SmSNR gene and application thereof in increasing content of salvianolic acid in salvia miltiorrhiza

By knocking out the SmSNR gene in Salvia miltiorrhiza, the key enzyme gene in the downstream synthesis pathway of salvianolic acid was activated, solving the problems of low germplasm quality and low salvianolic acid content in Salvia miltiorrhiza, and achieving a significant increase in salvianolic acid content and a reduction in production costs.

CN119506304BActive Publication Date: 2026-03-03CHINESE PEOPLES LIBERATION ARMY NAVAL SPECIALTY MEDICAL CENT
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411747091.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-02
Publication Date
2026-03-03
Estimated Expiration
2044-12-02

AI Technical Summary

Technical Problem

Due to the degradation of Salvia miltiorrhiza germplasm resources and the unstable content of salvianolic acid, the content of medicinal components in Salvia miltiorrhiza is low, and existing technologies are unable to effectively increase the accumulation of salvianolic acid.

Method used

By knocking out the SmSNR gene in Salvia miltiorrhiza in response to gibberellin stimulation, the expression of key enzyme genes in the downstream synthesis pathway of salvianolic acid was activated. The SmSNR gene knockout vector was constructed using the CRISPR/Cas9 method and transformed into Agrobacterium tumefaciens. The vector was then used to infect sterile Salvia miltiorrhiza seedling explants to establish SmSNR gene knockout hairy roots.

Benefits of technology

It significantly increased the content of salvianolic acid in tanshinone, especially salvianolic acid B and rosmarinic acid, reaching approximately 2.21 times and 1.72 times that of the control group, respectively, thereby reducing production costs and improving the stability of the medicinal components of tanshinone.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119506304B_ABST
    Figure CN119506304B_ABST
Patent Text Reader

Abstract

The present application relates to a kind of SmSNR gene and its application in improving the content of salvianolic acid in Salvia miltiorrhiza, the nucleotide sequence of the above-mentioned SmSNR gene is as shown in SEQ ID No.1.The SmSNR gene is cloned in Salvia miltiorrhiza for the first time in the present application, and it is found that it plays a negative regulation role in salvianolic acid biosynthesis, and the content of salvianolic acid in Salvia miltiorrhiza can be significantly improved by knocking out SmSNR gene in Salvia miltiorrhiza.The SmSNR transcription factor responding to gibberellin induction is screened by transcriptome sequencing analysis in the present application, and SmSNR gene knockout vector is constructed using CRISPR / Cas9 technology, and gene knockout hairy root is obtained by transformation, and the expression of key enzyme gene in the downstream synthesis pathway of salvianolic acid can be activated by knocking out SmSNR gene in Salvia miltiorrhiza, so as to effectively improve the content of salvianolic acid in Salvia miltiorrhiza, especially the content of salvianolic acid B and rosmarinic acid, which has high application value and research value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of plant molecular biology and genetic engineering, and in particular to an SmSNR gene and its application in increasing the content of tanshinone in Salvia miltiorrhiza. Background Technology

[0002] Salvia miltiorrhiza Bge., a perennial herb belonging to the genus Salvia in the Lamiaceae family, was first recorded in the Han Dynasty's *Shennong's Classic of Materia Medica*. It is bitter and slightly cold in nature, and its dried roots and rhizomes are used medicinally. As one of the most widely cultivated and major medicinal herbs in my country, Salvia miltiorrhiza possesses the effects of removing blood stasis, relieving pain, promoting blood circulation, and regulating menstruation. It is widely used in the treatment of various cardiovascular and cerebrovascular diseases such as angina pectoris, acute cerebral infarction, and coronary heart disease, and has broad clinical application prospects. Danshen acid compounds are the main components in Salvia miltiorrhiza that exert its blood-activating and stasis-removing effects. In recent years, it has also been found to have various pharmacological activities such as anti-tumor, anti-inflammatory, antibacterial, antiviral, and free radical scavenging activities, demonstrating extremely high medicinal value. As an important food and medicine homology species, Salvia miltiorrhiza has been developed into various health foods, such as Salvia miltiorrhiza tea, Salvia miltiorrhiza and Gastrodia elata capsules, and Salvia miltiorrhiza aminochondroitin tablets. These products have the effects of promoting blood circulation, removing blood stasis, regulating blood lipids, and increasing bone density, and have broad market value.

[0003] However, in recent years, due to the severe degradation of Salvia miltiorrhiza germplasm resources, the content of salvianolic acid in Salvia miltiorrhiza from different producing areas varies greatly, resulting in significant differences in quality. Therefore, steadily increasing the content of medicinal components in Salvia miltiorrhiza has important research significance and application prospects. Knocking out or overexpressing transcription factors in Salvia miltiorrhiza through genetic engineering is a way to improve the quality of Salvia miltiorrhiza from a genetic perspective and increase the content of medicinal components. According to previous reports, MYB family transcription factors play an important role in the biosynthesis of salvianolic acid, but different transcription factors may have different effects on the synthesis of salvianolic acid. SmMYB52 can activate key enzyme genes in the biosynthesis of salvianolic acid, positively regulating the accumulation of salvianolic acid, but SmMYB36 has the opposite function; overexpression of SmMYB36 inhibits the accumulation of salvianolic acid in the hairy roots of Salvia miltiorrhiza. Therefore, in order to practically solve the problems of low germplasm quality and low salvianolic acid content in Salvia miltiorrhiza, it is essential to find a new method to increase the content of medicinal components in Salvia miltiorrhiza. Summary of the Invention

[0004] To overcome at least one problem existing in the prior art, this invention provides a gibberellin-responsive SmSNR gene and its application in increasing the content of salvianolic acid in Salvia miltiorrhiza. This invention screens for the gibberellin-responsive MYB family transcription factor SmSNR in Salvia miltiorrhiza by stimulating it with gibberellin. Knocking out the SmSNR gene in Salvia miltiorrhiza activates the expression of key enzyme genes in the downstream synthetic pathway of salvianolic acid, thereby significantly increasing the accumulation of salvianolic acid in Salvia miltiorrhiza. This method effectively solves the problems of low quality of Salvia miltiorrhiza and low salvianolic acid content in Salvia miltiorrhiza.

