or act as a preservative) are included.

[0127] Methods and uses

[0128] The present invention also relates to methods and uses of dCas13 proteins, crRNAs, polynucleotides, expression cassettes, vectors or host cells as described herein. The methods and uses of the present invention may be non-therapeutic or therapeutic, as further explained below.

[0129] The methods and uses of the present invention may include regulating the function of a regulatory element in a target RNA. Specifically, a dCas13 protein, crRNA, polynucleotide, expression cassette, vector or host cell is used to regulate the function of a regulatory element in a target RNA.

[0130] The methods and uses of the present invention may be in vitro, in vitro or in vivo. For example, the present invention also provides an in vitro method for regulating the function of a regulatory element in a target RNA, comprising delivering a catalytically inactive Cas13 protein (dCas13) and CRISPR RNA (crRNA) to a cell, wherein the crRNA recruits the dCas13 protein to the regulatory element so that the dCas13 protein spatially blocks the regulatory element, and optionally wherein the Cas13 protein is a member of the Cas13b family, the Cas13X family, the Cas13Y family or the Cas13bt family.

[0131] Thus, in some embodiments, the method or use of the present invention is not a treatment of the human or animal body by surgery or therapy and is not a diagnostic method performed on the human or animal body.

[0132] The methods and uses of the present invention may include regulating (e.g., increasing, decreasing or restoring) the availability, expression and / or activity of a nucleic acid or protein of interest by modulating the function of a regulatory element in a target RNA, wherein the target RNA encodes or regulates the nucleic acid or protein of interest.

[0133] The regulatory element may be, for example, a repeat expansion sequence in the target RNA that causes a repeat expansion disease, such as DM1. In such embodiments, the function of the regulatory element may result in increasing, decreasing or restoring the availability, expression and / or activity of a protein regulated by the target RNA.

[0134] The regulatory element may be a splicing element, an open reading frame start codon, or an upstream open reading frame (uORF) start codon. Therefore, the present invention also relates to blocking ribosome attachment or translation, including regulating the function of a regulatory element in a nucleic acid according to the method of the present invention, or regulating the availability, expression and / or activity of a target nucleic acid or protein according to the method of the present invention, wherein the crRNA includes a spacer complementary to the start codon of the open reading frame or the start codon of the upstream open reading frame (uORF). In such an embodiment, the function of the regulatory element may result in increasing, decreasing or restoring the expression and / or activity of a protein encoded by the target RNA.

[0135] The regulatory element may be a splicing element. Therefore, the present invention also relates to inducing a splicing switch, comprising regulating the function of a regulatory element in a nucleic acid according to the method of the present invention, or regulating the availability, expression and / or activity of a target nucleic acid or protein according to the method of the present invention, wherein the crRNA comprises a spacer region complementary to the splicing element, such as an RNP binding site.

[0136] The regulatory element may be a nucleic acid (e.g., miRNA) binding site. In such an embodiment, the function of the regulatory element may result in an increase, decrease, or restoration of the expression and / or activity of the nucleic acid and / or protein regulated by the target RNA. Therefore, the present invention further relates to blocking miRNA binding sites, including regulating the function of the regulatory element in the nucleic acid according to the method of the present invention, or regulating the availability, expression, and / or activity of the target nucleic acid or protein according to the method of the present invention, wherein the crRNA includes a spacer complementary to the miRNA binding site.

[0137] In embodiments of the present invention where the availability of nucleic acids or proteins is reduced, the availability of nucleic acids or proteins in cells not in contact with the dCas13 protein or crRNA described herein, for example, as measured by the unbound level of nucleic acids or proteins, may be reduced by ≥50% (i.e., more than 50%), ≥60%, ≥70%, ≥80%, ≥90% or 100%.

[0138] In the embodiments of the present invention where the availability of nucleic acids or proteins is restored, the availability of nucleic acids or proteins in cells not in contact with the dCas13 protein or crRNA described herein, for example, as measured by the unbound level of nucleic acids or proteins, can be restored by ≥50% (i.e., more than 50%), ≥60%, ≥70%, ≥80%, ≥90% or 100%.

[0139] In embodiments of the present invention where the availability of nucleic acids or proteins is increased, the availability of nucleic acids or proteins in cells not in contact with the dCas13 protein or crRNA described herein, for example, as measured by the unbound level of nucleic acids or proteins, may be increased by ≥50% (i.e., more than 50%), ≥60%, ≥70%, ≥80%, ≥90% or 100%.

[0140] The present invention also relates to methods for increasing, decreasing or restoring the expression and / or activity of a nucleic acid or protein, including modulating the function of a regulatory element in a target RNA as described herein.

[0141] In embodiments of the present invention where the expression and / or activity of a nucleic acid or protein is increased, the expression and / or activity may be increased by ≥50% (i.e., more than 50%), ≥60%, ≥70%, ≥80%, ≥90%, ≥100% or ≥200% compared to the expression and / or activity in cells not contacted with the dCas13 protein or crRNA described herein.

[0142] In embodiments of the present invention where the expression and / or activity of a nucleic acid or protein is reduced, the expression and / or activity may be reduced by ≥50% (i.e., more than 50%), ≥60%, ≥70%, ≥80%, ≥90% or 100% compared to the expression and / or activity in cells not contacted with the dCas13 protein or crRNA described herein.

[0143] In the embodiments of the present invention where the expression and / or activity of a nucleic acid or protein is restored, the expression and / or activity may be restored by ≥15% (i.e., more than 15%), ≥20%, ≥30%, 40%, ≥50%, ≥60%, ≥70%, ≥80%, ≥90% or 100% compared to the expression and / or activity in cells not contacted with the dCas13 protein or crRNA described herein.

[0144] The methods and uses of the present invention may comprise the steps of determining: (i) the expression and / or activity level of the target RNA, (ii) the expression and / or activity level of the protein encoded or regulated by the target RNA, and / or (iii) the amount and / or activity level of a protein or nucleic acid bound to the target RNA; in a sample from a subject. Methods for determining the expression and / or activity levels of nucleic acids and proteins are known in the art. For example, RNA from a sample can be isolated and detected by hybridization or PCR techniques known in the art. Alternatively, protein expression determination can be performed in situ in vivo, i.e., directly on a tissue section (fixed and / or frozen) of a patient's tissue obtained from a biopsy or resection, so that nucleic acid purification is not required. Immunoassays, such as Western Blot or ELISA, may also be used.

[0145] The present invention also relates to dCas13 proteins, crRNA, polynucleotides, expression cassettes, vectors or host cells described herein, for use in treatment methods implemented on human or animal bodies. The present invention also relates to the use of dCas13 proteins, crRNA, polynucleotides, expression cassettes, vectors or host cells described herein in the preparation of drugs for treatment methods. The present invention also relates to the use of dCas13 proteins, crRNA, polynucleotides, expression cassettes, vectors or host cells described herein for treatment methods. The present invention relates to a method for treating or preventing a disease, comprising administering to the subject a therapeutically effective amount of dCas13 proteins, crRNA, polynucleotides, expression cassettes, vectors or host cells described herein.

[0146] The methods and uses of the present invention may include inhibiting a disease state, such as preventing its development; and / or alleviating a disease state, such as causing regression of a disease state, until a desired endpoint is reached. The methods and uses of the present invention may include improving or reducing the severity, duration, or frequency of symptoms of a disease state (e.g., reducing pain or discomfort), and such improvements may or may not directly affect the disease.

[0147] The methods and uses of the present invention involve delivering dCas13 proteins, crRNA, polynucleotides, expression cassettes, vectors or host cells described herein to cells. The cells may be eukaryotic cells (eg, human cells). The cells may also be from non-human animals, such as mice, rats, rabbits, sheep, pigs, cattle, cats, or dogs.

[0148] In particular, the methods and uses of the present invention may involve delivering to a cell a vector (e.g., a viral vector such as AAV9) comprising an expression cassette, comprising a polynucleotide encoding a dCas13 protein (e.g., a dCas13b protein) and a crRNA comprising a dCas13b-specific direct repeat sequence. The dCas13b protein may be Psp-dCas13b, such as SEQ ID NO: 1, 2, or 3.

[0149] Delivery can be by single dose or multiple doses.

[0150] Generally, the present invention relates to methods and uses for human subjects in need thereof. However, non-human animal subjects are also contemplated, such as mice, rats, rabbits, sheep, pigs, cows, cats, or dogs.

[0151] The present invention relates to analyzing samples from subjects. The samples can be tissues, cells and biological fluids separated from the subject, or tissues, cells and fluids present in the subject. The samples can be blood and fractions or components of blood, including serum, plasma, or lymph.

[0152] The detection assay may be performed in situ, in which case the sample is a tissue section (fixed and / or frozen) obtained from a biopsy or resection of the subject.

[0153] The dCas13 proteins, crRNAs, polynucleotides, expression cassettes, vectors, or host cells described herein can be administered subcutaneously, intravenously, intradermally, orally, intranasally, intramuscularly, intracranially, intrathecally, intracerebroventricularly, intravitreally, or topically (e.g., in the form of a skin cream).

[0154] Doses and dosage regimens suitable for the present invention can be determined within the normal skills of the practitioner responsible for administering the composition. For example, for therapeutic purposes, a therapeutically effective amount of a dCas13 protein, crRNA, polynucleotide, expression cassette, vector or host cell described herein is administered to such a subject. A therapeutically effective amount is an amount that effectively improves one or more symptoms of a disorder.

[0155] It is understood by those skilled in the art that the dosage can be determined according to various parameters, in particular according to the age, weight and condition of the patient to be treated; the choice of vector, the target cell, organism or tissue, the degree of transformation / modification sought, the route of administration, the mode of administration, the type of transformation / modification sought, etc. The physician will be able to determine the route of administration and dosage required for any particular patient.

[0156] For example, the polynucleotide encoding the dCas13 protein and the crRNA described herein can be administered by intramuscular injection or intravascular injection at a dose of about 10 μg / kg to about 300 mg / kg body weight, such as about 50 mg / kg. In embodiments where the polynucleotide encoding the dCas13 protein and the crRNA described herein are delivered in a viral vector (e.g., AAV9), the viral vector can be delivered at a dose of about 1×10 8 About 1×10 15 Dosage of vector genome (vg) is administered. The dosage can be adjusted to balance the therapeutic benefit and any side effects. Other effective dosages can be easily determined by one of ordinary skill in the art through routine experiments to establish a dose-response curve.

[0157] RNA delivery is a useful method for in vivo delivery. RNA encoding dCas13 and crRNA described herein can be delivered to cells using liposomes, nanoparticles, microvesicles, or exosomes. For example, dCas13 mRNA and crRNA can be packaged into liposome particles for in vivo delivery. Liposome transfection reagents, such as Lipofectamine from Life Technologies and other reagents on the market, can effectively deliver RNA molecules to the liver.

