Application of ClWRKY61 gene in affecting fruit size and development in watermelon
By editing the watermelon ClWRKY61 gene using CRISPR/Cas9 technology, fruit size regulation was achieved, solving the problem of insufficient genetic basis for watermelon fruit size variation and providing genetic resources to support the targeted improvement of fruit size and the breeding of new varieties.
Patent Information
- Application Number
- CN202411659362.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-20
- Publication Date
- 2025-09-19
- Estimated Expiration
- 2044-11-20
AI Technical Summary
Currently, little is known about the genetic basis and regulatory gene functions of watermelon fruit size variation, which limits the targeted improvement of watermelon fruit size at the molecular level.
By overexpressing or knocking out the watermelon ClWRKY61 gene and using CRISPR/Cas9 technology to edit the watermelon genome, fruit size can be regulated. Recombinant vectors and recombinant microorganisms are constructed for genetic transformation to obtain watermelon plants with enlarged or reduced fruit.
The biological function of the ClWRKY61 gene in fruit size development has been clarified, providing genetic resources for the creation of new germplasms with different fruit shapes and the breeding of new characteristic varieties to meet the diversified market needs.
Smart Images

Figure CN119506300B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of molecular biology, and more particularly to application of the watermelon ClWRKY61 gene in influencing fruit size development. Background Art
[0002] The WRKY transcription factor (TF) family is one of the largest in higher plants and plays a key regulatory role in plant adaptation to abiotic stress. This family is characterized by a highly conserved WRKYGQK motif and a C2H2 or C2HC zinc finger structure. This conserved structure enables it to bind to the W-box, whose sequence is (C / T)TGAC(T / C). Based on the number of WRKY domains and zinc finger structures, WRKY TFs are divided into subfamilies I, II, and III, with subfamily II further divided into IIa, IIb, IIc, IId, and IIe. Numerous members of the WRKY family, such as AhWRKY75 in peanut, GhWRKY17 in cotton, TaWRKY75-A in wheat, and SlWRKY8 in tomato, have been found to be induced by salt stress. This suggests that WRKY TFs may play an important role in plant resistance to salt stress.
[0003] Watermelon (Citrullus lanatus), an annual climbing herbaceous plant belonging to the Cucurbitaceae family, is an important horticultural crop, widely cultivated worldwide. Its fruit is primarily eaten fresh, but can also be used for winemaking, feed, and other purposes. In 2022, my country's watermelon planting area reached approximately 22.2723 million mu (approximately 1.6 million hectares), accounting for 7% of the global vegetable production area, with a production of approximately 63.0231 million tons. Fruit size is a crucial agronomic trait in watermelon. With rising living standards, consumers in different regions have shown varying preferences for watermelon shapes and sizes. However, little is known about the genetic basis of fruit size variation in watermelon and the functions of the genes that regulate it, limiting targeted improvement of fruit size at the molecular level. Therefore, identifying genes that regulate fruit size in watermelon not only provides theoretical insights for the targeted improvement of superior germplasm but also provides technical support for the selection and breeding of distinctive new varieties.
[0004] Therefore, providing an application of the watermelon ClWRKY61 gene in influencing fruit size development is an urgent problem to be solved by those skilled in the art. Summary of the Invention
[0005] In view of this, the present invention provides an application of the ClWRKY61 gene in watermelon in influencing fruit size development.
[0006] In order to achieve the above object, the present invention adopts the following technical solutions:
[0007] The invention discloses an application of the ClWRKY61 gene in influencing fruit size and development in watermelon. The nucleotide sequence of the ClWRKY61 gene is shown in SEQ ID NO.1.
[0008] Furthermore, the watermelon ClWRKY61 gene is used in positively regulating fruit size development. The nucleotide sequence of the ClWRKY61 gene is shown in SEQ ID NO.1.
[0009] Furthermore, the use of a biological material overexpressing the watermelon ClWRKY61 gene in increasing the size of watermelon fruit, wherein the nucleotide sequence of the ClWRKY61 gene is shown in SEQ ID NO.1;
[0010] The biological material is any one of the following:
[0011] A: Expression cassette capable of overexpressing the ClWRKY61 gene;
[0012] B: recombinant vector containing the expression cassette described in A;
[0013] C: A recombinant microorganism containing the expression cassette described in A or the recombinant vector described in B.