[0005] To achieve the above objectives, the present invention adopts the following technical solution:

[0006] The first aspect of the present invention is to provide an SmSNR gene that regulates the biosynthesis of salvianolic acid in response to gibberellin stimulation, the nucleotide sequence of which is shown in SEQ ID No. 1.

[0007] Furthermore, the primer sequences used for PCR amplification of the SmSNR gene are shown in SEQ ID No. 10 to SEQ ID No. 11.

[0008] Furthermore, the primer sequences used for qRT-PCR detection of the SmSNR gene are shown in SEQ ID No. 12 to SEQ ID No. 13.

[0009] Furthermore, the primer sequences used to construct the subcellular localization vector containing the SmSNR gene sequence are shown in SEQ ID No. 14 to SEQ ID No. 15. Preferably, the subcellular localization vector is a pEAQ-SmSNR-GFP vector containing the SmSNR target sequence.

[0010] A second aspect of the present invention is to provide a protein encoded by the SmSNR gene as described in any of the first aspects, the amino acid sequence of which is shown in SEQ ID No. 2.

[0011] A third aspect of the present invention is to provide a biological material related to the knockout of the SmSNR gene, comprising: an sgRNA sequence of the SmSNR gene sequence, a recombinant vector containing the sgRNA sequence, a recombinant vector knocking out the SmSNR gene sequence, and a recombinant cell knocking out the SmSNR gene sequence.

[0012] In the aforementioned biological materials, the open reading frame region of the SmSNR gene is analyzed to identify potential sgRNAs for SmSNR, with the preferred sgRNA sequence shown in SEQ ID No. 3. In these biological materials, the vector can be a plasmid, granule, bacteriophage, or viral vector. The vector can be transformed, transduced, or transfected into host cells. Host cells include prokaryotic cells, fungal cells, insect cells, and animal cells, such as *Escherichia coli* and *Agrobacterium tumefaciens*. The aforementioned recombinant vectors and recombinant cell lines can be prepared using conventional methods in the art. Preferably, the recombinant vector containing the sgRNA sequence is a CRISPR / Cas9-At intermediate vector containing the sgRNA sequence, the recombinant vector knocking out the SmSNR gene sequence is the pCAMBIA1300-SmSNRsgRNA-CRISPR / Cas9 vector, and the recombinant cell line knocking out the SmSNR gene sequence is *Agrobacterium tumefaciens* with SmSNR knocked out.

[0013] A fourth aspect of the present invention is the application of the SmSNR gene as described in any of the first aspects, or the biomaterial as described in any of the third aspects, in increasing the content of salvianolic acid in tanshinone, which increases the content of salvianolic acid in tanshinone by directionally knocking out the SmSNR gene in tanshinone.

[0014] Furthermore, the expression of key enzyme genes in the tanshinone synthesis pathway is enhanced by knocking out the SmSNR gene in tanshinone. The key enzyme genes include SmPAL, SmTAT, SmC4H, Sm4CL, SmHPPR, SmRAS, SmCYP98A75, and SmCYP98A78, with SmPAL and SmRAS being preferred.

[0015] Furthermore, the salvianolic acid includes salvianolic acid B and rosmarinic acid.

[0016] Furthermore, the SmSNR gene was knocked out in Salvia miltiorrhiza using the CRISPR / Cas9 method.

[0017] Furthermore, the step of targeted knockout of the SmSNR gene in Danshen specifically includes:

[0018] Step S1: Design the sgRNA sequence based on the SmSNR gene sequence and integrate the sgRNA sequence into an intermediate vector containing a CRISPR / Cas9 expression cassette;

[0019] Step S2: The intermediate vector containing the sgRNA sequence obtained in step S1 is double-digested with enzymes, and the digestion products are ligated into a plant expression vector to obtain a knockout vector.

[0020] Step S3: Transform the knockout vector obtained in step S2 into Agrobacterium tumefaciens competent cells to obtain Agrobacterium tumefaciens strain containing the knockout vector.

[0021] Step S4: Infect the explants of sterile Salvia miltiorrhiza seedlings with the Agrobacterium tumefaciens strain obtained in step S3 to obtain Salvia miltiorrhiza SmSNR gene knockout hairy roots.

[0022] Further, in step S1, the sgRNA sequence is as shown in SEQ ID No. 3.

[0023] Further, in step S1, the intermediate vector containing the CRISPR / Cas9 expression cassette is a CRISPR / Cas9-At vector. Specifically, the CRISPR / Cas9-At vector is expressed by the AtU6 promoter, and the restriction enzyme site used in the construction process is BbsⅠ.

[0024] Furthermore, in step S1, the primer sequences used to integrate the sgRNA sequence into the intermediate vector containing the CRISPR / Cas9 expression cassette are shown in SEQ ID No. 4 to SEQ ID No. 5.

[0025] Further, in step S1, the construction steps of the CRISPR / Cas9-At vector are as follows: primer annealing of primers with sequences shown in SEQ ID No. 4 to SEQ ID No. 5 is performed using T4 PNK enzyme; CRISPR / Cas9-At is digested with BbsI; and the sgRNA sequence is integrated into the CRISPR / Cas9-At intermediate vector using T4 ligase of full-gold.