[0158] The methods and uses of the present invention may be directed to treating or preventing repeat expansion diseases (e.g., myotonic dystrophy type I (DM1)), miRNA dysregulation-related diseases, translation dysregulation-related diseases, or abnormal splicing-related diseases (e.g., spinal muscular atrophy (SMA) and Duchenne muscular dystrophy (DMD)). These diseases are further explained below.

[0159] Repeat expansion diseases

[0160] The methods and uses of the present invention may be directed to treating or preventing repeat expansion diseases. The methods and uses of the present invention are particularly useful for treating or preventing repeat expansion diseases in which repeat expansion occurs in non-coding regions; and wherein somatic instability / RBP recruitment / RAN translation plays some role in disease pathology. The inventors have demonstrated that Psp-dCas13b can be programmed with crRNA to target and spatially block extended CTG repeats at the post-transcriptional level. This results in the removal of RBPs involved in splicing, and subsequently reverses the splicing lesions observed in cells derived from DM1 patients and cells of DM1 mouse models. Based on the mechanism of action of Psp-dCas13b and the known DM1 disease mechanisms, the observed therapeutic effects will be applicable to other repeat expansion diseases, such as those in which repeat expansion occurs in non-coding regions; and wherein somatic instability / RBP recruitment / RAN translation plays some role in disease pathology. Examples of these repeat expansion diseases are provided in Tables 2 and 3.

[0161] Therefore, the present invention provides a method for treating or preventing a disease listed in Table 2 or 3, comprising administering to the subject a therapeutically effective amount of a dCas13 protein and crRNA described herein. The present invention also provides a dCas13 protein as described herein, for use in a method for treating or preventing a disease listed in Table 2 or 3, wherein the method comprises administering a therapeutically effective amount of the dCas13 protein and crRNA to a subject. The present invention also provides crRNA as described herein, for use in a method for treating or preventing a disease listed in Table 2 or 3, wherein the method comprises administering a therapeutically effective amount of a dCas13 protein and crRNA to a subject. Similarly, the present invention also provides the use of a dCas13 protein as described herein in a medicament for a method for treating or preventing a disease listed in Table 2 or 3, wherein the method comprises administering a therapeutically effective amount of the dCas13 protein and crRNA to a subject. The present invention also provides the use of crRNA as described herein in a medicament for a method for treating or preventing a disease listed in Table 2 or 3, wherein the method comprises administering a therapeutically effective amount of a dCas13 protein and crRNA to a subject. The method may include regulating the function of a regulatory element in a nucleic acid according to the method of the present invention, or regulating the availability, expression and / or activity of a target nucleic acid or protein according to the method of the present invention. The crRNA may include a spacer region complementary to a repeat expansion sequence in a target RNA of a gene listed in Table 2 or 3 associated with a disease to be treated or prevented.

[0162] Repeat expansion diseases may include Winfrich-Lunderberg disease, Baratela-scott syndrome, glutaminase deficiency, spinocerebellar ataxia type 12, fragile XE syndrome, Jacobson syndrome, fragile site FRA2A-related intellectual disability, fragile site FRA12A-related intellectual disability, fragile X syndrome, fragile X-related primary ovarian insufficiency, fragile X-related tremor / ataxia syndrome, neuronal intranuclear inclusion disease, distal oculopharyngeal myopathy type 1, and distal oculopharyngeal myopathy. Terminal myopathy 2, oculopharyngeal myopathy with leukoencephalopathy, cerebellar ataxia, neuronal and vestibular reflex syndrome, spinocerebellar ataxia type 10, X-linked dystonia parkinsonism, myotonic dystrophy type 2, fragile site FRA7A-related autism spectrum disorder, Fuchs' endothelial corneal dystrophy, Friedreich's ataxia, spinocerebellar ataxia type 36, C9orf72 amyotrophic lateral sclerosis and / or frontotemporal dementia, spinocerebellar ataxia type 31, familial Adult myoclonic epilepsy 1, familial adult myoclonic epilepsy 2, familial adult myoclonic epilepsy 3, familial adult myoclonic epilepsy 4, familial adult myoclonic epilepsy 6, familial adult myoclonic epilepsy 7, spinocerebellar ataxia type 37, dentate nucleus, red nucleus, globus pallidus, Lewy body atrophy, Huntington's disease, spinal and bulbar muscular atrophy, spinocerebellar ataxia type 1, spinocerebellar ataxia type 2, spinocerebellar ataxia type 3, spinocerebellar ataxia type 6 adjustment, spinocerebellar ataxia type 7, spinocerebellar ataxia type 17, pseudoachondroplasia and multiple epiphyseal dysplasia, blepharophimosis, ptosis and epicanthus syndrome, cranioclavicular dysplasia, congenital central hypoventilation syndrome, hand-foot-genital syndrome, holoprosencephaly 5, oculopharyngeal muscular dystrophy, syndactyly 1, X-linked hypopituitarism, X-linked intellectual disability, spinocerebellar ataxia type 8, myotonic dystrophy type 1, Huntington's disease-like 2.

[0163] The repeat expansion disease can be a neurological disease, such as Huntington's disease-like 2, C9orf72 amyotrophic lateral sclerosis and / or frontotemporal dementia, fragile X-associated tremor / ataxia syndrome, fragile X-associated primary ovarian insufficiency, spinocerebellar ataxia type 10, spinocerebellar ataxia type 31, or spinocerebellar ataxia type 36.

[0164] The repeat expansion disease may be myotonic dystrophy type 1, Fuchs' corneal endothelial dystrophy, myotonic dystrophy type 2, Huntington's disease-like 2, C9orf72 amyotrophic lateral sclerosis and / or frontotemporal dementia, fragile X-associated tremor / ataxia syndrome, fragile X-associated primary ovarian insufficiency, spinocerebellar ataxia type 36, spinocerebellar ataxia type 31, or spinocerebellar ataxia type 10. The inventors have found that using a dCas13b protein, such as Psp-dCas13b as described herein, can be particularly effective in treating these diseases. Thus, the present invention provides a method for treating or preventing myotonic dystrophy type 1, Fuchs' corneal endothelial dystrophy, myotonic dystrophy type 2, Huntington's disease-like 2, C9orf72 amyotrophic lateral sclerosis and / or frontotemporal dementia, fragile X-associated tremor / ataxia syndrome, fragile X-associated primary ovarian insufficiency, spinocerebellar ataxia type 36, spinocerebellar ataxia type 31, or spinocerebellar ataxia type 10, comprising administering to a subject a therapeutically effective amount of a dCas13b protein (e.g., Psp-dCas13b) and a crRNA specific for the dCas13b protein, as described herein.

[0165] The repeat expansion disease may be myotonic dystrophy type 1, myotonic dystrophy type 2, or Fuchs' endothelial corneal dystrophy. The inventors have discovered that the use of dCas13b proteins, such as Psp-dCas13b described herein, may be particularly effective in treating these diseases.

[0166] The repeat expansion disease may be myotonic dystrophy type 1. The inventors have discovered that the use of dCas13b proteins, such as Psp-dCas13b described herein, may be particularly effective in treating these diseases.

[0167] The repeat expansion disease may be myotonic dystrophy type I (DM1), and the repeat expansion sequence may be (CTG) n , the target RNA may be DMPK1.

[0168] Therefore, the present invention provides a method for treating or preventing DM1, comprising administering to a subject a therapeutically effective amount of a dCas13 protein (e.g., dCas13b, such as Psp-dCas13b) and a crRNA as described herein, wherein the crRNA comprises a repeat expansion sequence (CTG) in DMPK1. n Complementary spacer region.

[0169] The present invention also provides a dCas13 protein (e.g., dCas13b, such as Psp-dCas13b) described herein for use in a method for treating or preventing DM1, wherein the method comprises administering to a subject a therapeutically effective amount of the dCas13 protein (e.g., dCas13b, such as Psp-dCas13b) and crRNA, wherein the crRNA comprises a repeat expansion sequence (CTG) in DMPK1. n Complementary spacer. Similarly, the present invention also provides the use of the dCas13 protein described herein (e.g., dCas13b, such as Psp-dCas13b) in the preparation of a medicament for treating or preventing DM1, wherein the method comprises administering to a subject a therapeutically effective amount of the dCas13 protein (e.g., dCas13b, such as Psp-dCas13b) and crRNA, wherein the crRNA comprises a repeat expansion sequence (CTG) in DMPK1. n Complementary spacer region.

[0170] The present invention also provides the crRNA described herein for use in a method for treating or preventing DM1, wherein the method comprises administering to a subject a therapeutically effective amount of a dCas13 protein (e.g., dCas13b, such as Psp-dCas13b) and the crRNA, wherein the crRNA comprises a repeat expansion sequence (CTG) in DMPK1. n Similarly, the present invention also provides the use of the crRNA described herein in the preparation of a medicament for the treatment or prevention of DM1, wherein the method comprises administering to a subject a therapeutically effective amount of a dCas13 protein (e.g., dCas13b, such as Psp-dCas13b) and the crRNA, wherein the crRNA comprises a repeat expansion sequence (CTG) in DMPK1. n Complementary spacer region.

[0171] The dCas13 protein may comprise or consist of SEQ ID NO: 1, 2 or 3. The crRNA may consist of any one of SEQ ID NO: 8 to 11 (eg, see Figures 4 and 6).

[0172] Diseases associated with miRNA dysregulation

[0173] The methods and uses of the present invention may be directed to treating or preventing diseases associated with miRNA dysregulation. The inventors have demonstrated that Psp-dCas13b can be programmed with crRNA to block the target sites of miR-17, miR-92a, and miR-222 in a fluorescent reporter system in human cells. Therefore, the dCas13 protein and crRNA described herein are particularly useful for blocking the interaction between miRNA and its target binding site to reduce miRNA-mediated target RNA silencing, thereby treating or preventing diseases associated with miRNA dysregulation.

[0174] It has been previously reported that several miRNA-targeted therapeutics (antimiRs) have reached clinical development, including short antisense oligonucleotides targeting miR-122, which have reached Phase II trials for the treatment of hepatitis C. The dCas13 and crRNA described herein are more advantageous. The dCas13 and crRNA described herein do not target miRNAs, but rather prevent the interaction between miRNAs and their binding sites by spatially blocking the miRNA binding sites within the target RNA, so they can interfere more precisely than miRNA-targeted therapies.

