Tree salt stress resistance gene and application thereof

Abstract

The application belongs to the technical field of genetic engineering, and particularly relates to a tree salt stress resistance gene and application thereof. The nucleotide sequence of the tree salt stress resistance gene is shown as SEQ ID NO. 1. The expression amount of the gene is significantly positively correlated with the salt resistance of plants. It has been verified that the MYB43 gene can significantly improve the salt resistance of plants after overexpression in poplar, and does not inhibit the growth characteristics of plants, and therefore can be used for cultivating high-yield, high-quality and salt-resistant new varieties, and provides a new molecular tool for genetic improvement of forest tree salt resistance.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of genetic engineering, and particularly relates to a tree salt stress resistance gene and application thereof. BACKGROUND

[0002] Soil salinization seriously restricts agricultural and forestry production and is one of the key limiting factors for the sustainable development of agricultural and forestry production. Salt stress can cause primary stress such as osmotic stress and ion toxicity, and high salt can also cause a series of secondary stresses such as oxidative stress and nutrient stress. The accumulation of various stresses can affect the growth and metabolic processes of plants. As a sessile organism, plants have evolved a highly complex signal transduction pathway to reduce the harm caused by soil salinity stress.

[0003] The V-myb avian myeloblastosis viral oncogene homolog (MYB) gene family is one of the largest transcription factor families in plants, and is involved in the regulation of physiological processes such as plant growth and development, physiological metabolism, cell morphology and pattern formation. It is ubiquitous in plants. However, there are few reports on the salt-tolerant function of MYB transcription factor family genes in Populus tomentosa. SUMMARY

[0004] The purpose of the present application is to provide a tree salt stress resistance gene and application thereof. The tree salt stress resistance gene can significantly improve the salt resistance of the plant after overexpression in the poplar, and will not inhibit the growth characteristics of the plant.

[0005] The present application provides a tree salt stress resistance gene, and the nucleotide sequence of the tree salt stress resistance gene is shown in SEQ ID NO. 1.

[0006] The present application also provides a CDS sequence of the tree salt stress resistance gene.

[0007] The present application also provides the application of the gene or the CDS sequence in the tree salt stress resistance.

[0008] The present application also provides a pair of primers for amplifying the gene or the CDS sequence, and the forward nucleotide sequence of the primer is shown in SEQ ID NO. 2; and the reverse nucleotide sequence of the primer is shown in SEQ ID NO. 3.

[0009] The present application also provides a recombinant vector comprising the gene or the CDS sequence.

[0010] As a preferred solution, the basic skeleton of the recombinant vector comprises a pBI121 vector.

[0011] The application further provides application of the recombinant vector in salt stress resistance of trees.

[0012] The application further provides a method for improving salt stress resistance of trees, comprising the following step: overexpressing the gene or the CDS sequence in a target tree genome.

[0013] The application further provides application of the gene, the CDS sequence or the recombinant vector in creating salt stress resistance germplasm resources, and overexpressing the gene or the CDS sequence in a target tree genome.

[0014] As a preferred solution, the trees comprise poplar, and the poplar comprises populus tomentosa.

[0015] Beneficial effects: the application provides a tree salt stress resistance gene, and the nucleotide sequence of the tree salt stress resistance gene is shown as SEQ ID NO. 1. The expression amount of the gene is significantly positively correlated with the salt resistance of plants. It is verified that the overexpression of the MYB43 gene in poplar can significantly improve the salt resistance of plants, and does not inhibit the growth characteristics of plants, so that the gene can be used for cultivating high-yield, high-quality and salt-resistant new varieties, and provides a new molecular tool for genetic improvement of forest salt resistance.

[0016] The embodiment of the application shows that after the CDS sequence of the MYB43 gene is overexpressed in poplar, the salt resistance of the plant can be significantly improved, photosynthesis can be improved, and root system development can be promoted, thereby providing a new idea for cultivating new salt-resistant poplar varieties. BRIEF DESCRIPTION OF DRAWINGS

[0017] In order to more clearly illustrate the technical solutions in the embodiments of the application or the prior art, the drawings needed in the embodiments will be briefly introduced.