[0026] Further, in step S1, the annealing system consists of 1 μL of 10×T4 PNK Buffer, 0.5 μL of T4 Polynucleotide Kinase, 1 μL each of forward and reverse primers, and 6.5 μL of ddH2O; the reaction conditions are: 37℃ water bath for 30 min, PCR: 95℃ for 5 min, then decreasing by 5℃ every 30 seconds until reaching 25℃; the single enzyme digestion system consists of 3 μg of CRISPR / Cas9-At, 3 μL of BbsI enzyme, 5 μL of r-Cutsmart, and water to bring the total to 50 μL, with the reaction conditions being 37℃ for 4 h; the reaction system using T4 ligase consists of 50 ng of linear psgR-Cas9-At, 1 μL of annealed sgRNA, 2 μL of T4 Ligase Buffer, 1 μL of T4 Ligase, and ddH2O to bring the total to 10 μL, with the reaction conditions being 22℃ for 1 h.

[0027] Further, in step S2, the plant expression vector is the pCAMBIA1300 plant expression vector, and the knockout vector is the pCAMBIA1300-SmSNRsgRNA-CRISPR / Cas9 vector.

[0028] Furthermore, in step S2, the double restriction sites used are EcoRI and HindIII, and the ligase used is T4 ligase.

[0029] Further, in step S2, the double digestion system consists of 3 μg of a CRISPR / Cas9-At vector or pCAMBIA 1300 vector containing the sgRNA sequence, 3 μL each of EcoRI and HindIII enzymes, 5 μL of r-Cutsmart, and water to a final volume of 50 μL. The reaction conditions are 37°C for 4 h. The ligation reaction system consists of 50 ng of CRISPR / Cas9-At vector digestion product, 1 μL of pCAMBIA 1300 vector digestion product, 2 μL of T4 Ligase Buffer, 1 μL of T4 Ligase, and ddH2O to a final volume of 10 μL. The reaction conditions are 22°C for 1 h. Further, in step S3, the Agrobacterium tumefaciens is Agrobacterium tumefaciens C58C1. It is understood that other strains, such as Agrobacterium tumefaciens GV3101, can also be used.

[0030] Further, in step S3, the construction steps of the Agrobacterium tumefaciens strain containing the knockout vector specifically include: taking 2 μL of the above-constructed pCAMBIA1300-SmSNRsgRNA-CRISPR / Cas9 vector and adding it to 100 μL of Agrobacterium tumefaciens C58C1 competent cells, incubating on ice for 30 min, flash freezing in liquid nitrogen for 5 min, placing at room temperature for 3 min, and heat shocking at 37℃ for 5 min; adding 500 μL of YEB medium, incubating at 28℃ and 200 rpm for 5 h, and then evenly spreading it into YEB solid medium containing kanamycin and rifampin and culturing until OD. 600 =0.6.

[0031] Further, in step S4, the step of infecting the explants of sterile *Salvia miltiorrhiza* seedlings with the *Agrobacterium tumefaciens* strain specifically includes:

[0032] Step S41, bacterial culture pretreatment: Resuspend the activated Agrobacterium cells in 1 / 2 MS liquid medium with a final concentration of 20 μM acetylsuccinone and incubate at room temperature for 20 min;

[0033] Step S42, Co-culture: Place the leaves of the sterile Salvia miltiorrhiza seedlings of appropriate size into the Agrobacterium rhizogenes cultured in step S41 and incubate at room temperature for 10 minutes; after incubation, remove excess bacterial solution, place the leaves face up on MS solid medium, and incubate in the dark at 25°C for two days.

[0034] Step S43, Resistance Reduction: After co-culture, the Danshen explants were transferred to 1 / 2 MS solid medium with a cephalosporin concentration of 500 mg / L, and the resistance was reduced every two weeks.

[0035] Step S44, Subculture: The grown single-clonal hairy roots are isolated for subculture.

[0036] Furthermore, step S4 also includes a step of PCR identification and sequencing of the hairy roots of Salvia miltiorrhiza to confirm the successful knockout of the SmSNR gene.

[0037] Furthermore, in PCR identification and sequencing, the primer sequences used for PCR identification of genomic DNA of hairy roots are shown in SEQ ID No. 6 to SEQ ID No. 7; the primer sequences used for PCR identification of the rolB gene of hairy roots are shown in SEQ ID No. 8 to SEQ ID No. 9.

[0038] Furthermore, in the PCR identification of the genomic DNA of hairy roots, upstream specific primers were designed within the above-mentioned plant expression vector sequence, and the reverse primers used during vector construction were used as downstream specific primers for PCR amplification and sequencing verification.

[0039] Furthermore, the genomic DNA of hairy roots that were positive for both genomic DNA and rolB gene detection was sequenced to confirm whether the SmSNR gene had been successfully knocked out.

[0040] The fifth aspect of the present invention is a method for constructing hairy roots of Salvia miltiorrhiza with SmSNR gene knockout, which adopts the steps of directionally knocking out the SmSNR gene in Salvia miltiorrhiza as described in any of the fourth aspects.

[0041] Compared with the prior art, the present invention, by adopting the above technical solution, has the following beneficial effects:

[0042] This invention is the first to identify SmSNR as a MYB family transcription factor. It comprehensively applies methods such as vector construction, genetic transformation, molecular detection, qPT-PCR analysis, compound extraction, and content determination to provide a method for increasing salvianolic acid content by knocking out the SmSNR gene in *Salvia miltiorrhiza*. Ultra-high performance liquid chromatography (UPLC) and quantitative real-time PCR (qRTPCR) were used to detect the salvianolic acid content and the expression levels of key enzyme genes in its biosynthetic pathway in transgenic hairy roots. The results showed that knocking out the SmSNR gene in *Salvia miltiorrhiza* can activate the expression of key enzyme genes in the downstream biosynthetic pathway of salvianolic acid, thereby effectively increasing the salvianolic acid content in *Salvia miltiorrhiza*, especially the contents of salvianolic acid B and rosmarinic acid, which were approximately 2.21 times and 1.72 times higher than those in the control group, respectively.