[0175] Therefore, the present invention provides a method for treating or preventing a disease associated with miRNA disorder, comprising administering to a subject a therapeutically effective amount of a dCas13 protein (e.g., a dCas13b protein, such as Psp-dCas13b) and crRNA as described herein. The present invention also provides dCas13 proteins as described herein, for use in methods for treating or preventing diseases associated with miRNA disorder, wherein the method comprises administering to a subject a therapeutically effective amount of the dCas13 protein (e.g., a dCas13b protein, such as Psp-dCas13b) and crRNA. The present invention also provides crRNA as described herein, for use in methods for treating or preventing diseases associated with miRNA disorder, wherein the method comprises administering to a subject a therapeutically effective amount of a dCas13 protein (e.g., a dCas13b protein, such as Psp-dCas13b) and the crRNA. Similarly, the present invention also provides the use of dCas13 proteins (e.g., dCas13b proteins, such as Psp-dCas13b) described herein in the preparation of a medicament for a method for treating or preventing a disease associated with miRNA disorder, wherein the method comprises administering a therapeutically effective amount of the dCas13 protein (e.g., dCas13b protein, such as Psp-dCas13b) and crRNA to a subject. The present invention also provides the use of crRNA described herein in the preparation of a medicament for a method for treating or preventing a disease associated with miRNA disorder, wherein the method comprises administering a therapeutically effective amount of dCas13 proteins (e.g., dCas13b proteins, such as Psp-dCas13b) and crRNA to a subject. The method may include regulating the function of a regulatory element in a nucleic acid according to the method of the present invention, or regulating the availability, expression and / or activity of a target nucleic acid or protein according to the method of the present invention. The crRNA may include a spacer region that is fully complementary or partially complementary to a miRNA binding site in a target RNA. The crRNA may include a spacer region that binds to a miRNA adjacent sequence to destroy a miRNA binding site.

[0176] Diseases associated with miRNA dysregulation may be hepatitis C (dCas13 protein can be used to treat hepatitis C by blocking miR122::HCV interaction), melanoma (dCas13 protein can be used to treat melanoma by blocking miR16::TYRP1), breast cancer (dCas13 protein can be used to treat breast cancer by blocking miR21::PDCD4 and miR21::PTEN), and heart failure (dCas13 protein can be used to treat heart failure by blocking miR21::Spry1).

[0177] Inhibiting translation could treat disease

[0178] The methods and uses of the present invention may be directed to treating or preventing diseases associated with dysregulated translation and / or treating or preventing diseases treatable by inhibiting translation. The inventors have demonstrated that Psp-dCas13b can be used to block the translation of fluorescent reporter proteins in human cells. Therefore, the dCas13 proteins and crRNAs described herein are particularly useful for inhibiting the translation of abnormally expressed genes with toxic gain of function, thereby treating or preventing diseases associated with dysregulated translation and / or treating or preventing diseases treatable by inhibiting translation.

[0179] Therefore, the present invention provides a method for treating or preventing diseases related to translation disorders and / or treating or preventing diseases that can be treated by inhibiting translation, comprising administering to a subject a therapeutically effective amount of a dCas13 protein (e.g., a dCas13b protein, such as Psp-dCas13b) and crRNA as described herein. The present invention also provides dCas13 proteins as described herein, for use in treating or preventing diseases related to translation disorders and / or treating or preventing diseases that can be treated by inhibiting translation, wherein the method comprises administering to a subject a therapeutically effective amount of the dCas13 protein (e.g., a dCas13b protein, such as Psp-dCas13b) and crRNA. The present invention also provides crRNA as described herein, for use in treating or preventing diseases related to translation disorders and / or treating or preventing diseases that can be treated by inhibiting translation, wherein the method comprises administering to a subject a therapeutically effective amount of a dCas13 protein (e.g., a dCas13b protein, such as Psp-dCas13b) and the crRNA. Similarly, the present invention also provides the use of dCas13 proteins (e.g., dCas13b proteins, such as Psp-dCas13b) described herein in the preparation of a medicament for treating or preventing a disease associated with translational disorders and / or treating or preventing a method for inhibiting translational treatment of a disease, wherein the method comprises administering to a subject a therapeutically effective amount of the dCas13 protein (e.g., dCas13b protein, such as Psp-dCas13b) and crRNA. The present invention also provides the use of crRNA described herein in the preparation of a medicament for treating or preventing a disease associated with translational disorders and / or treating or preventing a method for inhibiting translational treatment of a disease, wherein the method comprises administering to a subject a therapeutically effective amount of dCas13 proteins (e.g., dCas13b proteins, such as Psp-dCas13b) and the crRNA. The method may include regulating the function of a regulatory element in a nucleic acid according to the method of the present invention, or regulating the availability, expression, and / or activity of a target nucleic acid or protein according to the method of the present invention. The crRNA may include a spacer region complementary to a translational regulatory element, such as a Kozak sequence, a 5′UTR sequence upstream of the start codon of an open reading frame, the start codon of an open reading frame, or the start codon of an upstream open reading frame (uORF) in a target RNA that exhibits a toxic gain of function.

[0180] Diseases associated with dysregulated translation may be Huntington's disease or amyotrophic lateral sclerosis. Diseases treatable by inhibiting translation may be familial hypercholesterolemia.

[0181] Modulating splicing could treat disease

[0182] The methods and uses of the present invention may relate to the treatment or prevention of diseases associated with abnormal splicing and / or the treatment or prevention of diseases treatable by modulating splicing.

[0183] The inventors have demonstrated that Psp-dCas13b can be programmed with crRNA to target specific RNA sequences and spatially block the interaction of target RNA with the following substances: (1) ribosomes; (2) miRNA silencing complexes; and (3) RNA binding proteins (see Examples). These data demonstrate that Psp-dCas13b has a sufficiently strong affinity to block the interaction between RNA molecules and various RNA binding proteins and / or ribonucleoprotein complexes.

[0184] RNA splicing is the process by which small nuclear ribonucleoproteins (snRNPs) bind to pre-mRNA, form intron loops, and remove introns to produce mature RNA transcripts. Previous studies have shown that splicing switching can be induced by, for example, spatially blocking snRNP binding sites with antisense oligonucleotides. Therefore, the dCas13 protein and crRNA described herein can be used to target and spatially block snRNP binding sites, which can block the interaction between snRNP and pre-mRNA, thereby inducing splicing switching.

[0185] Therefore, the present invention provides a method for treating or preventing abnormal splicing-related diseases and / or treating or preventing a method for regulating splicing-treatable diseases, comprising administering to a subject a therapeutically effective amount of a dCas13 protein (e.g., a dCas13b protein, such as Psp-dCas13b) and crRNA as described herein. The present invention also provides dCas13 proteins as described herein, for treating or preventing abnormal splicing-related diseases and / or treating or preventing a method for regulating splicing-treatable diseases, wherein the method comprises administering to a subject a therapeutically effective amount of the dCas13 protein (e.g., a dCas13b protein, such as Psp-dCas13b) and crRNA. The present invention also provides crRNA as described herein, for treating or preventing abnormal splicing-related diseases and / or treating or preventing a method for regulating splicing-treatable diseases, wherein the method comprises administering to a subject a therapeutically effective amount of a dCas13 protein (e.g., a dCas13b protein, such as Psp-dCas13b) and the crRNA. Similarly, the present invention also provides the use of dCas13 proteins (e.g., dCas13b proteins, such as Psp-dCas13b) described herein in the preparation of a method for treating or preventing a splicing abnormality-related disease and / or a method for treating or preventing a splicing-treatable disease, wherein the method comprises administering a therapeutically effective amount of the dCas13 protein (e.g., dCas13b protein, such as Psp-dCas13b) and crRNA to a subject. The present invention also provides the use of crRNA described herein in the preparation of a drug for treating or preventing a splicing abnormality-related disease and / or a method for treating or preventing a splicing-treatable disease, wherein the method comprises administering a therapeutically effective amount of dCas13 proteins (e.g., dCas13b proteins, such as Psp-dCas13b) and crRNA to a subject. The method may include regulating the function of a regulatory element in a nucleic acid according to the method of the present invention, or regulating the availability, expression, and / or activity of a target nucleic acid or protein according to the method of the present invention. The crRNA may include a spacer region complementary to a splicing element, such as a snRNP binding site, an exonic splicing enhancer (ESE), and an exonic splicing silencer (ESS).

[0186] The disease associated with abnormal splicing may be spinal muscular atrophy (SMA). The disease treatable by regulating splicing may be DMD.

[0187] The present invention also provides kits and products for the present invention. The kit may include dCas13 proteins, crRNA, polynucleotides, vectors, delivery vehicles, host cells, compositions or pharmaceutical compositions and instructions for use as described herein. The kit may also include one or more additional reagents, such as buffers, crRNA, polynucleotides, vectors, delivery vehicles, host cells, compositions or pharmaceutical compositions necessary for the composition and delivery of dCas13 proteins. The kit may also include a package insert with instructions for use.

[0188] Implementation

[0189] 1. A method for modulating the function of a regulatory element in a target RNA, comprising delivering to a cell:

[0190] - a catalytically inactive Cas13 protein (dCas13), wherein the Cas13 protein is a member of the Cas13b family, the Cas13X family, the Cas13Y family or the Cas13bt family; and

[0191] - CRISPR RNA (crRNA), which is capable of recruiting the dCas13 protein to the regulatory element,

[0192] Thereby regulating the function of the regulatory element.

[0193] 2. The method of embodiment 1, wherein the regulatory element is: (a) a cis-regulatory element, such as a splicing element, or (b) a trans-regulatory element, such as a protein binding site or a nucleic acid binding site.

[0194] 3. The method of embodiment 2, wherein:

[0195] (a) the protein binding site is a repeat expansion sequence, the start codon of an open reading frame, the start codon of an upstream open reading frame (uORF), or a snRNP binding site; or

[0196] (b) The nucleic acid binding site is a miRNA binding site.

[0197] 4. A method as described in any of the preceding embodiments, wherein the Cas13 protein is:

[0198] (a) PspCas13b, Pgu13b, PgiCas13b, Cas13X.1, Cas13X.2, PinCas13b, Cas13Y.1, Cas13Y.2, Cas13Y.3, Cas13bt1, or Cas13bt3;

[0199] (b) PspCas13b, PguCas13b, PgiCas13b, Cas13X.1, Cas13X.2, PinCas13b, Cas13Y.1, Cas13Y.2, Cas13bt1, or Cas13bt3; or

[0200] (c) PspCas13b.

[0201] 5. A method as described in embodiment 4, wherein the Cas13 protein is PspCas13b.

[0202] 6. A method as described in any of the preceding embodiments, wherein relative to the corresponding unmodified Cas13 protein, the dCas13 protein includes mutations in one or more amino acid residues in the RxxxxH motif of the HEPN-1 domain and the RxxxxH motif of the HEPN-2 domain.