[0018] Figure 1 The position of the CDS fragment of the MYB43 gene connected to the pBI121 vector, wherein LB represents the left boundary, and RB represents the right boundary;

[0019] Figure 2 The schematic diagram of gRNA connected to the vector;

[0020] Figure 3 The growth characteristics of wild-type poplar plants and MYB43 overexpression positive plants;

[0021] Figure 4 The plant height statistical results of wild-type poplar plants and MYB43 overexpression positive plants;

[0022] Figure 5To observe the growth traits of wild type poplar plants, positive plants overexpressing MYB43 under 0 mM, 50 mM, 85 mM and 100 mM salt stress, and the root development traits of the plants under 50 mM salt stress;

[0023] Figure 6 To observe the root cross-sections of poplar plants overexpressing MYB43 and knocking out MYB43, and wild type control 。 DETAILED DESCRIPTION

[0024]

[0025] The application further provides the CDS sequence of the tree salt stress resistance gene. As a specific embodiment, the CDS sequence of the tree salt stress resistance gene is as shown in SEQ ID NO.4: 5'-ATGGGG AAGGCAACCATGTTGTGACAAAGTTGGGTTGAAGAAAGGGCCATGGACTTCTGATGAGGATAAGAAACTCATTACCTTCATCCTCGCTAATGGTCAATGTTGCTGGAGAGCTGTTCCTAAGCTTGCAGGATTGTTAAGGTGTGGGAAGAGTTGCAGGCTGAGATGGACAAACTATCTCAGGCCAGATTTGAAGAGAGGTCTTTTATCAGAATACGAAGAGAAGATGGTGATTGATCTCCACGCTCAACTTGGCAACAGATGGTCTAAGATTGCATCACATCTACCCGGCAGAACTGATAATGAAATCAAGAACCATTGGAATACTCACATCAAGAAAAAGTTAAGGAAAATGGGAATTGATCCTCTCACTCACAAGCCACTCTCTACCATTGAAACACCGCCGTCACCACCACCACAGCAAGAAGTTCAAGTGCAGGAGAAAATACAAGAAATAGAGCAGCAAGCTGTACAACAGTCTTGTTCCCCTAATATCGTATCTGAACTGGACCAAAATAAGGAACCTGAGACATCATTACGATCAACAGTAACTCAAGAGGAAGAGATCAATAACATGGCCGCAAGCACATATGGCACAATGGAGCAAACGGATGGTTTTTGCATAGATGAAGTTCCGCTAATTGAACCCCATGAAATCTTAGTCCCTTGTGGACTTTCTCCTTCATCAACCCCAGCCCCAACCTCTTCATCATCGTCATCGACATCATCTTCTTCTTCTTCATATGGTTCAAACAATATCCTTGAAGACTTGCTACTGCCAGATTTTGAATGGCCTATTAATAATGTCGACATTGGCTTGTGGGGTGATTACCTGAACAGTTGGGATGTGCTAATCAGTGATGCTGTCGGTGATTGGAAGCAAACAACAATGTTTGATCCTCCTCTCAATCAGTGCTCAAGAATGATATTGGATCAAGATTCTTGGACAAATGGGCTCTTGTGA-3'.

[0026] The application also provides application of the gene or the CDS sequence in salt stress resistance of trees.

[0027] As a specific embodiment, after overexpression of the CDS sequence of the MYB43 gene in poplar, the salt resistance of the plant can be significantly improved, and photosynthesis can be improved, and root system development can be promoted, thereby providing a new idea for breeding new salt-resistant poplar varieties. The salt can be NaCl.

[0028] The application also provides a pair of primers for amplifying the gene or the CDS sequence, wherein a forward nucleotide sequence of the primer is shown as SEQ ID NO. 2; and a reverse nucleotide sequence of the primer is shown as SEQ ID NO. 3.

[0029] The sequence of the primer is shown as follows:

[0030] The forward primer (SEQ ID NO. 2) is 5'-ATGGGAAGGCAACCATGTTGTG-3',

[0031] The reverse primer (SEQ ID NO. 3) is 5'-TCACAAGAGCCCATTTGTCCAAG-3'.

[0032] The application also provides a recombinant vector comprising the gene or the CDS sequence. After the recombinant vector is introduced into a plant, the MYB43 gene can be overexpressed in the plant, thereby improving the salt resistance of the plant.

[0033] As a preferred solution, the basic skeleton of the recombinant vector comprises a pBI121 vector.