[0014] Furthermore, the use of a biomaterial overexpressing the watermelon ClWRKY61 gene in increasing the longitudinal diameter of watermelon, wherein the nucleotide sequence of the ClWRKY61 gene is shown in SEQ ID NO.1;
[0015] The biological material is any one of the following:
[0016] A: Expression cassette capable of overexpressing the ClWRKY61 gene;
[0017] B: recombinant vector containing the expression cassette described in A;
[0018] C: A recombinant microorganism containing the expression cassette described in A or the recombinant vector described in B.
[0019] Furthermore, the use of a biological material with the ClWRKY61 gene knocked out in watermelon to reduce the size of watermelon fruit is characterized in that the nucleotide sequence of the ClWRKY61 gene is shown in SEQ ID NO.1;
[0020] The biological material is any one of the following:
[0021] A: expression cassette capable of silencing the ClWRKY61 gene;
[0022] B: recombinant vector containing the expression cassette described in A;
[0023] C: A recombinant microorganism containing the expression cassette described in A or the recombinant vector described in B.
[0024] Furthermore, the use of a biological material with the ClWRKY61 gene knocked out in watermelon to reduce the longitudinal diameter of watermelon is characterized in that the nucleotide sequence of the ClWRKY61 gene is shown in SEQ ID NO.1;
[0025] The biological material is any one of the following:
[0026] A: expression cassette capable of silencing the ClWRKY61 gene;
[0027] B: recombinant vector containing the expression cassette described in A;
[0028] C: A recombinant microorganism containing the expression cassette described in A or the recombinant vector described in B.
[0029] Furthermore, the watermelon ClWRKY61 gene is used in watermelon fruit size breeding, and the nucleotide sequence of the ClWRKY61 gene is shown in SEQ ID NO.1.
[0030] As can be seen from the above technical solutions, compared with the prior art, the present invention provides the application of the ClWRKY61 gene in influencing fruit size development in watermelon. The present invention discovered a watermelon WRKY transcription factor, ClWRKY61. Furthermore, it was found that compared to the wild-type (WT), the fruit of ClWRKY61 knockout lines was significantly smaller, while the fruit of ClWRKY61 overexpression lines was significantly larger. This indicates that the ClWRKY61 transcription factor is a positive regulator of watermelon fruit enlargement. This gene can provide genetic resources for the creation of new germplasms with different fruit shapes and the selection of distinctive new varieties, while meeting the market demand for diversified watermelon fruit shapes, and has extremely important scientific and production application significance. BRIEF DESCRIPTION OF THE DRAWINGS
[0031] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are merely embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying any creative work.
[0032] Figure 1 The accompanying drawings are schematic diagrams of the ClWRKY61 gene structure, target site structure, and edited strain sequence information of the present invention;
[0033] Figure 2 The accompanying figure shows the expression level of the gene ClWRKY61 in the overexpression strain OEWRKY61 of the present invention;
[0034] Figure 3The accompanying drawings show the fruit size phenotypes of the ClWRKY61 knockout and overexpression strains of the present invention;
[0035] Among them, A: WT; B: CR-WRKY61; C: OEWRKY61;
[0036] Figure 4 The accompanying figure shows the longitudinal diameter analysis of fruits of the ClWRKY61 knockout and overexpression strains of the present invention. DETAILED DESCRIPTION
[0037] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.