[0203] 7. A method as described in any of the preceding embodiments, wherein the dCas13 protein comprises or consists of an amino acid sequence having ≥85% sequence identity with SEQ ID NO: 1, provided that the amino acid residues corresponding to amino acid residues 133 and 1058 of SEQ ID NO: 1 are not histidine, for example, are both alanine.

[0204] 8. A method as described in any of the preceding embodiments, wherein the dCas13 protein is truncated by ≤110 amino acid residues from the C-terminus compared to the unmodified protein, and optionally wherein the Cas13 protein of the dCas13 protein is a member of the Cas13b family, such as PspCas13b.

[0205] 9. A method as described in embodiment 8, wherein the dCas13 protein comprises or consists of an amino acid sequence having ≥85% sequence identity with SEQ ID NO: 2 or 3, provided that the amino acid residue corresponding to the 133rd amino acid residue of SEQ ID NO: 2 or 3 is not histidine, for example, it is alanine.

[0206] 10. A method as described in any of the aforementioned embodiments, wherein the crRNA includes a dCas13-specific direct repeat and a spacer region capable of specifically hybridizing with a target RNA sequence.

[0207] 11. A method as described in embodiment 10, wherein the crRNA includes dCas13b-specific direct repeats and the spacer has a length of 12 to 36 nucleotides, 12 to 27 nucleotides, or 18 to 24 nucleotides, for example, the crRNA includes or consists of any one of SEQ ID NO: 4, 7 to 11, or 73 to 80.

[0208] 12. A method for regulating the availability, expression and / or activity of a target nucleic acid or protein, comprising regulating the function of a regulatory element in a target RNA by the method described in any of the preceding embodiments, wherein the target RNA encodes or regulates the target nucleic acid or protein, so that the availability, expression and / or activity of the target nucleic acid or protein is increased or decreased.

[0209] 13. A method for blocking miRNA binding sites, comprising regulating the function of a regulatory element in a target RNA according to any one of embodiments 1 to 11, or regulating the availability, expression and / or activity of a target nucleic acid or protein according to the method described in embodiment 12, wherein the crRNA comprises a spacer region complementary to the miRNA binding site, so that the silencing of the target RNA mediated by the miRNA is reduced.

[0210] 14. A method for blocking ribosome attachment or translation of a target RNA, comprising regulating the function of a regulatory element in a nucleic acid according to any one of embodiments 1 to 11, or regulating the availability, expression and / or activity of a target nucleic acid or protein according to the method described in embodiment 12, wherein the crRNA comprises a spacer region complementary to the start codon of an open reading frame or the start codon of an upstream open reading frame (uORF), so that the translation of the target RNA is reduced.

[0211] 15. A method for inducing splicing switching, comprising regulating the function of a regulatory element in a target RNA according to any one of embodiments 1 to 11, or regulating the availability, expression and / or activity of a target nucleic acid or protein according to the method described in embodiment 12, wherein the crRNA comprises a spacer region complementary to the splicing element, such as an RNP binding site, so that the splicing of the target RNA is regulated.

[0212] 16. A dCas13b-specific crRNA, comprising: (i) a dCas13b-specific direct repeat, and (ii) a spacer region that can specifically hybridize to a target RNA sequence and has a length between 18 and 24 nucleotides.

[0213] 17. A dCas13b protein consisting of an amino acid sequence having ≥85% sequence identity with SEQ ID NO: 2 or 3, provided that the amino acid residue corresponding to amino acid residue 133 of SEQ ID NO: 2 or 3 is alanine.

[0214] 18. A polynucleotide or vector encoding the crRNA according to embodiment 16 or the dCas13b protein according to embodiment 17, optionally wherein the vector is AAV or a lentivirus.

[0215] 19. A delivery vehicle comprising the crRNA according to embodiment 16, the dCas13b protein according to embodiment 17, or the polynucleotide or vector according to embodiment 18.

[0216] 20. A pharmaceutical composition comprising: (i) the crRNA according to embodiment 16 or the dCas13b protein according to embodiment 17, and (ii) a pharmaceutically acceptable carrier.

[0217] 21. The crRNA according to embodiment 16 or the dCas13b protein according to embodiment 17, for use in a therapeutic method performed on a human or animal body.

[0218] 22. The crRNA of embodiment 16, for use in a method for treating a repeat expansion disease, optionally wherein the expansion disease is myotonic dystrophy type 1 (DM1), myotonic dystrophy type 2, or Fuchs' corneal endothelial dystrophy.

[0219] 23. A method for treating or preventing a repeat expansion disease in a subject, wherein the method comprises administering a therapeutically effective amount of a dCas13 protein and a crRNA to the subject, wherein the method comprises regulating the function of a regulatory element in a nucleic acid as described in any one of embodiments 1 to 11, or regulating the availability, expression and / or activity of a target nucleic acid or protein according to the method described in embodiment 12, wherein the crRNA comprises a spacer region complementary to the expanded repeat sequence, and optionally wherein the expansion disease is myotonic dystrophy type 1 (DM1), myotonic dystrophy type 2, or Fuchs' corneal endothelial dystrophy.

[0220] 24. A dCas13 protein for use in a method for treating a repeat expansion disease, wherein the method comprises administering a therapeutically effective amount of a dCas13 protein and a crRNA to a subject, wherein the method comprises regulating the function of a regulatory element in a nucleic acid as described in any one of embodiments 1 to 11, or regulating the availability, expression and / or activity of a target nucleic acid or protein according to the method described in embodiment 12, wherein the crRNA comprises a spacer region complementary to an expanded repeat sequence, and optionally wherein the expansion disease is myotonic dystrophy type 1 (DM1), myotonic dystrophy type 2, or Fuchs' corneal endothelial dystrophy.

[0221] 25. The crRNA used in embodiment 22, the method in embodiment 23, or the dCas13 protein used in embodiment 24, wherein the Cas13 protein is a member of the Cas13b family, and optionally wherein the dCas13 protein comprises or consists of an amino acid sequence having ≥85% sequence identity with SEQ ID NO: 2 or 3, provided that the amino acid residue corresponding to the 133rd amino acid residue of SEQ ID NO: 2 or 3 is alanine.

[0222] other

[0223] It should be understood that the different applications of dCas13b and crRNA described herein can be adjusted according to the specific needs of the art. It should also be understood that the terms used herein are only for describing specific embodiments of the present invention and are not intended to be limiting.

[0224] In addition, as used in this specification and the appended claims, the singular forms "a", "an", and "the" include plural referents unless the content clearly dictates otherwise. Thus, for example, reference to "a regulatory element" includes two or more "regulatory elements."

[0225] In addition, "≥x" mentioned herein means equal to or greater than x. "≤x" mentioned herein means less than or equal to x.

[0226] For the purposes of the present invention, in order to determine the percent identity of two sequences (e.g., two polynucleotides or two polypeptide sequences), the sequences are aligned for optimal comparison purposes (e.g., gaps may be introduced in the first sequence for optimal alignment with the second sequence). The nucleotides or amino acid residues at each position are then compared. When a position in the first sequence is occupied by the same nucleotide or amino acid as the corresponding position in the second sequence, the nucleotide or amino acid is identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences (i.e., % identity = number of identical positions / total number of positions in the reference sequence × 100).

[0227] Typically, sequence comparisons are performed over the length of a reference sequence. For example, if a user wishes to determine whether a given ("test") sequence is 95% identical to SEQ ID NO:3, SEQ ID NO:3 would be the reference sequence. In order to assess whether a sequence is at least 95% identical to SEQ ID NO:3 (an example of a reference sequence), one skilled in the art will compare SEQ ID NO:3 over its entire length and determine how many positions in the test sequence are identical to positions in SEQ ID NO:3. If at least 95% of the positions are identical, the test sequence is at least 95% identical to SEQ ID NO:3. If the sequence is shorter than SEQ ID NO:3, gaps or missing positions should be considered non-identical positions.

[0228] The skilled person is aware of different computer programs that can be used to determine the homology or identity between two sequences. For example, comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. In one embodiment, the percent identity between two amino acid or nucleic acid sequences is determined using the Needleman and Wunsch (1970) algorithm, which has been incorporated into the GAP program in the Accelrys GCG software package (available at http: / / www.accelrys.com / Products / GCG / ), using a Blosum 62 matrix or a PAM250 matrix, a gap weight of 16, 14, 12, 10, 8, 6, or 4, and a length weight of 1, 2, 3, 4, 5, or 6.

[0229] All publications, patents and patent applications cited herein, whether supra or infra, are hereby incorporated by reference in their entirety.

[0230] The following examples illustrate the invention.

[0231] Example

[0232] Example 1

[0233] Materials and methods

[0234] Generation of dCas13-encoding vector

[0235] All dCas13 encoding vectors were generated by ligating PCR amplicons containing the appropriate dCas13 ortholog, localization signal, and fluorescent marker into vectors containing either the EF1-α promoter or the CMV promoter. Amplification conditions were as follows: 98°C for 60 s, 40 cycles of 98°C for 10 s, optimal annealing conditions determined by the NEB Tm calculator for 30 s, 72°C for 60–180 s, and then 72°C for 5 min.

[0236] Generation of crRNA encoding vectors

[0237] All crRNA encoding vectors were generated by annealing two single-stranded oligonucleotides and ligating the resulting double-stranded oligonucleotide into a vector containing the hU6 promoter and pol III termination signal. Custom single-stranded oligonucleotides were synthesized and used for oligonucleotide annealing reactions. For all oligonucleotide annealing reactions, 10 μL containing 10 μM of the forward and reverse oligonucleotides, 1× T4 DNA ligase buffer, and five units of T4 polynucleotide kinase were incubated at 37°C for 30 minutes, raised to 95°C for 5 minutes, and then cooled to 25°C at a rate of 0.1°C / s.

[0238] The annealed oligonucleotides are then used as inserts in cloning reactions where applicable.

[0239] Transfection of HEK293T cells

[0240] For each well, 500 ng of dCas13 encoding plasmid, 1 μg of crRNA encoding plasmid, and 50 ng of bidirectional reporter plasmid were mixed and incubated in Opti-MEM containing 1.5 μg of PEI. TM Add to 50 μl. Then mix the solution and add to the cells. Then incubate the cells at 37°C, 5% CO2 for 24 hours. Then remove the transfection medium and replace it with fresh DMEM + 10% FBS, and let the cells rest for another 24 hours (48 hours after the start of transfection) before harvesting for flow cytometry analysis.