[0034] The application also provides application of the recombinant vector in salt stress resistance of trees. As a specific embodiment, overexpression of the MYB43 gene has a significant promoting effect on the plant height of poplar, which indicates that the MYB43 gene can not only improve the salt resistance of the plant, but also promote the growth characteristics of the plant.

[0035] The application also provides a method for improving salt stress resistance of trees, comprising the following step: overexpression of the gene or the CDS sequence in a target tree genome. As a specific embodiment, a recombinant expression vector can be transformed into cells of a target plant to overexpress the MYB43 gene. The transformation method can be an Agrobacterium transformation method; and the Agrobacterium is preferably GV3101. By overexpression of the MYB43 gene in the plant, a new variety with high yield, high quality and salt resistance can be bred, and the genetic improvement of the salt resistance of the tree has great application value.

[0036] The application also provides application of the gene, the CDS sequence or the recombinant vector in creating salt stress-resistant germplasm resources, and overexpression of the gene or the CDS sequence in a target tree genome.

[0037] Unless otherwise specified, the raw materials for preparing the application have no special requirements, and commercially available products known to those skilled in the art can be used.

[0038] In order to further illustrate the application, the tree salt stress-resistant gene and its application provided by the application are described in detail below in combination with examples, but they should not be understood as limiting the protection scope of the application.

[0039] Examples

[0040] 1. MYB43 gene cloning

[0041] The total RNA of Populus tomentosa "Yiyang No. 3" (Ma, H. Cloning and genetic transformation of sucrose synthase PtSS gene family members and analysis of wood property differences in Populus tomentosa hybrids [D]. Beijing Forestry University, 2015.) was extracted by using the RNAprep Pure Plant Total RNA Extraction Kit (DP432) of TIANGEN, and the detailed operation steps can be found in the kit instruction manual. The extracted RNA was detected by agarose gel electrophoresis, and the result showed that it had clear and obvious bands, indicating that the quality of the extracted RNA met the standard for further testing. The concentration and quality (OD260 / 280 ratio) of the RNA were detected, and the quality (OD260 / 280 ratio) was 1.9, indicating that the sample could be used for subsequent experiments. The cDNA synthesis was performed by using the TAKARA cDNA Synthesis Kit (PrimeScript TM IV 1st strand cDNA Synthesis Mix) with the total RNA of the plant as a template, and the specific operation steps can be found in the product instruction manual. The cDNA was stored at -20℃ for standby use.

[0042] The gene amplification was performed by using the full-type gold high-fidelity gene cloning kit (High Fidelity (HiFi) PCR SuperMix II (-dye) (AS131)). In this embodiment, the CDS fragment (SEQ ID NO. 4) of the MYB43 gene was obtained by the method of RT-PCR with the cDNA of Populus tomentosa "Yiyang No. 3" as a template. The primers used in the RT-PCR were as follows:

[0043] Forward primer F: 5'-ATGGGAAGGCAACCATGTTGTG-3' (SEQ ID NO. 2);

[0044] Reverse primer R: 5'-TCACAAGAGCCCATTTGTCCAAG-3' (SEQ ID NO. 3).

[0045] The amplification system of RT-PCR was 25 μL, specifically: super-faith Taq enzyme 10.0 μL, forward primer 0.5 μL, reverse primer 0.5 μL, buffer 0.5 μL, cDNA template 2.0 μL, ddH2O supplemented to 25 μL; the PCR amplification condition was: pre-denaturation 94℃ 3 min; denaturation 94℃ 10 s, annealing 59℃ 60 s, extension 72℃ 40 s, 40 cycles; the purpose fragment was detected by agarose gel electrophoresis, and the ordinary agarose gel DNA recovery kit of Tian Gen was used for gel recovery, and the specific operation instruction was seen in the kit instruction.

[0046] The CDS fragment of the gel-recovered MYB43 gene was connected to the pEASY-T1 vector to obtain the T1-MYB43 vector. The specific operation steps were seen in the instruction of the full-size pEASY-T1 (Seamless Cloning and Assembly Kit (CU201-02)) kit. The connected vector was transformed into DH5α E. coli competent cells (Shanghai Weidi Biological Company (DL1001M)), and the transformation method was operated according to the instruction of the E. coli competent cells.