[0043] The method described in this invention is technically simple and highly operable, and it reduces the production cost of salvianolic acid to a certain extent, thus showing promising application prospects. Attached Figure Description

[0044] The accompanying drawings, which are included to provide a further understanding of the invention and form part of this invention, illustrate exemplary embodiments of the invention and are for illustrative purposes only, and do not constitute an undue limitation of the invention. In the drawings:

[0045] Figure 1 This is a schematic diagram illustrating the changes in SmSNR expression levels before and 3 hours after gibberellin stimulation in one embodiment of the present invention;

[0046] Figure 2 This is a schematic diagram of the conservative structural domain analysis results of SmSNR in one embodiment of the present invention; wherein, it contains two SANT structural domains;

[0047] Figure 3 This is a schematic diagram of the results of SmSNR multiple sequence alignment in one embodiment of the present invention; wherein, the red box area represents the SANT structural domain;

[0048] Figure 4 This is an MYB phylogenetic tree analysis of different species in one embodiment of the present invention; among them, SmSNR is most similar to AtMYB71 and AtMYB79 in Arabidopsis thaliana.

[0049] Figure 5 This is a schematic diagram of the results of SmSNR expression feature analysis in one embodiment of the present invention; wherein, part A: SmSNR tissue expression pattern analysis results; part B: SmSNR subcellular localization analysis (GFP is green fluorescent protein; BF is bright field; Merged is green fluorescent protein bound to bright field).

[0050] Figure 6 This is a schematic diagram illustrating the acquisition and positive identification results of SmSNR transgenic Salvia miltiorrhiza hairy roots in one embodiment of the present invention; wherein, part A: rooting process; part B: schematic diagram of knockout vector construction; part C: quantitative analysis of SmSNR expression in positive hairy roots; part D: gene editing diagram of target site of the target gene;

[0051] Figure 7 This is a schematic diagram showing the expression detection results of key genes in the salvianolic acid synthesis pathway in hairy roots by SmSNR knockout in one embodiment of the present invention.

[0052] Figure 8 This is a schematic diagram showing the changes in salvianolic acid content in hairy roots after SmSNR knockout in one embodiment of the present invention; wherein RA is rosmarinic acid and SAB is salvianolic acid B. Detailed Implementation

[0053] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Experimental methods in the following embodiments that do not specify specific conditions are generally determined according to national standards. Experimental materials in the following embodiments that do not specify their source are all commercially available raw materials. The equipment used in each step of the following embodiments is conventional equipment. If there is no corresponding national standard, it is carried out according to general international standards, conventional conditions, or conditions recommended by the manufacturer. Unless otherwise stated, all parts are parts by weight, and all percentages are percentages by mass. Unless otherwise defined or stated, all professional and scientific terms used in the present invention have the same meaning as those skilled in the art. In addition, any methods and materials similar or equivalent to those described can be applied to the methods of the present invention.

[0054] It should be noted that, unless otherwise specified, the embodiments and features described in the present invention can be combined with each other. The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but this is not intended to limit the scope of the invention.

[0055] Example 1 - Screening and Cloning of the SmSNR Gene in Danshen

[0056] This embodiment screened and obtained a MYB family transcription factor SmSNR (salvianolic acid negative regulator) that regulates salvianolic acid biosynthesis in response to gibberellin stimulation, and cloned the gene sequence. The specific steps included:

[0057] (1) Screening of SmSNR gene in Danshen;

[0058] Using previously established transcriptome data on the response of Danshen to gibberellin (registered at the National Center for Biotechnology Information in the United States, accession number PRJNA663993), we identified a MYB transcription factor (GenBank accession number AGN52058.1) whose expression level decreased after gibberellin induction. This factor was named SmSNR and analyzed for verification.

[0059] Two-month-old *Salvia miltiorrhiza* roots were stimulated with 100 μM gibberellin (GA), and samples were taken before and 3 hours after treatment. 100 mg of each sample was used for RNA extraction using the TransZol UP Plus RNA Kit (Beijing TransGen Biotech Co., Ltd.). The extracted RNA was reverse transcribed into cDNA using TransScript One-Sept gDNA Removal and cDNA Synthesis SuperMix (Beijing TransGen Biotech Co., Ltd.). The reaction mixture consisted of 1000 ng of *Salvia miltiorrhiza* RNA, 1 μL of Anchore Oligo(dT)18 Primer, 1 μL of gDNA Remover, 1 μL of TransScript RT / RI Enayme Mix, 10 μL of 2×TS Reaction Mix, and water to a final volume of 20 μL. The reaction conditions were 42℃ for 30 min and 85℃ for 5 sec. TB was used. The expression level of the SmSNR gene was detected by qRT-PCR using Premix Ex Taq™ (Tli RNaseH Plus) (Beijing TransGen Biotech Co., Ltd.). 18S primers were used as the internal control primers. The reaction mixture consisted of 2 μL cDNA, 0.4 μL each of forward and reverse primers, 10 μL of 2× Super Mix, and water to a final volume of 20 μL. The reaction conditions were: 94℃ for 20 sec; 45 cycles (94℃, 5 sec; 60℃, 15 sec; 72℃, 10 sec); 95℃, 15 sec; 60℃, 60 sec; 97℃, 1 sec). All reaction mixtures and procedures were performed according to the instructions of the corresponding kit. The sequences of the qRT-PCR detection primers and internal control primers are as follows:

[0060] SmSNR-qPCR-F: 5'-CGAAGGCCGTTGGAACAATG-3' (SEQ ID No. 12);

[0061] SmSNR-qPCR-R: 5'-CCATCTGTTCCCCCATCGAG-3' (SEQ ID No. 13);

[0062] 18S-F: 5'-ATGATAACTCGACGGATCGC-3' (SEQ ID No. 32);;

[0063] 18S-R: 5'-CTTGGATGTGGTAGCCGTTT-3' (SEQ ID No. 33).

[0064] The above experimental results are as follows Figure 1As shown, the expression level of the SmSNR gene can respond to GA stimulation. At 3h, the expression level of the SmSNR gene decreased significantly, and at 6h it gradually returned to its original state.