[0038] CDS sequence of ClWRKY61:
[0039] ATGGATTGTTCCTGGCCTGACACCACGCCCTCCGATCGAAGAAAAGCAGCCGACGAACTGCTTCGTGGCCGTGAACTTGCACAACAACTACGAGCCTATCTACA GAGAACTTCCAATTCCGGT GGGACGGCTCCCAAGATCTGCTCTCCAGAATCCTAACCTCTTTCTCAAAACACTTTCCATCTTGAATCGCTGCGACTCCGATGACATAAATGGCTCTATTGTGGATTCACCCGAGGATCG TGCTAGTAGAAAATCCCAGGAATCTGGGGACAGTTGCAAGAGTCCCGATCGCAGGGGTTGCTATAAGAGAAGAAAGAGTTGCCAGAGTTGGGCGAGAGAGCTGCAGCCTGGTGGACGATGG GCAC GCGTGGAGGAAGTACGGGCAGAAGACCATTCTAAATGCGAAATACCCAAGAAACTATTACAGATGCACCCACAAATTCGACCAGGCCTGCCAAGCCACAAAGCAAGTCCAGCGACTGCAAGACCATCCCAAAATTCCGTACTACTTATTATGGCCATCACACCTGCTCCAATTTCCTCAAAGCTTCCGACATCGTGCTCGGCTCCTCCAATTTCGACGATTCCTGCGGAGTGCTCCT CAGTTTTGACACCCCCGCCGCACCCAACTTTTTACTCCAACAGGATGCTATGTTGGTCAAGAAGGAAGTTGCAATCGCCGAAAGCAGGGATGATGAGGCCGTATGTTCCCCCTCCGACTACATTAGTACGGCCGAGCCCTCGCCCGACGACCATCTCTCCGAGGTTTTCATGGGTTCCGTCGTCGACTTTGAGGATGATGTTTTACAATTCCAGTTTTGA; SEQ. ID NO.1.
[0040] Example 1 Construction of CRISPR / Cas9 editing vector PBSE402-ClWRKY61
[0041] 1) Editing site selection of gene ClWRKY61
[0042] Based on the CDS sequence of ClWRKY61 (shown in SEQ ID NO. 1) and the online target site design website CRISPR-P (http: / / crispr.hzau.edu.cn / CRISPR2 / news.php, V2), two target sites (Target1 and Target2) were designed. Target 1 and Target 2 are located in the first and second exons of the ClWRKY61 gene, respectively.
[0043] Target1 sequence: GAGAACTTCCAATTCCGGT; SEQ ID NO.2;
[0044] Target2 sequence: GTACTTCCTCCACGCGTGC; SEQ ID NO. 3.
[0045] 2) Construction of CRISPR / Cas9 editing vector
[0046] (1) PCR amplification:
[0047] Adaptor primers Target1F / Target2R were synthesized based on the two target sequence sets described above. PCR amplification was performed using the high-fidelity enzyme PrimeStarMax Premix (TaKaRa) using a 100-fold diluted intermediate vector pCBC-DT1T2 as a template. The amplification system consisted of 25 μL of PrimeStarMax Premix (2×), 2.5 μL of template, 2.5 μL of each upstream and downstream primer, and 17.5 μL of ddH2O. The PCR reaction program was as follows: 38 cycles of 98°C for 10 s, 58°C for 5 s, and 72°C for 15 s, followed by 72°C for 5 min.
[0048] The target sequence adapter primers (underlined target sequence) are as follows:
[0049] Target1 sequence primer: Target1F
[0050] ATATATGGTCTCGATTG GAGAACTTCCAATTCCGGT GTTTTAGAGC TAGAAATAGC;SEQ IDNO.4;
[0051] Target2 sequence primer: Target2R
[0052] ATTATTGGTCTCGAAAC GTACTTCCTCCACGCGTGC CAATCTCTTA GTCGACTCTAC; SEQ ID NO.5.
[0053] (2) Vector digestion:
[0054] The CRISPR / Cas9 vector PBSE402 was digested with the restriction endonuclease BsaI (NEWENGLAND BioLabs). The digestion system consisted of 2 μg of PBSE402, 5 μL of CutSmart buffer, 1 μL of BsaI, and 50 μL of ddH2O. Digestion was performed at 37°C for 2 h. After electrophoresis, the fragments were recovered from the gel.
[0055] Ligation of PCR product with vector: Ligate the PCR product with the digested vector PBSE402 by homologous recombination. The ligation system is: vector to insert ratio approximately 1:2; 4 μL of 5× reaction buffer; 1 μL of NovoRec Plus recombinase; and ddH2O to a volume of 20 μL. Ligate at 50°C for 10 min.