[0047] 2. Construction of MYB43 overexpression vector

[0048] (1) Enzymatic digestion: the overexpression vector pBI121 (Complete sequence of the binary vector pBI121 and its application in cloning T-DNA insertion from transgenic plants. DOI: 10.1023 / A:1023475710642) and the T1-MYB43 vector containing the target gene were selected for enzymatic digestion with BamH I as the enzyme digestion site. Incubation was performed at 37℃ for 3 hours to ensure complete cutting of the cutting reaction. The pBI121 vector and the T1-MYB43 vector cut by BamH I were detected by electrophoresis, and the gel was recovered to obtain the linearized pBI121 vector and the CDS fragment of the MYB43 gene; the system and method of enzyme digestion were performed according to the instruction of the BamH I restriction endonuclease (NEW ENGLAND Biolabs BamH I restriction endonuclease (R0136S)).

[0049] (2) Ligation: the Seamless Cloning and Assembly Kit kit to connect the CDS fragment of MYB43 gene with linearized pBI121 vector (the position of CDS connected to the vector is shown in Figure 1 ) to obtain a ligation product. For detailed operation, refer to the kit instruction.

[0050] (3) Transformation: the ligation product was transformed into E. coli DH5a competent cells. The freeze-thaw method (Research on Transformation Efficiency of Different Methods for E. coli and Agrobacterium. Journal of Huaihai Institute of Technology (Natural Science Edition), 2007, (02): 55-58.) was used for cell transformation. The transformation product was uniformly spread on LB agar plates containing 50 mg / L kanamycin for culture.

[0051] (4) Screening: resistant colonies were picked from the LB agar plates, and PCR verification or sequencing was performed to confirm the correctness and directionality of the inserted fragment.

[0052] Plasmid extraction and storage: the plasmid was extracted from the verified positive colonies. The high-purity plasmid extraction kit (DP104) produced by Tiangen Company was used to extract the plasmid of the MYB43 overexpression vector, and the plasmid of the MYB43 overexpression vector was stored at -20°C.

[0053] 3. Genetic transformation of MYB43 overexpression vector

[0054] The competent Agrobacterium GV3101 (AC1001M) was placed on ice, 1 g of plasmid containing the MYB43 overexpression vector was added, and it was mixed thoroughly, and placed on ice for 30 min; it was quickly cooled in liquid nitrogen for about 1 min, and then quickly transferred into a 37°C water bath, and it was melted; 1 mL of YEB liquid medium without antibiotics was added, and it was cultured at 28°C, 230 r / min for 4 h to resuspend the bacterial cells and spread on YEB plates containing 30 mg / L kanamycin and dry, and it was cultured at 28°C for 48 h to obtain Agrobacterium containing the overexpression vector.

[0055] Fresh and disease-free leaves of healthy poplar tissue culture seedlings were selected as leaf disc transformation materials. After surface cleaning and disinfection of the leaves, they were cut into small pieces or blocks.

[0056] The Agrobacterium containing the overexpression vector was cultured on LB medium at 28°C to the logarithmic growth phase.

[0057] The leaves were placed in the resuspended Agrobacterium bacterial solution for co-culture, and then the transformed leaf discs were transferred to the differentiation medium (MS + 1.0 mg / L 6-BA and 0.1 mg / L NAA, pH adjusted to 5.8, agar 8 g / L), and the photoperiod was set to 16 h light / 8 h darkness, and the temperature was maintained at 25°C to promote stable transformation and expression of DNA.

[0058] New shoots were transplanted from differentiation medium to rooting medium to promote plant formation. The overexpression vector pBI121, carrying a selective marker gene (kanamycin resistance), was used to screen transformed leaf discs to obtain positive plants. DNA was extracted from the screened plants and detected by PCR to confirm the presence of the exogenous gene, thus verifying the successful introduction of the overexpression vector.

[0059] 4. Construction of the MYB43 gene editing vector

[0060] (1) gRNA design: The online tool CRISPR-EG (http: / / skl.scau.edu.cn / targetdesign / ) was used to design gRNAs targeting the MYB43 gene by inputting the gene sequence. The first exon was selected as the target site to improve the knockout efficiency. The final gRNA sequence was: 5'-ACCAGTGA CATATCTGAACTGGG-3' (SEQ ID NO. 5).

[0061] (2) Vector construction: The CRISPR / Cas9 vector p2gR-TRI (ACRISPR / Cas9toolkit for multiplex genome editing in plants. https: / / doi.org / 10.1186 / s12870-014-0327-y) suitable for plant cells was selected. Figure 2 As shown, gRNA was ligated into the vector, with insertion sites of: Target-Sense: 5'-TTG-gRNAsense; Target-Anti: 5'-AAC-gRNA anti. This yielded the knockout vector. The construction method for the knockout vector is the same as in "2. Construction of the MYB43 overexpression vector".