[0065] (2) Cloning of the SmSNR gene in Danshen;

[0066] Using the cDNA obtained from the above reverse transcription as a template, PCR amplification was performed using FastPfu Fly DNA Polymeras (Beijing TransGen Biotech Co., Ltd.). The reaction system consisted of 2 μL of cDNA and 1 μL each of forward and reverse primers. FastPfu Fly DNA Polymeras 1μL, The FastPfu Fly Reaction Mix consisted of 25 μL of water and 20 μL of water. The reaction conditions were: 95℃ for 2 min; 35 cycles (95℃ for 20 sec; 55℃ for 20 sec; 72℃ for 1 min); 72℃ for 5 min. The amplification primers were:

[0067] SmSNR-F: 5'-ATGTCTTGGGGTATGGGGTG-3' (SEQ ID No. 10);

[0068] SmSNR-R: 5'-TGGTTTCAATTAAGTAAGGGAAAT-3' (SEQ ID No. 11);

[0069] The nucleotide sequence of the SmSNR gene obtained by the above PCR amplification is shown in SEQ ID No. 1, and the amino acid sequence of the translated protein is shown in SEQ ID No. 2.

[0070]

[0071] Example 2 - Bioinformatics Analysis of the SmSNR Gene in Danshen

[0072] This embodiment performs biological information analysis on the SmSNR gene of *Salvia miltiorrhiza*, and the specific steps include:

[0073] The SmSNR gene was analyzed using the BLAST tool P-BLAST (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi?PROGRAM=blastp&PAGE_TYPE=BlastSearch&LIN K_LOC=blasthome) on the NCBI website to predict its structural domains. Simultaneously, the amino acid sequence of SmSNR was compared with the amino acid sequences of currently reported MYB family transcription factors using MEG5.0 software.

[0074] The above results are as follows Figures 2-4 As shown, Figure 2 and Figure 3 The results show that SmSNR contains two SANT domains and belongs to the R2R3 subfamily; Figure 4 The results showed that SmSNR was most closely related to AtMYB71 in Arabidopsis thaliana and belonged to the R2R3 subfamily.

[0075] Example 3 - Analysis of SmSNR gene expression pattern and subcellular localization in Danshen.

[0076] This embodiment analyzed the expression pattern of the SmSNR gene in Danshen and performed subcellular localization verification, specifically including the following steps:

[0077] (1) Analysis of the expression pattern of SmSNR gene in Danshen;

[0078] Following the steps in Example 1, RNA was extracted from the roots, stems, leaves, and flowers of adult Salvia miltiorrhiza and reverse transcribed into cDNA. The expression level of the SmSNR gene was then detected by qRT-PCR using the primers SmSNR-qPCR-F (SEQ ID No. 12) and SmSNR-qPCR-R (SEQ ID No. 13).

[0079] The above test results are as follows Figure 5 As shown in Part A, the SmSNR gene was expressed at the highest level in Salvia miltiorrhiza leaves and at the lowest level in Salvia miltiorrhiza flowers.

[0080] (2) Subcellular localization of the SmSNR gene in Danshen;

[0081] 1) Carrier construction

[0082] Based on the SmSNR gene sequence of *Salvia miltiorrhiza* obtained by cloning and amplification in Example 1, primers for constructing the subcellular localization vector (primer sequences are shown in SEQ ID No. 14-SEQ ID No. 15) were designed for homologous arm amplification. The amplification reaction system and conditions were as described in Example 1. Simultaneously, the subcellular localization vector pEAQ-GFP was double-digested using NEB's XhoI and AgeI enzymes. The digestion system consisted of 3 μg of pEAQ-GFP plasmid, 3 μL of each enzyme, 5 μL of r-Cutsmart, and water to a final volume of 50 μL. The reaction conditions were 37°C for 4 h. After digestion, the pEAQ-SmSNR-GFP vector containing the SmSNR target sequence was constructed using a full-length gold-coated seamless cloning enzyme. The ligation system consisted of 1 μL of linear pEAQ-GFP, 2 μL of the homologous arm amplification product with the restriction enzyme sites, 5 μL of Basic Mix, and 2 μL of ddH2O. The reaction conditions were 50°C for 15 min. The primer sequences used are as follows:

[0083] SmSNR-GFP-F: 5'-caaaaaagcaggcttctcgagATGTCTTGGGGTATGGGGTGG-3' (SEQ ID

[0084] No. 14);

[0085] SmSNR-GFP-R: 5'-ttgctcaccattccaccggtATAAAAATCTAAATTTTGCTGGAAATTAG-3' (SEQ ID No. 15).

[0086] 2) Subcellular localization

[0087] Add 2 μL of the constructed pEAQ-SmSNR-GFP vector to 100 μL of *Agrobacterium tumefaciens* GV3101 competent cells, incubate on ice for 30 min, flash freeze in liquid nitrogen for 5 min, incubate at room temperature for 3 min, and heat shock at 37℃ for 5 min. Add 500 μL of LYEB medium and incubate at 28℃ and 200 rpm for 5 h. Then, evenly spread the culture onto YEB solid medium containing kanamycin and rifampin. Simultaneously, transfer the empty pEAQ-GFP vector into *Agrobacterium tumefaciens* GV3101 competent cells as a blank control. After bacterial growth, transfer the cells to YEB liquid medium containing kanamycin and rifampin and culture until OD600. 600=0.8. Collect bacteria by centrifugation and resuspend in transient conversion buffer (10 mM MgCl2, 10 mM MES, and 200 μM acetylsylcholine). After standing at room temperature for 2 hours, use a syringe to aspirate the more active bacterial solution from the top and slowly inject it into the underside of tobacco leaves. Incubate in the dark for 2–3 days after injection. Place tobacco leaves near the injection site on a glass slide, underside up, moisten with double-distilled water, fix the leaves with a coverslip, and observe using a laser confocal microscope.