[0056] (3) Recombinant plasmid transformation:
[0057] Heat shock transform 5 μl of the ligation product into competent E. coli DH5a, plate onto LB solid culture plates containing 50 mg / L kanamycin, and incubate overnight at 37°C. Positive colonies were detected using primers U626-IDF / U629-IDR.
[0058] The specific primer sequences are as follows:
[0059] U626-IDF: TGTCCCAGGATTAGAATGATTAGGC; SEQ ID NO.6;
[0060] U629-IDR: AGCCCTCTCTCTTTCGATCCATCAAC; SEQ ID NO.7.
[0061] After sequencing was correct, the recombinant plasmid was extracted and transformed into Agrobacterium competent cells EHA105. After PCR verification, it was used for watermelon genetic transformation. The Agrobacterium transformation steps are as follows:
[0062] Add 1 μl of the recombinant plasmid to competent Agrobacterium tumefaciens EHA105 cells, place in an ice box for 5 minutes, then quickly freeze in liquid nitrogen for 5 minutes. Place in a 37°C water bath for 5 minutes. Add 400 μl of antibiotic-free culture medium to each tube for resuscitation. Transfer the tube to a shaker at 200 rpm and 28°C for shaking. Plate 100 μl of the resuscitated bacterial solution onto LB solid medium containing antibiotics and air-dry at room temperature. Once the bacterial solution has been fully absorbed, invert the culture dish and culture in a 28°C incubator for 2-3 days.
[0063] Example 2 Construction of overexpression vector pCAMBIA1305-ClWRKY61
[0064] (1) PCR amplification:
[0065] Specific primers OE-ClWRKY61-F / R were designed based on the reference sequence of ClWRKY61. The cDNA of watermelon germplasm 'YL' was used as a template and PCR amplification was performed with the high-fidelity enzyme PrimeStarMax Premix (TaKaRa).
[0066] The specific primer sequences are as follows:
[0067] OE-ClWRKY61-F:
[0068] ACGGGGGACTCTAGAGGATCC ATGGATTGTTCCTGGCCT ; SEQ ID NO.8;
[0069] OE-ClWRKY61-R:
[0070] CACCAATTCACACGTGTTAGTGGTGGTGGTGGTGGTG AAACTGGA ATTGTAAAACATCA ;SEQ ID NO.9.
[0071] The amplification system consisted of 25 μL of PrimeStarMax Premix (2×), 2.5 μL of template, 2.5 μL of upstream and downstream primers, and 17.5 μL of ddH₂O. The PCR reaction program was as follows: 38 cycles of 98°C for 10 s, 58°C for 5 s, and 72°C for 15 s, followed by 72°C for 5 min. After PCR completion, 5 μL of 10× loading buffer was added to the reaction mixture. An agarose gel was then prepared and electrophoresed. The correct bands were detected, and the PCR product was recovered using a DNA purification kit (Tiangen).
[0072] (2) Vector digestion:
[0073] The overexpression vector pCAMBIA1305 was digested with restriction endonucleases BamHI and PmlI (NEWENGLAND BioLabs). The digestion system was: 4 μg of pCAMBIA1305, 5 μL of CutSmart buffer, 1 μL of BamHI, 1 μL of PmlI, and 50 μL of ddH2O. Digestion was performed at 37°C for 2 h. After electrophoresis, the fragments were recovered from the gel.
[0074] Ligation of PCR product with vector: Ligate the PCR product with the digested vector pCAMBIA1305 by homologous recombination. The ligation system is: vector to insert ratio approximately 1:2; 4 μL of 5× reaction buffer; 1 μL of NovoRec Plus recombinase; and ddH2O to a volume of 20 μL. Ligate at 50°C for 10 min.