[0241] Flow cytometry

[0242] Adherent HEK293T cells were harvested using 0.05% trypsin-EDTA. After trypsinization, cells were washed with PBS, resuspended in growth medium, and passed through a 70 μm cell strainer prior to flow cytometry analysis. TM Flow cytometry was performed using a cell analyzer. ECFP was measured with a 450 / 50 bandpass filter after 405 nm excitation. EGFP was measured using 488 nm excitation and a 530 / 30 bandpass filter. mIFP was measured using 640 nm excitation and a 670 / 14 bandpass filter.

[0243] Electroporation and differentiation of human myoblasts

[0244] First, human myoblasts were harvested using 0.05% trypsin-EDTA and electroporated with the Neon transfection system kit according to the manufacturer's instructions. For every 150,000 cells, 100 ng of Super PiggyBac transposase expression vector and 600 ng of dCas13-crRNA vector were used. The electroporation settings were 1750 V, 10 ms, 3 pulses. The electroporated cells were then plated and cultured to allow myoblasts to differentiate into myotubes.

[0245] Fluorescence Activated Cell Sorting (FACS) of Human Myotube Cells

[0246] Adherent human myotubes were harvested using 0.05% trypsin-EDTA. After trypsinization, cells were washed with PBS and resuspended in SkMC growth medium supplemented with SupplementMix and 0.1 μg / mL DAPI. The cell suspension was then passed through a 70 μm cell strainer. TM Cell sorting experiments were performed using a Fusion cell sorter. DAPI was measured with a 450 / 50 bandpass filter after 405 nm excitation. EGFP was measured using 488 nm excitation and a 530 / 30 bandpass filter. Cells were sorted into SkMC growth medium and immediately proceeded to the subsequent RNA extraction step.

[0247] RNA extraction and semi-quantitative PCR analysis

[0248] From human myotube tissue culture or HSA LR Total RNA was extracted from mice. For in vivo experiments, RNA was extracted from HSA LR TA muscles collected from mice were homogenized in 1-thioglycerol / homogenization solution for 2 × 1 min. Subsequently, total RNA was isolated. Total RNA collected from in vitro or in vivo experiments was then processed to remove residual plasmid contamination. For each sample, cDNA was generated from 75 ng of total RNA. Subsequently, 1 μL of the cDNA preparation was used for semi-quantitative PCR analysis. 1–10 μL of the PCR product was then electrophoresed on a 2% agarose gel and (Biotium) Nucleic acids were visualized using BioRad GelDoc TM Gel images were captured with an XR+ imager, with an exposure time just below that which would result in saturated pixels (~0.75 s). Image processing was performed using ImageJ. First, background subtraction was performed, and the upper and lower band densities were measured for each sample. Then, the relative inclusion level (PSI, Ψ) of exon skipping events was calculated as the ratio of the upper band density to the total band density for each target gene.

[0249] Synthesis of AAV encoding dCas13, transgenic mice, and AAV injection

[0250] Ultrapurified AAV9 encoding full-length Psp-dCas13b and its 23nt crRNA, truncated Psp-dCas13b and its 21nt crRNA, or EGFP was synthesized in VectorBuilder. All mice used in this study were FVB-WT strain or HSA with >200 repeats LR Transgenic mice. For TA injection, AAV9 containing full-length Psp-dCas13b and its 23nt crRNA or truncated Psp-dCas13b and its 21nt was diluted in sterile phosphate-buffered saline (PBS) and injected (30 μL) into the HSA LR in the TA muscle of anesthetized mice (5–9 weeks old).

[0251] Example 2

[0252] Psp-dCas13b can be redesigned as an efficient RNA steric blocker

[0253] The inventors first sought to identify the best Cas13 ortholog that was catalytically inactivated and repurposed as an RNA steric blocker.

[0254] LwaCas13a, PspCas13b, and RfxCas13d representing each major Cas13 family member were selected. A catalytically inactive LwaCas13a (Lwa-dCas13a) was designed by replacing the arginine residues of the two RxxxxH motifs of LwaCas13a with alanine. A catalytically inactive PspCas13b (Psp-dCas13b) was designed by replacing the histidine residues of the two RxxxxxxH motifs of PspCas13b with alanine. A catalytically inactive RfxCas13d (Rfx-dCas13d) was designed by replacing the first and last residues of the RxxxxH motif of RfxCas13d with alanine.

[0255] Lwa-dCas13a, Psp-dCas13b and Rfx-dCas13d were cloned into expression vectors containing sequences encoding N-terminal nuclear export signals (NES). Then, HEK293T cells were co-transfected with (a) an expression vector encoding NES-Lwa-dCas13a, NES-Psp-dCas13b or NES-Rfx-dCas13d; (b) an expression vector encoding the corresponding crRNA; and (c) an expression vector encoding a bidirectional fluorescent reporter gene expressing ECFP and mIFP (see Figure 1A ). The relative expression levels of ECFP to mIFP were quantified by flow cytometry to determine the steric hindrance effect of each dCas13 ortholog.

[0256] To compare the ribosome steric hindrance effects of Lwa-dCas13a, Psp-dCas13b, and Rfx-dCas13d, these dCas13 proteins were programmed using their corresponding crRNAs to bind and sterically block the 5′UTR or translation start site (TSS) of the ECFP transgene (see Figure 1A , top right). Meanwhile, to compare the miRNA steric hindrance effects of Lwa-dCas13a, Psp-dCas13b, and Rfx-dCas13d, the miR-17 binding site was cloned in the 3′UTR of the ECFP transgene, which resulted in miR-17-induced downregulation of ECFP relative to mIFP. The dCas13 proteins were then programmed with their corresponding crRNAs to bind and sterically block the miR-17 target site ( Figure 1A , lower right).

[0257] The inventors observed that Psp-dCas13b exhibited the highest steric hindrance, resulting in ~50% ECFP repression and miR-17 derepression in ribosome and miRNA blocking experiments, respectively ( Figure 1B and C).

[0258] Example 3

[0259] Shortening the crRNA spacer enhances the steric hindrance of Psp-dCas13b

[0260] To further improve the steric hindrance effect of Psp-dCas13b, the inventors tested crRNA spacers of different lengths. The inventors hypothesized that longer spacers that extend Watson-Crick base pairing beyond the native length of 30nt found in Prevotella P5-125 transcriptome would increase binding affinity and thereby increase the steric hindrance effect. Surprisingly, shorter spacers of 18–24nt mediated significantly higher steric hindrance, achieving complete inhibition of ECFP in ribosome blocking experiments ( Figure 2A ).

[0261] To confirm that the observed steric hindrance effect was mediated by the interaction between Psp-dCas13b and the crRNA ribonucleoprotein (RNP) complex, rather than crRNA:mRNA hybridization, the inventors performed fluorescence reporter experiments in which Psp-dCas13b or crRNA was omitted. The results of the experiment showed that both Psp-dCas13b and crRNA were required to block ECFP translation ( Figure 2B ), indicating that crRNA:mRNA hybridization alone is unlikely to play a major role in blocking ribosome attachment.

[0262] Example 4

[0263] Psp-dCas13b blocks miRNA interactions in a highly specific manner

[0264] To explore the general applicability of Psp-dCas13b blocking miRNA function, the inventors cloned three bidirectional reporter vectors expressing ECFP and mIFP, respectively, and included binding sites for miR-17, miR-92a, or miR-222 in the 3′UTR of the ECFP transgene. It is known that miR-17, miR-92a, and miR-222 are highly active in HEK293T cells and were found to inhibit ECFP expression relative to mIFP (data not shown). Subsequently, a total of 45 crRNA vectors were designed to cover the entire 3′UTR of the ECFP transcript.

[0265] The inventors observed that in all three miRNA reporters, co-expression of Psp-dCas13b and its corresponding crRNA resulted in de-repression of ECFP expression, indicating the general nature of Psp-dCas13b as a miRNA blocker. In particular, the inventors demonstrated that de-repression was only observed when Psp-dCas13b was guided by a crRNA designed to partially or completely cover the miRNA binding site. At the same time, no consistent de-repression was observed when crRNAs including spacers complementary to adjacent regions of the miRNA binding site targeted Psp-dCas13b ( Figure 3A ).

[0266] The inventors further measured the degree of derepression achieved by the Psp-dCas13b steric blocker by comparing relative ECFP expression levels with those achieved by miRNA blocking antisense oligonucleotide (antagomiR) treatment ( Figure 3B The inventors observed that blocking the miR-17 target site with Psp-dCas13b phenotypically replicated the level of derepression achieved with antagomiR-17, resulting in a complete blockade of miRNA activity against ECFP mRNA.

[0267] Example 5

[0268] Reversal of disease pathology by targeting repeat expansion sequences in DMPK1 mRNA with Psp-dCas13b

[0269] After establishing the applicability of Psp-dCas13b to block ribosome and miRNA function, the inventors investigated the utility of this system for the treatment of RNA-dominant diseases. Myotonic dystrophy type 1 (DM1) is caused by the (CTG) n A hereditary neuromuscular disease caused by the expansion of a repeat sequence. The expanded sequence is then transcribed into toxic RNA, which recruits cellular splicing factors and produces repeat-associated small peptides ( Figure 4A). The symptoms and signs of DM1 are primarily caused by extensive splicing disorders due to the recruitment of splicing factors (11, 12). Previous studies have shown that mis-splicing of ATP2A1 and SOS1 mRNAs leads to muscle stiffness and myotonia, which constitute the hallmark symptoms of the disease. It is also known that mis-splicing of other gene transcripts such as INSR, cTNT, DMD, MBNL1 and MBNL2 also leads to the development of other symptoms such as insulin resistance, cardiac conduction defects, learning difficulties and infertility.

[0270] The inventors hypothesized that Psp-dCas13b could be used to treat DM1 by sterically blocking toxic repeat sequences in DMPK1 mRNA, thereby de-recruiting splicing factors and inhibiting repeat-associated non-AUG (RAN) translation. To explore this possibility, the inventors electroporated wild-type (WT) or DM1 patient-derived myoblasts with piggyBac plasmids encoding NLS-dCas13b-NLS-P2A-EGFP and its corresponding crRNAs. Five different crRNAs were designed for this experiment, encoding scrambled non-targeting control (Scr), 23nt (crRNA1), 31nt (crRNA2), 21nt (crRNA3), or 24nt (crRNA4) repeat targeting sequences ( Figure 4B ). The electroporated myoblasts were then differentiated into myotubes for 6 days, after which EGFP(+) cells were sorted. Total RNA from EGFP(+) cells was then collected and the splicing patterns of the six biomarker exons were evaluated by RT-PCR. The inventors observed consistent reversal of disease-associated splicing patterns in all biomarker transcripts, including SOS1, INSR, MBNL1, MBNL2, ATP2A1, and DMD. The inventors also observed different levels of splicing correction associated with different spacer lengths on crRNA. Consistent with the observations described by the inventors in “Shortening the crRNA spacer increases the steric hindrance effect of Psp-dCas13b”, short spacers of 21 nucleotides (crRNA3), 23 nucleotides (crRNA1), and 24 nucleotides (crRNA4) mediated complete reversal of splicing, while a spacer of 31 nucleotides (crRNA2) only mediated partial correction ( Figure 4C and D). The ability of crRNA3 to reverse pathological splicing patterns was further confirmed by RNaseq ( Figure 4E and F).