[0088] The above results are as follows Figure 5 As shown in Part B, the results indicate that the SmSNR-GFP fusion protein only exhibits fluorescence signals in the cell nucleus, suggesting that SmSNR is expressed in the cell nucleus, consistent with its role as a transcription factor regulating its biological functions.

[0089] Example 4 - Obtaining hairy roots from SmSNR gene knockout in Salvia miltiorrhiza

[0090] This embodiment provides a preferred method for constructing hairy roots with SmSNR gene knockout in Salvia miltiorrhiza, which specifically includes the following steps:

[0091] (1) Construction of CRISPR / Cas9-At vector;

[0092] The open reading frame (ORF) region of the SmSNR gene was analyzed using the CHOPCHOP website (https: / / chopchop.cbu.uib.no / ) to identify potential sgRNAs for SmSNR. The sequence with the highest score was selected as the sgRNA (SEQ ID No. 3), and primers were designed to construct the knockout vector (primer sequences are shown in SEQ ID No. 4 and SEQ ID No. 5). The designed primers were annealed using T4 PNK enzyme. The annealing system consisted of 1 μL of 10×T4 PNK Buffer, 0.5 μL of T4 Polynucleotide Kinase, 1 μL each of forward and reverse primers, and 6.5 μL of ddH2O. The reaction conditions were: 37°C for 30 min, PCR: 95°C for 5 min, followed by a 5°C decrease every 30 seconds until reaching 25°C. Simultaneously, referring to part (1) of Example 3, CRISPR / Cas9-At was digested with BbsⅠ under the following conditions: 37℃, 4h. 1.5 μL CPI was added, and the mixture was pipetted and incubated at 37℃ for 30min. The sgRNA sequence was integrated into the CRISPR / Cas9-At intermediate vector using the T4 ligase of All-Gold. The reaction mixture consisted of 50 ng linear psgR-Cas9-At, 1 μL annealed sgRNA, 2 μL T4 Ligase Buffer, 1 μL T4 Ligase, and ddH2O to a final volume of 10 μL. The reaction conditions were 22℃, 1h. The constructed vector was then expressed using the AtU6 promoter. Figure 6 (As shown in Part B).

[0093] sgRNA: 5'-TTGAACTGCATGCTCGATGG-3' (SEQ ID No. 3);

[0094] SmSNR-Cas9-F: 5'-GATTGTTGAACTGCATGCTCGATGG-3' (SEQ ID No. 4);

[0095] SmSNR-Cas9-R: 5'-AAACCCATCGAGCATGCAGTTCAAC-3' (SEQ ID No. 5).

[0096] (2) Construction of pCAMBIA 1300 vector;

[0097] Referring to part (1) of Example 3, pCAMBIA 1300 and the CRISPR / Cas9-At vector containing the sgRNA sequence were simultaneously digested with EcoRI and HindIII enzymes. After digestion, referring to part (1) of Example 4, the intermediate vector CRISPR / Cas9-At was constructed into the plant expression vector pCAMBIA1300 using T4 ligase (Beijing TransGen Biotech Co., Ltd.) to obtain the pCAMBIA1300-SmSNRsgRNA-CRISPR / Cas9 vector.

[0098] (3) Infecting Salvia miltiorrhiza explants;

[0099] Referring to Example 3, the constructed pCAMBIA1300-SmSNRsgRNA-CRISPR / Cas9 vector was transformed into Agrobacterium tumefaciens C58C1 competent cells. Simultaneously, the empty pCAMBIA1300-CRISPR / Cas9 vector was transformed into Agrobacterium tumefaciens C58C1 competent cells as a blank control. The cells were then plated onto YEB solid medium containing kanamycin and rifampin. After bacterial growth, the cells were transferred to YEB liquid medium containing kanamycin and rifampin and cultured until OD500. 600 =0.6. Centrifuge to collect bacterial cells, add 10 mL of 1 / 2 MS liquid medium with a final concentration of 20 μM acetylsylphenone, and slowly incubate until OD reaches 0.6. 600 =1.0 (incubated at room temperature for approximately 20 minutes). Cut the leaves of the sterile Salvia miltiorrhiza seedlings into pieces approximately 1cm long. 2 The prepared Agrobacterium tsao-ko leaves were inoculated with a cultured Agrobacterium solution (approximately 10 minutes at room temperature). After inoculation, excess solution was removed, and the leaves were laid flat on 1 / 2 MS solid medium with the upper surface facing up. They were then incubated in the dark at 25°C for 2 days. After the dark incubation, the leaves were transferred to 1 / 2 MS solid medium containing 500 mg / L cephalosporin for further dark incubation. The cephalosporin concentration in the medium was then reduced every two weeks (250 mg / L, 200 mg / L, 150 mg / L). The mature monoclonal hairy roots were isolated for subculture. The rooting process of the transgenic hairy roots of *Salvia miltiorrhiza* is as follows: Figure 6 As shown in Part A.

[0100] (4) Identification of knockout strains;

[0101] use Genomic DNA was extracted from monoclonal hairy roots using the Plant Genomic DNA Kit (Beijing TransGen Biotechnology Co., Ltd.). Upstream-specific primers were designed within the pCAMBIA1300 vector sequence, and the reverse primers used during vector construction were used as downstream-specific primers for PCR identification. The upstream primer was P2 (SEQ ID No. 6), and the downstream primer was SmSNR-sgRNA-R (SEQ ID No. 7). Simultaneously, the rolB gene was identified in positive hairy roots using PCR primers rolB-F (SEQ ID No. 8) and rolB-R (SEQ ID No. 9). Specific sequence information is as follows:

[0102] P2: 5'-GCGATTAAGTTGGGTAACGC-3' (SEQ ID No. 6);

[0103] SmSNR-sgRNA-R: 5'-CAAGAGCTGTAGATTGAGATG-3' (SEQ ID No. 7);

[0104] rolB-F: 5'-CGAGGGGATCCGATTTGCTT-3' (SEQ ID No. 8);

[0105] rolB-R: 5'-GACGCCCTCCCTCGCCTTCCT-3' (SEQ ID No. 9).