[0075] (3) Recombinant plasmid transformation:
[0076] 5 μl of the ligation product was heat-shock transformed into competent E. coli DH5a, plated onto LB solid culture plates containing 50 mg / L kanamycin, and cultured overnight at 37°C. Colonies were tested for positive results using gene-specific primers OE-ClWRKY61-F / R. After sequencing, the recombinant plasmid was extracted and transformed into competent Agrobacterium tumefaciens EHA105 cells. After PCR verification, it was used for genetic transformation of watermelon. The Agrobacterium transformation steps are as follows:
[0077] Add 1 μl of the recombinant plasmid to competent Agrobacterium tumefaciens EHA105 cells, place in an ice box for 5 minutes, then quickly freeze in liquid nitrogen for 5 minutes. Place in a 37°C water bath for 5 minutes. Add 400 μl of antibiotic-free culture medium to each tube for resuscitation. Transfer the tube to a shaker at 200 rpm and 28°C for shaking. Plate 100 μl of the resuscitated bacterial solution onto LB solid medium containing antibiotics and air-dry at room temperature. Once the bacterial solution has been fully absorbed, invert the culture dish and culture in a 28°C incubator for 2-3 days.
[0078] Example 3
[0079] 1) Watermelon genetic transformation:
[0080] Plump seeds of the watermelon germplasm 'YL' were soaked in distilled water at 50-55°C for approximately 30 minutes, then the husks were removed. The peeled kernels were washed in 75% alcohol for approximately 30 seconds in a laminar flow hood, rinsed twice with sterile water, and then disinfected by soaking in 3% sodium hypochlorite for 15 minutes. After rinsing again with sterile water 5-7 times, the seeds were air-dried and sown on MS solid culture medium and incubated in the dark at 25°C for 3 days.
[0081] After the seeds germinate, remove them, cut off the ends of the cotyledons, and divide the remaining cotyledons into 8 pieces for easy infection. During this period, single colonies of EHA105 containing the CRISPR / Cas9 vector PBSE402-ClWRKY61 and the overexpression vector pCAMBIA1305-ClWRKY61 were picked into LB liquid medium containing 50 mg / L kanamycin and 20 mg / L rifampicin, and the bacterial solution was shaken until the OD 600 =0.8, resuspend the bacterial solution in MS culture medium (MS5194.43g / L, sucrose 30g / L, 6-BA 1.5mg / L) to a final concentration of OD 600 = 0.2 to obtain a bacterial suspension. The cut cotyledons were soaked in the bacterial suspension for 15 minutes, removed and air-dried, and then co-cultured in a co-culture medium (CM: MS519 4.43 g / L, sucrose 30 g / L, G3251 (PhytoTech Labs) 3 g / L, 6-BA 1.5 mg / L) lined with filter paper at 25°C in the dark for 3 days.
[0082] After 3 days of co-cultivation, the cotyledonary blocks were removed and washed with sterile water to remove excess Agrobacterium liquid on the surface (washed about 5-7 times) until the sterile water was clear. After being taken out and dried, they were placed on recovery medium (RM: MS5194.43 g / L, sucrose 30 g / L, G32513 g / L, 6-BA 1.5 mg / L, 200 mg / L Timentin) for recovery culture and cultured at 28°C for 7 days.
[0083] After 7 days, the cotyledons that recovered were transferred to MS medium (selective medium SM) containing 1.5 mg / L 6-BA, 200 mg / L Timentin, and 1.4 mg / L Basta for selection culture. The culture was subcultured at 28°C for 3-4 weeks, with subculture every 7 days. Explants with obvious buds were then transferred to shoot elongation medium (containing 4.43 g / L MS524, 30 g / L sucrose, 3 g / L LG3251, 1 g / L inositol, 500 μL / L SH organic solution, 0.01 mg / L NAA, 0.1 mg / L 6-BA, 200 mg / L Timentin, and 1.4 mg / L Basta) under the conditions of 28°C, 8 h / d of darkness, 16 h / d of light, and a light intensity of 8000 Lx. The selected buds were cut off (note that the incision should not contain callus), and transferred to MS medium containing 0.5 mg / L IBA and 200 mg / L Timentin for rooting culture at 28°C until rooting.
[0084] SH organic solution contains 10g / L nicotinic acid, 10g / L VB1, and 1g / L VB6.