[0062] 5. Genetic transformation using the MYB43 gene editing vector

[0063] The genetic transformation method for the MYB43 gene editing vector is the same as that for "3. Genetic transformation of the MYB43 overexpression vector".

[0064] 6. MYB43 overexpression enhances salt tolerance in poplar plants.

[0065] When the MYB43 overexpression poplar transgenic plants and wild type poplar plants (plants without introduction of foreign genes) reached 4 weeks old, the tissue culture seedlings were taken out from the culture medium, transplanted into the prepared soil, placed in the poplar culture room, and soil cultured for 16 weeks, as shown in Figure 3 and Figure 4 It can be seen from Figure 3 and Figure 4 that overexpression of the MYB43 gene has a significant promoting effect on the vertical growth of poplar.

[0066] The MYB43 overexpression plants and wild type poplar plants were subcultured for one month, and the apical buds were placed in a culture medium containing different concentrations of NaCl for sterile culture. The wild type (plants without introduction of foreign genes) and overexpression lines were subjected to 0mM, 50mM, 85mM and 100mM NaCl (the concentration of the salt is the concentration in the culture medium) salt stress treatment for 7 days, as shown in Figure 5 , the overexpression MYB43 gene poplar can grow normally under 50mM NaCl salt treatment compared with the wild type control, and with the increase of salt concentration, the lateral roots of the overexpression MYB43 gene poplar are more developed than the control.

[0067] The root cross section of two-month-old overexpression MYB43 and knockout MYB43 poplar and wild type control was found, as shown in Figure 6 , the red arrow indicates the endodermis cells in the root, and the black arrow indicates the pericycle cells, which have an effect on the development of lateral roots. The lateral roots are usually covered with root hairs, and the presence of root hairs further increases the absorption area, which can more effectively absorb water and dissolved mineral elements in the soil, and then transport these nutrients to the aboveground part of the plant to support the growth and development of organs such as leaves and stems. The endodermis and pericycle cells in the root system of the overexpression MYB43 gene poplar are larger than the control, and show the phenotype of increased lateral roots under salt stress. However, the development of endodermis and pericycle cells in the root system of the knockout MYB43 poplar is slow, which affects the generation of lateral roots and further affects the development of the plant.

[0068] It can be seen that the overexpression of the MYB43 gene in poplar can significantly improve the salt resistance of the plant, and does not inhibit the growth characteristics of the plant, and the change in the root is the key to salt stress resistance, the increase of lateral roots regulated in the endodermis and pericycle cells, and the absorption and utilization efficiency of water and nutrients by the root system under stress is enhanced. The high salt resistance of the MYB43 gene provided by the present application provides a new idea for breeding salt-tolerant poplar new varieties.

[0069] Although the above embodiments have been described in detail, it should be understood that these are only some embodiments of the present application, but not all embodiments. Other embodiments can be obtained on the basis of the above embodiments without creativity, and these embodiments all belong to the protection scope of the present application.

Claims

1. Application of a coding nucleic acid overexpressing a MYB43 gene in salt stress resistance of Populus tomentosa, characterized in that, The sequence of the coding nucleic acid is shown as SEQ ID NO.

4.

2. Use of a recombinant vector comprising a MYB43 gene encoding nucleic acid in salt stress resistance of Populus tomentosa, characterized in that, The sequence of the coding nucleic acid is shown as SEQ ID NO.

4.

3. Use according to claim 2, characterized in that, The basic skeleton of the recombinant vector comprises a pBI121 vector.

4. A method of enhancing salt stress tolerance in a tree, the method comprising, The method comprises the following steps: overexpressing a coding nucleic acid of the MYB43 gene in the genome of the target tree; the sequence of the coding nucleic acid is shown as SEQ ID NO. 4; The tree is Populus tomentosa.

5. Use of a MYB43 gene coding nucleic acid in creating a salt stress-resistant germplasm resource, characterized in that, overexpressing a coding nucleic acid of the MYB43 gene in the genome of the target tree; the sequence of the coding nucleic acid is shown as SEQ ID NO. 4; and the tree is Populus tomentosa.

Images