[0106] Genomic DNA from hairy roots that tested positive in both tests was sequenced to confirm whether the knockout was successful and the type of knockout. Figure 6 As shown in section D, this embodiment obtained a total of 8 SmSNR double-strand knockout Salvia miltiorrhiza hairy roots.

[0107] Example 5 - Expression of key enzyme gene for tanshinone biosynthesis in hairy roots of Salvia miltiorrhiza SmSNR gene knockout positive

[0108] This embodiment studies the expression of a key enzyme gene for the biosynthesis of salvianolic acid in the hairy roots of *S. tanshinone* with SmSNR gene knockout positive. The specific steps include:

[0109] (1) RNA extraction and cDNA synthesis from hairy roots;

[0110] The SmSNR double-strand knockout hairy roots identified as positive in Example 4 were cultured in a shaker at 25°C in the dark. After 2 months, the hairy roots were collected, and RNA was extracted and reverse transcribed into cDNA according to the method in Example 1. The expression level of the SmSNR gene was detected by qRT-PCR using primers: SmSNR-qPCR-F (SEQ ID No. 12) and SmSNR-qPCR-R (SEQ ID No. 13).

[0111] The above experimental results showed that the expression level of SmSNR was downregulated to varying degrees in the hairy roots of *Salvia miltiorrhiza* with the SmSNR gene knocked out. Three plants with the most significant changes were selected for subsequent experiments, numbered CR-SNR#4, CR-SNR#5, and CR-SNR#7 (e.g., CR-SNR#4, CR-SNR#5, CR-SNR#7, CR-SNR#8, CR-SNR#9, CR-SNR#10, CR-SNR#11, CR-SNR#12, CR-SNR#13, CR-SNR#14, CR-SNR#15, CR-SNR#16, CR-SNR#17, CR-SNR#18, CR-SNR#19, CR-SNR#10, CR-SNR#11, CR-SNR#12, CR-S Figure 6 (as shown in section C).

[0112] (2) Design and synthesis of quantitative PCR primers;

[0113] Based on the sequences of the key enzyme genes SmPAL, SmTAT, SmC4H, Sm4CL, SmHPPR, SmRAS, SmCYP98A75, and SmCYP98A78 in the biosynthesis of salvianolic acid, primers were designed using the Primer designing tool website. All primers were synthesized by Shanghai Sangon Biotech Co., Ltd., and the primer sequences are as follows:

[0114] Primer name Specific sequence information (5'-3') SmPAL-F TACCTCGTCGCCCTATGCCAAG(SEQ ID No.16) SmPAL-R ATTGACGCCCATTGTGAGAGTT(SEQ ID No.17) SmTAT-F CAACTGCTGGTCTTCCACAAAC(SEQ ID No.18) SmTAT-R GCGAGCCAAAACGGACA(SEQ ID No.19) SmC4H-F CCAGGAGTCCAAATAACAGAGC(SEQ ID No.20) SmC4H-R GCCACCAAGCGTTCACCAAGAT(SEQ ID No.21) Sm4CL-F TCGCCAAATACGACCTTTCC(SEQ ID No.22) Sm4CL-R TGCTTCAGTCATCCCATACCC(SEQ ID No.23) SmHPPR-F TGACTCCAGAAACAACCCACATT(SEQ ID No.24) SmHPPR-R CCCAGACGACCCTCCACAAG(SEQ ID No.25) SmRAS-F CCAAAGTCAATTATGCCAAGGG(SEQ ID No.26) SmRAS-R GTCGGATAGGTGGTGCTCGT(SEQ ID No.27) SmCYP98A75-F AACTCGAGTAAGAGCCTGCTG(SEQ ID No.28) SmCYP98A75-R CCTGTTGTCAGCAATGGACC(SEQ ID No.29) SmCYP98A78-F TCACCGCCATGGTTGAATCC(SEQ ID No.30) SmCYP98A78-R GTTGTGGAACGCCATTGAT(SEQ ID No.311)

[0115] (3) Expression of key enzyme genes in transgenic hairy roots;

[0116] The expression levels of key enzyme genes involved in the biosynthesis of salvianolic acid in hairy roots were detected using the above primers, and TB was used. The experiment was conducted using the Premix Ex Taq™ (Tli RNaseH Plus) kit (Beijing TransGen Biotech Co., Ltd.), and the results are as follows: Figure 7 As shown, in the hairy roots of Salvia miltiorrhiza with the SmSNR gene knocked out, the expression levels of most key enzyme genes involved in the biosynthesis of salvianolic acid increased to some extent, with SmPAL and SmRAS showing the most significant changes.

[0117] Example 6 - UPLC detection of salvianolic acid content in transgenic hairy roots

[0118] This embodiment uses UPLC to detect the content of salvianolic acid in the hairy roots of *Salvia miltiorrhiza* with the SmSNR gene knocked out. The specific steps include:

[0119] (1) Preparation of standard products;

[0120] Accurately weigh salvianolic acid B and rosmarinic acid standards, dissolve them separately in chromatographic grade methanol to prepare 1 mg / mL standard stock solutions, then take 100 μL of each of the two standards and prepare a 20 μg / mL mixed standard with chromatographic grade methanol. Then, perform serial dilution with chromatographic grade methanol at a ratio of 1:2 to finally prepare 8 standard solutions of different concentrations for plotting standard curves.

[0121] (2) Extraction of salvianolic acid;

[0122] The hairy roots from the expanded culture were ground into powder using a mortar and pestle. 1 mg of the sample was weighed into a 2 mL RNase-free EP tube, and 800 μL of 75% ethanol was added. The mixture was left to stand overnight at room temperature. The next day, the sample was vortexed and extracted by ultrasonication at 60 W for 40 min, followed by centrifugation at 12000 × g for 20 min at room temperature. 700 μL of the supernatant was transferred into a new 2 mL RNase-free EP tube and evaporated to dryness using a vacuum evaporation concentrator. 200 μL of methanol was added for redissolution, and the mixture was centrifuged at 12000 × g for 30 min. 180 μL of the supernatant was transferred into a sample vial for analysis.