[0085] When the regenerated seedlings have roots and grow to 4-5 true leaves, take them out of the culture bottle, slowly rinse off the culture medium on the roots with clean water, transplant them into a substrate that has been sterilized at high temperature and high pressure in advance, water them thoroughly and keep them warm and moist. After 3-4 days, you will see water droplets on the hole tray cover, and gradually open the cover to harden the seedlings.
[0086] 2) Detection of gene-edited plants:
[0087] The PBSE402 vector carries a GFP fluorescent tag, and the CTAB method was used to extract the DNA of the GFP-fluorescent watermelon regenerated seedlings. The steps were as follows: a small number of young leaves were quickly ground into powder in liquid nitrogen and placed in a 1.5 ml centrifuge tube; 800 μl of preheated CTAB extraction buffer was added and the tube was incubated in a 65°C waterbath for 30 min; an equal volume of chloroform / isoamyl alcohol was added, where the volume ratio of chloroform to isoamyl alcohol was 24:1, the tube was mixed, and the tube was centrifuged at 8000 rpm for 10 min; the supernatant was transferred to a new centrifuge tube, 2 / 3 of the volume of isopropanol was added, and the tube was gently mixed by inverting; the tube was centrifuged at 10000 rpm for 10 min; the supernatant was discarded, and the precipitate was rinsed twice with 75% ethanol by volume, the remaining liquid was discarded, and the tube was dried and dried for 3 min. The tube was then dissolved in 100 μl of ddH2O (containing 0.1% RNase) and stored at 4°C for later use.
[0088] Using the extracted DNA as a template, the edited lines used target 1 primers CRJC-W61F / R to perform PCR amplification on the sequences of the two target sites respectively. The positive control was the recombinant plasmid, and the negative control was the non-transgenic plant DNA.
[0089] The specific primer sequences are as follows:
[0090] CRJC-W61F: ATGGATTGTTCCTGGCCTGA; SEQ ID NO.10;
[0091] CRJC-W61R: TCAAAACTGGAATTGTAAAACATCA; SEQ ID NO.11.
[0092] The amplification system was: 2× Taq PCR StarMix with loading dye 10 μL, template 1 μL, upstream and downstream primers 1 μL each, ddH2O 7 μL. The PCR reaction program was: 94°C for 3 minutes; 94°C for 30 seconds, 58°C for 30 seconds, 72°C for 1 minute, 30 cycles; 72°C for 5 minutes. PCR products were recovered based on band size and TA cloned. After positive PCR test results were obtained, clones were selected and sent for testing to confirm the editing event. Results are shown in the table. Figure 1 A total of two gene-edited plants, crwrky61-1 and crwrky61-2, were obtained, with 264bp and 265bp deleted between Target1 and Target2, respectively.
[0093] 3) Detection of overexpression plants:
[0094] Using the cDNA reverse transcribed from the extracted RNA as a template, the expression level of the overexpression strain was detected using primers qRTPCR-ClWRKY61-F / R.
[0095] The specific primer sequences are as follows:
[0096] qRTPCR-ClWRKY61-F:TCGTGCTCGGCTCCTCCAAT; SEQ ID NO.12;
[0097] qRTPCR-ClWRKY61-R: TCATCCCTGCTTCGGCGATTG; SEQ ID NO. 13.
[0098] See the results Figure 2 , a total of one overexpression line OEWRKY61 was obtained. qRT-PCR analysis showed that the expression level of gene ClWRKY61 in the overexpression line OEWRKY61 was significantly higher than that in the wild-type plant (about 27 times).
[0099] The expression levels of ClWRKY61 gene in overexpression and wild-type strains were analyzed using Student's t test (**, P < 0.01).
[0100] 4) Phenotypic observation of transgenic watermelon plants:
[0101] Seeds of the wild-type (WT), overexpressing strain OEWRKY61, and edited plant crwrky61-1 were soaked for 6 hours and then germinated in a dark environment at 28°C for approximately 30 hours. When the seeds turned white, they were sown individually in nutrient pots (8×7×7 cm). The seedlings were grown at 28°C / 18°C (day / night) and 18h / 6h (light / dark). Watering was done regularly and quantitatively every day. When the seedlings had three leaves and one heart, they were transplanted into the field and managed normally. After flowering, they were strictly self-pollinated and the pollination time was recorded. After the fruits matured (35-40 days of growth), the fruits of each strain were collected for phenotypic observation and photography, and the longitudinal diameter was measured with a ruler. After measuring at least three fruits for each strain, data were analyzed using SPSS software.