[0271] The inventors further compared the degree of reversal of pathological splicing achieved by the dCas13 system and the degree of reversal of pathological splicing achieved by the antisense oligonucleotide CAG7. Using RNaseq, the inventors found that the dCas13 system was significantly superior to antisense oligonucleotides. In particular, Psp-dCas13b / crRNA3 treatment of DM1 patient-derived myoblasts completely corrected 48% of DM1-associated mis-splicing events, while only 23% correction was obtained with CAG7 treatment (Figure 5).

[0272] Example 6

[0273] C-terminal truncation of Psp-dCas13b does not affect its steric hindrance

[0274] To further investigate the utility of Psp-dCas13b as a therapeutic modality, the inventors attempted to deliver AAV9-encoded Psp-dCas13b to a mouse model of DM1. Although AAV is known to be an effective vector for gene therapy, its packaging capacity is limited to ~4.7 kb. Therefore, the relatively large size of Psp-dCas13b leaves little room for the inclusion of promoters or other regulatory sequences to control the expression pattern of Psp-dCas13b. To address this important issue, the inventors designed two C-terminally truncated variants of Psp-dCas13b and performed standard studies on the steric hindrance of the full-length protein in the context of a fluorescent reporter molecule ( Fig. 6A The inventors observed that two truncated variants of Psp-dCas13b (one with a length of 1053 amino acid residues [1053-aa] and one with a length of 984 amino acid residues [984-aa]) had comparable ribosomal steric effects and sensitivity to the length of the spacer region of the full-length variant ( Figure 6B ).

[0275] The 984-aa variant is henceforth referred to as mini-Psp-dCas13b and used in subsequent in vivo experiments.

[0276] Example 7

[0277] Psp-dCas13b reverses splicing deregulation in a DM1 mouse model

[0278] Next, the inventors packaged therapeutic AAV9 vectors encoding: (1) pEFS-driven full-length Psp-dCas13b or pCMV-driven mini-Psp-dCas13b; and (2) phU6-driven crRNA containing 21nt CAG repeats. A control AAV9 vector encoding pCMV-driven EGFP was also generated. Approximately 1×10 12Treatment or control AAV9 vector genomes (vg) were used for the study (n = 5; Fig. 7A TA muscle tissues were then collected 4 weeks after injection.

[0279] The inventors observed a modest reversal of splicing deregulation of Atp2a1, Mbnl1, Clcn1, and Ldb3 transcripts in mice injected with pEFS-driven full-length Psp-dCas13b. The inventors also observed that pCMV-driven mini-Psp-dCas13b resulted in a stronger reversal of splicing deregulation of Mbnl1 transcripts than pEFS-driven full-length Psp-dCas13b ( Figure 7B ), which may reflect the increased expression level of mini-Psp-dCas13b driven by the CMV promoter.

[0280] The intracellular dose of dCas13 plays a major role in reversing splicing lesions in vitro. In fact, when the expression level of dCas13 is too high or too low, the therapeutic effect of dCas13 is reduced. Therefore, the optimal dose of mini-Psp-dCas13b can be determined by testing a wide range of doses. For example, a dose range in which there is a 1,000-fold difference between the lowest dose and the highest dose can be tested. At the optimal dose, pCMV-driven mini-Psp-dCas13b is expected to result in a stronger reversal of splicing disorders of mouse Mbnl1, Atp2a1, Cln1 and Ldb3 transcripts, as observed in vitro (Example 5 and Figure 4).

[0281] Example 8

[0282] Psp-dCas13b reverses splicing dysregulation in a mouse model of myotonic dystrophy type 2

[0283] Given that Psp-dCas13b can reverse splicing dysregulation in the DM1 mouse model, we anticipate that Psp-dCas13b may also be useful for treating other repeat expansion diseases in which: (1) repeat expansion occurs in noncoding regions; or (2) somatic instability / RBP recruitment / RAN translation plays a role in disease pathology.

[0284] Myotonic dystrophy type 2 (DM2) is caused by an unstable CCTG tetranucleotide repeat expansion in intron 1 of the CNBP gene. In the healthy range allele, (CCTG) n The repeat sequence is usually interrupted by one or more GCTG, TCTG or ACTG motifs. However, in the expanded allele, the repeat sequence is usually uninterrupted. Similar to DM1, the repeat expansion is transcribed into toxic RNA that recruits cellular splicing factors (leading to mis-splicing of various RNA transcripts such as CLCN1, INSR, LDB3, MAPT, TNNT3; ref. 13) and produces repeat-associated small peptides.

[0285] To investigate the ability of Psp-dCas13b to reverse splicing dysregulation in DM2, therapeutic AAV9s were generated encoding: (1) pCMV-driven mini-Psp-dCas13b; and (2) phU6-driven crRNA containing 24 nt CCTG repeats. AAV9 vectors encoding pCMV-driven EGFP were also generated. After packaging these AAV9 vectors, 1 × 10 10 Up to 1×10 12 Experiments can be performed with 1 vector genome (vg) of either therapeutic or control AAV9 vector. Tissues can then be harvested 6–8 weeks after injection.

[0286] Total RNA from the samples can then be collected and the splicing patterns of biomarkers such as CLCN1, INSR, LDB3, MAPT and / or TNNT3 assessed by RT-PCR. It is expected that only samples from mice injected with the therapeutic vector will show consistent reversal of splicing dysregulation.

[0287] AAV9 vectors encoding Psp-dCas13b and crRNA are more advantageous than FDA-approved antisense oligonucleotides because: (a) delivery of AAV9-encoded transgenes allows for higher intracellular concentrations of therapeutic molecules, while delivery of sufficient ASOs to intracellular compartments has been challenging; (b) delivery of AAV9-encoded transgenes allows for the design of a one-time therapeutic strategy, while ASO treatment requires daily injections; and (c) due to the sensitivity of the Cas13 system to mismatches, Psp-dCas13b produces fewer off-target effects compared to ASOs. This is consistent with the comparative data shown in Figure 5.

[0288] Example 9

[0289] Psp-dCas13b promotes inclusion of SMN2 exon 7 in a mouse model of SMA

[0290] Psp-dCas13b has been found to sterically block the interaction of target RNA sequences with ribonucleoprotein complexes including ribosomes and miRNA silencing complexes. Therefore, Psp-dCas13b may also promote splicing switching by blocking the interaction between pre-mRNA transcripts and small nuclear ribonucleoproteins (snRNPs).

[0291] Spinal muscular atrophy (SMA) is caused by mutation or deletion of the survival motor neuron 1 (SMN1) gene, coupled with a significant skipping of SMN2 exon 7. It is known in the art that a 15 nt sequence in SMN2 intron 7, called intronic splicing silencer N1 (ISS-N1), can be targeted with antisense oligonucleotides to treat SMA.

[0292] To investigate the ability of Psp-dCas13b to promote retention of SMN2 exon 7, therapeutic AAV9 vectors can be generated encoding: (1) pCMV-driven mini-Psp-dCas13b; and (2) phU6-driven crRNA with a spacer region that includes a sequence complementary to ISS-N1 of SMN2 intron 7. AAV9 vectors encoding pCMV-driven EGFP can also be generated. After packaging these AAV9 vectors, ~1 × 10 dCas13b can be injected intrathecally into an SMA mouse model that exhibits major skipping of SMN2 exon 7. 10 – 1×10 12 Experiments were performed with 1 vector genome (vg) of either therapeutic or control AAV9 vector. Spinal cord and brain tissues were then collected 6–8 weeks after injection.

[0293] Total RNA from the samples can then be collected and RT-PCR can be used to assess the splicing pattern of SMN2. It is expected that only samples derived from mice injected with the therapeutic vector will show consistent retention of SMN2 exon 7.

[0294] Therapeutic vectors encoding Psp-dCas13b and cRNA are more advantageous than FDA-approved antisense oligonucleotides because: (a) delivery of AAV9-encoded transgenes allows for higher intracellular concentrations of therapeutic molecules, while delivery of sufficient ASOs to intracellular compartments has been challenging; (b) delivery of AAV9-encoded transgenes allows for the design of a one-time therapeutic strategy, while ASO treatment requires daily injections; and (c) due to the sensitivity of the Cas13 system to mismatches, Psp-dCas13b produces fewer off-target effects compared to ASOs. This is consistent with the comparative data shown in Figure 5.

[0295] Example 10

[0296] Psp-dCas13b reverses RNA-binding protein expression in a cellular model of Fuchs' corneal endothelial dystrophy (FECD) RBP recruits and blocks RAN translation

[0297] Given the ability of Psp-dCas13b to block RNP attachment and reverse RBP recruitment in DM1 cells and mouse models, it is likely that this paradigm can also mediate the reversal of RBP recruitment and block RAN ​​translation in Fuchs' corneal endothelial dystrophy (FECD).

[0298] FECD is an ophthalmic disease characterized by progressive loss of corneal endothelial cells, thickening of Descement's membrane, and deposition of extracellular matrix in the form of alveolar fossa. It is caused by a gene in intron 3 of the TCF4 gene (CTG) n FECD is inherited in an autosomal dominant manner and, similar to DM1, RBP recruitment and RAN translation play important roles in the pathology of the disease.

[0299] To investigate the ability of Psp-dCas13b to reverse RBP recruitment in FECD, therapeutic AAV9 can be generated encoding: (1) pCMV-driven mini-Psp-dCas13b; and (2) phU6-driven crRNA containing 24nt CCTG repeats. An AAV9 vector encoding pCMV-driven EGFP can also be generated as a control. After packaging these AAV9 vectors, experiments can be performed by transducing patient-derived corneal cells in culture. Approximately 2–4 days after transduction, cells are fixed and stained to visualize nuclear foci, indicating the presence of RBP recruitment. It is expected that only samples from mini-dCas13b-treated cells show consistent reversal of RBP recruitment.

[0300] References

[0301] 1 Zhang et al. Front Genet. 11:594576(2020).

[0302] 2 Cox et al.Science 358:6366(2017).