[0123] (3) UPLC detection;

[0124] Chromatographic conditions: C18 column with a particle size of 5 μm and an inner diameter of 250 × 4.6 mm, packed with octadecylsilane-bonded silica particles; column temperature 25 °C; mobile phase A was 0.08% formic acid aqueous solution; mobile phase B was 100% methanol; gradient elution was used; the mobile phase was sonicated for 5–10 min at a flow rate of 1.2 mL / min; and the injection volume was 10 μL.

[0125] The mixed standards of different concentrations prepared in step (1) were injected under the corresponding chromatographic conditions to ensure complete separation of the different components and good peak shapes. The chromatograms and chromatographic parameters were recorded, and the standard curves of salvianolic acid B and rosmarinic acid were obtained by analyzing the peak area (Y) against the standard concentration (X, mg / mL). The sample was detected by UPLC, and the peak area of ​​each component was recorded. The peak areas were then substituted into the linear regression equation to calculate the content of the sample components.

[0126] The results are as follows Figure 8 As shown, in this embodiment, knocking out the SmSNR gene using the CRISPR / Cas9 system can significantly increase the content of salvianolic acid B and rosmarinic acid in transgenic hairy roots. Among them, the most significant increase was observed in the plant, where the content of salvianolic acid B increased from 9.59 mg / g to 21.20 mg / g (approximately 2.21 times), and the content of rosmarinic acid increased from 12.58 mg / g to 21.68 mg / g (approximately 1.72 times).

[0127] As can be seen from the above embodiments, the present invention cloned the SmSNR gene from Salvia miltiorrhiza for the first time, and obtained a transgenic hairy root system of Salvia miltiorrhiza with high production of salvianolic acid by using a metabolic engineering strategy of knocking out the SmSNR gene. This provides the possibility for the commercial large-scale production of salvianolic acid and also provides an important source to meet the market demand for salvianolic acid.

[0128] The specific embodiments of the present invention have been described in detail above, but they are only examples, and the present invention is not limited to the specific embodiments described above. For those skilled in the art, any equivalent modifications and substitutions to the present invention are also within the scope of the present invention. Therefore, all equivalent changes and modifications made without departing from the spirit and scope of the present invention should be covered within the scope of the present invention.

Claims

1. Application of a biological material knocking out SmSNR gene in increasing the content of salvianolic acid in Salvia miltiorrhiza, characterized in that, The SmSNR gene regulates the biosynthesis of salvianolic acid in response to gibberellin stimulation, and the nucleotide sequence is shown as SEQ ID No. 1; wherein, in the application, the content of salvianolic acid in Salvia miltiorrhiza is increased by knocking out the SmSNR gene in Salvia miltiorrhiza, and the salvianolic acid includes salvianolic acid B and rosmarinic acid.

2. Use according to claim 1, characterized in that, The biological material includes: sgRNA of the SmSNR gene sequence, a recombinant vector for knocking out the SmSNR gene sequence, and a recombinant cell line for knocking out the SmSNR gene sequence.

3. Use according to claim 1, characterized in that, The biological material is a recombinant vector containing sgRNA of the SmSNR gene sequence.

4. Use according to claim 1, characterized in that, The step of knocking out the SmSNR gene in Salvia miltiorrhiza specifically includes: Step S1, designing sgRNA sequence according to SmSNR gene sequence, and integrating the sgRNA sequence into an intermediate vector containing a CRISPR / Cas9 expression frame; Step S2, double enzyme digestion is performed on the intermediate vector containing the sgRNA sequence obtained in step S1, and the enzyme digestion product is connected and constructed into a plant expression vector to obtain a knockout vector; Step S3, transforming the knockout vector obtained in step S2 into Agrobacterium tumefaciens competent cells to obtain an Agrobacterium tumefaciens strain containing the knockout vector; Step S4, infecting the Agrobacterium tumefaciens strain obtained by transformation in step S3 into Salvia miltiorrhiza sterile seedling explants to obtain Salvia miltiorrhiza SmSNR gene knockout hairy roots.

5. Use according to claim 4, characterized in that, In step S1, the sgRNA sequence is shown as SEQ ID No. 3; and / or, the intermediate vector containing the CRISPR / Cas9 expression frame is a CRISPR / Cas9-At vector.

6. Use according to claim 4, characterized in that, In step S1, the primer sequence used for integrating the sgRNA sequence into the intermediate vector containing the CRISPR / Cas9 expression frame is shown as SEQ ID No. 4-SEQ ID No.

5.

7. Use according to claim 4, characterized in that, In step S2, the plant expression vector is a pCAMBIA1300 plant expression vector, and the knockout vector is a pCAMBIA1300-SmSNRsgRNA-CRISPR / Cas9 vector; and / or, in step S3, the Agrobacterium tumefaciens is Agrobacterium tumefaciens C58C1.

8. Use according to claim 7, characterized in that, In step S4, further including the steps of PCR identification and sequencing determination of successful knockout of the SmSNR gene on the Salvia miltiorrhiza hairy roots; wherein, the primer sequence used for PCR identification of the genomic DNA of the hairy roots is shown as SEQ ID No. 6-SEQ ID No. 7; and the primer sequence used for PCR identification of the rolB gene of the hairy roots is shown as SEQ ID No. 8-SEQ ID No.

9. 9.A method for constructing a Salvia miltiorrhiza SmSNR gene knockout hairy root and application of the method in increasing the content of salvianolic acid in Salvia miltiorrhiza, characterized in that, The salvianolic acid includes salvianolic acid B and rosmarinic acid, and the construction method adopts the step of knocking out the SmSNR gene in Salvia miltiorrhiza as described in any one of claims 4-8.