[0102] The results showed that ( Figure 3 ), under normal growth conditions, the fruit of the knockout strain was significantly smaller than that of the wild type (WT), while that of the overexpression strain was larger than that of the wild type (WT); at the same time, the longitudinal diameter data showed that ( Figure 4 The longitudinal diameter of the fruit of the knockout strain was reduced by approximately 33.33% compared to the wild type, while the longitudinal diameter of the overexpression strain was increased by 36.67%. The longitudinal diameters of WT, OEWRKY61, and crwrky61-1 (CR-WRKY61) were 37.50±3.04cm, 51.25±3.03cm, and 25.10±0.71cm, respectively.
[0103] The significance was analyzed by one-way ANOVA method and Duncan test (P<0.05).
[0104] In summary, the present invention provides the watermelon WRKY transcription factor ClWRKY61 and clarifies its biological function in watermelon fruit size development, providing genetic resources for improving the fruit size traits of excellent watermelon germplasm and laying the foundation for the breeding of new varieties with different fruit sizes to meet different market demands.
[0105] The above description of the disclosed embodiments is intended to enable one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be readily apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention is not limited to the embodiments shown herein but is intended to conform to the widest scope consistent with the principles and novel features disclosed herein.
Claims
1. Watermelon ClWRKY61 The application of the gene in positively regulating the size development of watermelon fruit is characterized in that: described ClWRKY61 The nucleotide sequence of the gene is shown in SEQ ID NO.
1.
2. Overexpression of Watermelon ClWRKY61 The application of genetically modified biological materials in enlarging watermelon fruit is characterized in that: described ClWRKY61 The nucleotide sequence of the gene is shown in SEQ ID NO.1; The biological material is any one of the following: A: It can ClWRKY61 expression cassettes for gene overexpression; B: recombinant vector containing the expression cassette described in A; C: A recombinant microorganism containing the expression cassette described in A or the recombinant vector described in B.
3. Overexpression of Watermelon ClWRKY61 The application of genetic biomaterials in increasing the longitudinal diameter of watermelon is characterized in that: described ClWRKY61 The nucleotide sequence of the gene is shown in SEQ ID NO.1; The biological material is any one of the following: A: It can ClWRKY61 expression cassettes for gene overexpression; B: recombinant vector containing the expression cassette described in A; C: A recombinant microorganism containing the expression cassette described in A or the recombinant vector described in B.
4. Knockout Watermelon ClWRKY61 The application of genetically modified biological materials in reducing the size of watermelon fruits is characterized in that: described ClWRKY61 The nucleotide sequence of the gene is shown in SEQ ID NO. 1; The biological material is any one of the following: A: It can ClWRKY61 expression cassettes for gene silencing; B: recombinant vector containing the expression cassette described in A; C: A recombinant microorganism containing the expression cassette described in A or the recombinant vector described in B.
5. Knockout Watermelon ClWRKY61 The application of genetically modified biological materials in reducing the longitudinal diameter of watermelon is characterized in that: described ClWRKY61 The nucleotide sequence of the gene is shown in SEQ ID NO. 1; The biological material is any one of the following: A: It can ClWRKY61 expression cassettes for gene silencing; B: recombinant vector containing the expression cassette described in A; C: A recombinant microorganism containing the expression cassette described in A or the recombinant vector described in B.
6. Watermelon ClWRKY61 The application of the gene in watermelon fruit size breeding is characterized in that, The watermelon ClWRKY61 Gene knockout reduces watermelon fruit size ClWRKY61 Gene overexpression increases watermelon fruit size; the watermelon ClWRKY61 The nucleotide sequence of the gene is shown in SEQ ID NO.1.
Citation Information
Patent Citations
Application of CsCRC protein and coding gene thereof in regulation and control of plant fruit length
CN115215929A