[0303] 3 Emeric et al., bioRxiv preprintDOI:10.1101 / 2021.05.26.445687(2007)

[0304] 4 Cunningham et al.Science 244,1081-1085(1989).

[0305] 5 Sambrook et al., Molecular Cloning: A Laboratory Manual, CSH Press1989, pp.15.3-15.108.

[0306] 6 Konermann et al., Cell 173:665-676, 2018.

[0307] 7 Cokol et al., EMBO Rep. 1(5):411-415(2000).

[0308] 8 Freitas and Cunha, Curr Genomics 10(8):550-557(2009).

[0309] 9 Slaymaker, IM et al. Cell Rep. 26, 3741-3751.e5 (2019).

[0310] 10 Ausubel (ed), Wiley Interscience, New York and the Maniatis Manual produced by Cold Spring Harbor Publishing (1999).

[0311] 11 Nakamori et al. Ann Neurol. 74(6):862-72(2013)

[0312] 12 Savkur et al.NatGenet.29(1):40-7(2001)

[0313] 13 Vihola et al. Acta Neuropathol. 119(4):465-479(2010)

[0314] Table 1 - Examples of Cas13 proteins.

[0315]

[0316]

[0317]

[0318] Table 2 - Repeat expansion diseases and example crRNA spacer sequences

[0319] disease Host genes Repeating motif Location Example crRNA spacer sequence Myotonic dystrophy type 1 DMPK CTG 3′UTR 5′-GCAGCAGCAGCAGCAGCA-3′(SEQ ID NO:73) Fuchs' endothelial corneal dystrophy TCF4 CTG Intron 5′-GCAGCAGCAGCAGCAGCA-3′(SEQ ID NO:73) Myotonic dystrophy type 2 CNBP CCTG Intron 5′-GCAGGCAGGCAGGCAGGCAGG-3′(SEQ ID NO:74) Huntington's disease-like 2 JPH3 CTG 3′UTR 5′-GCAGCAGCAGCAGCAGCA-3′(SEQ ID NO:75) C9orf72 Amyotrophic lateral sclerosis and / or frontotemporal dementia C9orf72 GGGGCC Intron 5′-GGCCCCGGCCCCGGCCCGGGCC-3′ (SEQ ID NO:76) Fragile X-associated tremor / ataxia syndrome FMR1 CGG 5′UTR 5′-GCCGCCGCCGCCCGCCGCCGCC-3′ (SEQ ID NO:77) Fragile X-associated primary ovarian insufficiency FMR1 CGG 5′UTR 5′-GCCGCCGCCGCCCGCCGCCGCC-3′ (SEQ ID NO:77) Spinocerebellar ataxia type 36 NOP56 GGCCTG Intron 5′-GCCCAGGCCCAGGCCCAGGCC-3′ (SEQ ID NO:78) Spinocerebellar ataxia type 31 BEAN1 / TK2b TGGAA / TTCCA Intron 5′-GTTAGGTTAGGTTAGGTTAGG-3′ (SEQ ID NO:79) Spinocerebellar ataxia type 10 ATXN10 ATTCT Intron 5′-GAATAGAATAGAATAGAATAG-3′ (SEQ ID NO:80)

[0320] Table 3 - Repeat Expansion Diseases

[0321]

[0322]

[0323] Sequence Listing

[0324] SEQ ID NO: 1——Peptide sequence of Psp-dCas13b

[0325]

[0326] SEQ ID NO: 2—Psp-dCas13b C-terminal truncated variant with a length of 984 amino acid residues (984-aa) The polypeptide sequence of mini-Psp-dCas13b

[0327]

[0328] SEQ ID NO:3 - C-terminal truncation of Psp-dCas13b with a length of 1053 amino acid residues (1053-aa) Variant polypeptide sequences

[0329]

[0330] SEQ ID NO:4—— Figure 2A The polynucleotide sequence of crRNA compatible with Psp-dCas13b is shown

[0331] NNNNNNNNNNGUUGUGGAAGGUCCAGUUUUAGGGGGCUAUUACAAC

[0332] SEQ ID NO:5—— Figure 3A Polynucleotide sequence of the ECFP transgene containing the miRNA target site shown

[0333] AAACCTCTACAAATGTGGTATGGCTGATTATGATCCGGATCCAAACACCGNNNNNNNNNNNNNNNNNNNNNNNGTTTTACCTGTCAGCTAGCACTCACGTGCTACCCCCTACACATTGATCCT

[0334] SEQ ID NO:6—— Figure 3A Poly(A) tail sequence of the indicated ECFP transgene

[0335] AAAAAAAAAA

[0336] SEQ ID NO:7—— Figure 4B The polynucleotide of crRNA with a 5′ scrambled spacer length of 44 nucleotides Sequence (crRNA-Scr)

[0337] GGAGACGAATAACGTTATATCCTGATTCACGTAATATCGTCTCAGUUGUGGAAGGUCCAGUUUUAGGGGGCUAUUACAAC

[0338] SEQ ID NO:8—— Figure 4B The polynucleotide sequence of the crRNA with a 5′ spacer length of 23 nucleotides is shown (crRNA1)

[0339] GAGCAGCAGCAGCAGCAGCAGCAGUUGUGGAAGGUCCAGUUUUAGGGGGCUAUUACAAC

[0340] SEQ ID NO:9—— Figure 4B The polynucleotide sequence of the crRNA with a 5′ spacer length of 31 nucleotides (crRNA2)

[0341] GAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCGUUGUGGAAGGUCCAGUUUUAGGGGGCUAUUACAAC

[0342] SEQ ID NO:10—— Figure 4B The polynucleotide sequence of the crRNA with a 5′ spacer length of 21 nucleotides (crRNA3)

[0343] GCAGCAGCAGCAGCAGCAGCA

[0344] SEQ ID NO:11 Figure 4B The polynucleotide sequence of the crRNA with a 5′ spacer length of 24 nucleotides (crRNA4)

[0345] GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGUUGUGGAAGGUCCAGUUUAGGGGGCUAUUACAAC

[0346] SEQ ID NO: 12 - polypeptide sequence of LshCas13a

[0347]

[0348] SEQ ID NO:13 - polypeptide sequence of LwaCas13a

[0349]

[0350]

[0351] SEQ ID NO: 14 - polypeptide sequence of LseCas13a

[0352]

[0353] SEQ ID NO:15 - polypeptide sequence of LmBCAS13a

[0354]

[0355] SEQ ID NO: 16 - polypeptide sequence of LnCas13a

[0356]

[0357] SEQ ID NO: 17 - CamCAS13a polypeptide sequence

[0358]

[0359] SEQ ID NO: 18 - polypeptide sequence of CgaCas13a

[0360]

[0361] SEQ ID NO: 19 - polypeptide sequence of Cga2Cas13a

[0362]

[0363]

[0364] SEQ ID NO:20 - PprCas13a polypeptide sequence

[0365]

[0366] SEQ ID NO:21 - polypeptide sequence of LweCas13a

[0367]

[0368] SEQ ID NO:22 - polypeptide sequence of Lwa2Cas13a

[0369]

[0370] SEQ ID NO:23 - polypeptide sequence of LbfCas13a

[0371]

[0372] SEQ ID NO:24 - Peptide sequence of RcsCas13a

[0373]

[0374] SEQ ID NO:25 - Peptide sequence of RcrCas13a

[0375]

[0376]

[0377] SEQ ID NO:26 - Peptide sequence of RcdCas13a

[0378]

[0379] SEQ ID NO:27 - polypeptide sequence of LbuCas13a

[0380]

[0381] SEQ ID NO:28——Polypeptide sequence of HheCas13a

[0382]

[0383] SEQ ID NO:29——Peptide sequence of EreCas13a

[0384]

[0385] SEQ ID NO:30 - polypeptide sequence of EbaCas13a

[0386]

[0387] SEQ ID NO: 31 - polypeptide sequence of BmaCas13a

[0388]

[0389]

[0390] SEQ ID NO:32 - polypeptide sequence of LspCas13a

[0391]

[0392] SEQ ID NO:33 - polypeptide sequence of BzoCas13b

[0393]

[0394] SEQ ID NO:34 - polypeptide sequence of PinCas13b

[0395]

[0396] SEQ ID NO:35 - Peptide sequence of PbuCas13b

[0397]

[0398] SEQ ID NO:36 - polypeptide sequence of AspCAS13b

[0399]

[0400] SEQ ID NO:37 - Peptide sequence of PsmCas13b

[0401]

[0402] SEQ ID NO:38 - polypeptide sequence of RanCas13b

[0403]

[0404] SEQ ID NO:39——PauCas13 b The peptide sequence

[0405]

[0406] SEQ ID NO:40 - Peptide sequence of PsaCas13b

[0407]

[0408] SEQ ID NO:41 - polypeptide sequence of Pin2Cas13b

[0409]

[0410] SEQ ID NO:42 - polypeptide sequence of CcaCas13b

[0411]

[0412] SEQ ID NO:43 - Peptide sequence of PguCas13b

[0413]

[0414] SEQ ID NO:44 - Peptide sequence of PspCas13b

[0415]

[0416]

[0417] SEQ ID NO:45 - polypeptide sequence of FbrCas13b

[0418]

[0419] SEQ ID NO:46 - Peptide sequence of PgiCas13b

[0420]

[0421] SEQ ID NO:47 - polypeptide sequence of Pin3Cas13b

[0422]

[0423] SEQ ID NO:48 - polypeptide sequence of Cas13bt1

[0424]

[0425] SEQ ID NO:49——Cas13bt 2 The peptide sequence

[0426]

[0427] SEQ ID NO:50——Polypeptide sequence of Cas13bt3

[0428]

[0429] SEQ ID NO:51 - polypeptide sequence of Cas13bt4

[0430]

[0431] SEQ ID NO:52 - polypeptide sequence of Cas13bt5

[0432]

[0433] SEQ ID NO:53 - polypeptide sequence of Cas13bt6

[0434]

[0435] SEQ ID NO:54 - polypeptide sequence of Cas13bt7

[0436]

[0437] SEQ ID NO:55 - polypeptide sequence of Cas13bt8

[0438]

[0439] SEQ ID NO:56 - polypeptide sequence of Cas13bt9

[0440]

[0441] SEQ ID NO:57 - polypeptide sequence of Cas13bt10

[0442]

[0443] SEQ ID NO:58 - polypeptide sequence of Cas13bt11

[0444]

[0445] SEQ ID NO:59 - polypeptide sequence of Cas13bt12

[0446]

[0447] SEQ ID NO:60——Polypeptide sequence of Cas13bt14

[0448]

[0449]

[0450] SEQ ID NO:61——Cas13bt1 5 The peptide sequence

[0451]

[0452] SEQ ID NO:62——Polypeptide sequence of Cas13bt16

[0453]

[0454] SEQ ID NO:63——Peptide sequence of FnsCas13c

[0455]

[0456] SEQ ID NO:64——Peptide sequence of FndCas13c

[0457]

[0458] SEQ ID NO:65 - polypeptide sequence of FnbCas13c

[0459]

[0460] SEQ ID NO:66——Peptide sequence of FnfCas13c

[0461]

[0462] SEQ ID NO:67 - polypeptide sequence of FpeCas13c

[0463]

[0464] SEQ ID NO:68 - polypeptide sequence of FulCas13c

[0465]

[0466] SEQ ID NO:69 - polypeptide sequence of AspBus13c

[0467]

[0468] SEQ ID NO:70—Nuclear localization signal

[0469] PKKKRRV

[0470] SEQ ID NO:71—Nuclear localization signal

[0471] KRPAATKKAGQAKKKK

[0472] SEQ ID NO:72—Kozak sequence

[0473] GCCGCCRCCAUGG

[0474] SEQ ID NO:73 - crRNA spacer sequence for targeting myotonic dystrophy type 1 and Fuchs angle Membrane endothelial dystrophy repeat motif

[0475] GCAGCAGCAGCAGCAGCAGCA

[0476] SEQ ID NO:74—crRNA spacer sequence, repeat motif for targeting myotonic dystrophy type 2

[0477] GCAGGCAGGCAGGCAGGCAGG

[0478] SEQ ID NO:75—crRNA spacer sequence for targeting the Huntington's disease-like 2 repeat motif

[0479] GCAGCAGCAGCAGCAGCAGCA

[0480] SEQ ID NO:76 - Repeated motif for targeting C9orf72 in amyotrophic lateral sclerosis and / or frontotemporal dementia crRNA spacer sequence

[0481] GGCCCCGGCCCGGCCCCGGCC

[0482] SEQ ID NO:-77 - for targeting fragile X-associated tremor / ataxia syndrome and fragile X-associated primary crRNA spacer sequence of the repeat motif of sexual ovarian insufficiency

[0483] GCCGCCGCCGCCGCCGCCGCC

[0484] SEQ ID NO:79 - crRNA spacer for repeat motif targeting spinocerebellar ataxia type 36 sequence

[0485] GCCCAGGCCCAGGCCCAGGCC

[0486] SEQ ID NO:79 - crRNA spacer for repeat motif targeting spinocerebellar ataxia type 31 sequence

[0487] GTTAGGTTAGGTTAGGTTAGG

[0488] SEQ ID NO:79 - crRNA spacer for repeat motif targeting spinocerebellar ataxia type 10 sequence

[0489] GAATAGAATAGAATAGAATAG

[0490] SEQ ID NO:81—Repeat motif of Winfrich-Lunderberg disease

[0491] CCCCGCCCCGCG

[0492] SEQ ID NO:82 - His tag

[0493] HHHHHHH

Claims

1. A method for regulating the function of a regulatory element in a target RNA, comprising delivering a catalytically inactive Cas13 protein (dCas13) and CRISPR RNA (crRNA) to a cell, wherein the crRNA recruits the dCas13 protein to the regulatory element, thereby regulating the function of the regulatory element.

2. The method of claim 1, wherein the Cas13 protein is a member of a Cas13b family, a Cas13a family, a Cas13d family, a Cas13X family, a Cas13Y family, or a Cas13bt family.

3. The method of claim 2, wherein the Cas13 protein is: (a) PspCas13b, RfxCas13d, LwaCas13a, Pgu13b, PgiCas13b, Cas13X.1, Cas13X.2, PinCas13b, Cas13Y.1, Cas13Y.2, Cas13Y.3, AdmCas13d, LbmCas13a, LbfCas13a, LbuCas13a, HheCas13a, Cas13bt1, or Cas13bt3; (b)PspCas13b, RfxCas13d, LwaCas13a, PguCas13b, PgiCas13b, Cas13X.1, Cas13X.2, PinCas13b, Cas 13Y.1, Cas13Y.2, AdmCas13d, LbmCas13a, LbfCas13a, LbuCas13a, HheCas13a, Cas13bt1, or Cas13bt3; or (c) PspCas13b.

4. The method of claim 2 or 3, wherein the Cas13 protein is PspCas13b.

5. A method as described in any of the preceding claims, wherein the dCas13 protein comprises a mutation in one or more amino acid residues in the RxxxxH motif of the HEPN-1 domain and the RxxxxH motif of the HEPN-2 domain relative to the corresponding unmodified Cas13 protein.

6. A method as claimed in any of the preceding claims, wherein the dCas13 protein comprises or consists of an amino acid sequence having ≥85% sequence identity with SEQ ID NO: 1, provided that the amino acid residues 133 and 1058 corresponding to SEQ ID NO: 1 are not histidine, for example, they are both alanine.

7. A method as described in any of the preceding claims, wherein the dCas13 protein is truncated by ≤110 amino acid residues from the C-terminus compared to the unmodified protein, and optionally wherein the Cas13 protein of the dCas13 protein is a member of the Cas13b family, such as PspCas13b.

8. The method of claim 7, wherein the dCas13 protein comprises or consists of an amino acid sequence having ≥85% sequence identity with SEQ ID NO: 2 or 3, provided that the amino acid residue corresponding to amino acid residue 133 of SEQ ID NO: 2 or 3 is not histidine, for example, alanine.

9. A method as described in any of the preceding claims, wherein the crRNA includes a dCas13-specific direct repeat and a spacer region that can specifically hybridize with a target RNA sequence.

10. The method of claim 9, wherein the crRNA includes dCas13b-specific direct repeats and the spacer has a length of 12 to 36 nucleotides, 12 to 27 nucleotides, or 18 to 24 nucleotides, for example, the crRNA includes or consists of any one of SEQ ID NO: 4, 7 to 11, or 73 to 80.

11. The method of any preceding claim, wherein the regulatory element is: (a) a cis-regulatory element, such as a splicing element, or (b) a trans-regulatory element, such as a protein binding site or a nucleic acid binding site.

12. The method of claim 11, wherein: (a) the protein binding site is a repeat expansion sequence, the start codon of an open reading frame, the start codon of an upstream open reading frame (uORF), or a snRNP binding site; or (b) The nucleic acid binding site is a miRNA binding site.

13. A method for regulating the availability, expression and / or activity of a target nucleic acid or protein, comprising regulating the function of a regulatory element in a target RNA according to the method of any of the preceding claims, wherein the target RNA encodes or regulates the target nucleic acid or protein such that the availability, expression and / or activity of the target nucleic acid or protein is increased or decreased.

14. A method for blocking miRNA binding sites, comprising regulating the function of a regulatory element in a target RNA according to any one of claims 1 to 12, or regulating the availability, expression and / or activity of a target nucleic acid or protein according to the method of claim 13, wherein the crRNA comprises a spacer region complementary to the miRNA binding site, so that miRNA-mediated silencing of the target RNA is reduced.

15. A method for blocking ribosome attachment or translation, comprising regulating the function of a regulatory element in a target RNA according to any one of claims 1 to 12, or regulating the availability, expression and / or activity of a target nucleic acid or protein according to the method of claim 13, wherein the crRNA comprises a spacer region complementary to the start codon of an open reading frame or the start codon of an upstream open reading frame (uORF), such that translation of the target RNA is reduced.

16. A method for inducing splicing switching, comprising regulating the function of a regulatory element in a target RNA according to any one of claims 1 to 12, or regulating the availability, expression and / or activity of a target nucleic acid or protein according to the method of claim 13, wherein the crRNA comprises a spacer region complementary to a splicing element, such as an RNP binding site, so that the splicing of the target RNA is regulated.

17. A dCas13b-specific crRNA, comprising: (i) a dCas13b-specific direct repeat, and (ii) a spacer region that is capable of specifically hybridizing to a target RNA sequence and has a length between 18 and 24 nucleotides.

18. A dCas13b protein consisting of an amino acid sequence having ≥85% sequence identity with SEQ ID NO: 2 or 3, provided that the amino acid residue corresponding to amino acid residue 133 of SEQ ID NO: 2 or 3 is alanine.

19. A polynucleotide or vector encoding the crRNA according to claim 17 or the dCas13b protein according to claim 18, optionally wherein the vector is AAV or a lentivirus.

20. A delivery vehicle comprising the crRNA according to claim 17, the dCas13b protein according to claim 18, or the polynucleotide or vector according to claim 19.

21. A pharmaceutical composition comprising: (i) crRNA according to claim 17 or dCas13b protein according to claim 18, and (ii) a pharmaceutically acceptable carrier.

22. The crRNA of claim 17 or the dCas13b protein of claim 18, for use in a therapeutic method implemented on the human or animal body.

23. The crRNA of claim 17, for use in a method for treating a repeat expansion disease, optionally wherein the expansion disease is myotonic dystrophy type 1 (DM1), myotonic dystrophy type 2, or Fuchs' corneal endothelial dystrophy.

24. A method for treating or preventing a repeat expansion disease in a subject, wherein the method comprises administering to the subject a therapeutically effective amount of a dCas13 protein and a crRNA, wherein the method comprises regulating the function of a regulatory element in a nucleic acid as described in any one of claims 1 to 12, or regulating the availability, expression and / or activity of a target nucleic acid or protein as described in claim 13, wherein the crRNA comprises a spacer region complementary to an expanded repeat sequence, and optionally wherein the expansion disease is myotonic dystrophy type 1 (DM1), myotonic dystrophy type 2, or Fuchs' corneal endothelial dystrophy.

25. A dCas13 protein for use in a method for treating a repeat expansion disease, wherein the method comprises administering a therapeutically effective amount of a dCas13 protein and a crRNA to a subject, wherein the method comprises regulating the function of a regulatory element in a nucleic acid as described in any one of claims 1 to 12, or regulating the availability, expression and / or activity of a target nucleic acid or protein as described in claim 13, wherein the crRNA comprises a spacer region complementary to the expanded repeat sequence, and optionally wherein the expansion disease is myotonic dystrophy type 1 (DM1), myotonic dystrophy type 2, or Fuchs' corneal endothelial dystrophy.

26. Use of crRNA according to claim 23, the method according to claim 24, or the dCas13 protein according to claim 25, wherein the Cas13 protein is a member of the Cas13b family, and optionally wherein the dCas13 protein comprises or consists of an amino acid sequence having ≥85% sequence identity with SEQ ID NO: 2 or 3, provided that the amino acid residue corresponding to amino acid residue 133 of SEQ ID NO: 2 or 3 is alanine.

Images