KASP molecular marker method related to peanut aspergillus flavus seed kernel infection resistance and application of KASP molecular marker method

Abstract

The invention belongs to the field of molecular genetic breeding, and particularly relates to a KASP molecular marker method related to peanut aspergillus flavus seed kernel infection resistance and application of the KASP molecular marker method. Through whole genome association analysis, the SNP locus is located at the 133198521th bp position of the peanut B06 chromosome (the reference genome is peanut), the nucleotide sequence polymorphism is C / A (the antisense strand is G / T), and the SNP locus is named as qARIB06. Based on the SNP site, KASP molecular marker primer sequences (SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3) are designed and developed, and the KASP molecular marker primer sequences are used for rapidly and accurately identifying the genotype of a peanut sample.

Description

Technical Field

[0001] The invention relates to the field of molecular genetic breeding, and in particular to a KASP molecular marker method related to peanut aflatoxin seed kernel infection resistance and an application thereof. Background Art

[0002] Aflatoxin (AFTs) is a highly toxic biological toxin produced by Aspergillus flavus and Aspergillus parasiticus, and its hazards cannot be ignored. AFB1 in AFTs is the most carcinogenic fungal toxin among the currently known carcinogens, posing a serious threat to animal production performance and human health. With the global temperature rising year by year and the intensification of drought, the problem of aflatoxin contamination has become increasingly serious and has become an important factor affecting food safety. As an important oil-bearing economic crop in the world, the safe production of peanuts is of great significance to ensuring the safe supply of edible oil. However, peanuts are susceptible to aflatoxin contamination. Therefore, cultivating varieties resistant to aflatoxin infection has become the key to solving the problem of aflatoxin contamination in peanuts.

[0003] Traditional breeding methods mainly rely on phenotypic selection, which is time-consuming, inefficient, and difficult to accurately screen out peanut varieties with resistance to Aspergillus flavus. With the development of peanut genome analysis and sequencing technology, genome-wide association analysis (GWAS) has become an effective means to explore key crop genes and related genetic mechanisms. GWAS can perform association analysis on traits across the entire genome and reveal the genetic basis for the formation of important agronomic traits. However, there are few reports on loci related to peanut resistance to Aspergillus flavus infection, which limits the application of molecular marker-assisted breeding.

[0004] In order to solve the above problems, the applicant proposed a KASP molecular marker method related to peanut aflatoxin infection resistance and its application. Summary of the invention

[0005] The object of the present invention is to provide a KASP molecular marker method related to the infection resistance of peanut Aspergillus flavus kernel and its application, so as to solve the problems in the prior art.

[0006] To achieve the above-mentioned object, the present invention provides the following technical scheme: a KASP molecular marker method related to peanut aflatoxin infection resistance, characterized in that the molecular marker is based on a significant SNP site (named as qARI_B06) at 133198521bp on peanut chromosome B06, whose nucleotide sequence polymorphism is C / A (antisense strand is G / T), located in the first exon of the candidate key gene AhZIP1, and a KASP molecular marker primer sequence is developed, specifically as shown in SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3.

[0007] Optionally, SEQ ID NO.1 is a forward primer, and its sequence is: AGGAGGTTTGAATTCATTGGCGT; SEQ ID NO.2 is a specific sequence reverse primer that binds to FAM fluorescence, and its sequence is: ACTCTCATTCTCTCACTTACAATCATGG; SEQ ID NO.3 is a specific sequence reverse primer that binds to HEX fluorescence, and its sequence is: ACTCTCATTCTCTCACTTACAATCATGT.

[0008] Optionally, the method comprises the following steps:

[0009] Extract genomic DNA from peanut leaves;

[0010] The extracted genomic DNA was amplified by PCR using the KASP molecular marker primer sequences shown in SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3;

[0011] Prepare a PCR reaction system, wherein the total PCR reaction system is 5 μl, including 2.43 μl of genomic DNA, 2.5 μl of 2×KASP Master Mix, and 0.07 μl of KASP Assay Mix (primer mixed working solution);

[0012] Amplification was performed according to a specific PCR reaction program, and the PCR results were scanned and analyzed by a KASP fluorescence analyzer to determine the genotype of the peanut sample.

[0013] Optionally, the PCR reaction program is: step one, 94°C, 15 min; step two, 94°C, 20 s, 61-55°C gradient PCR, 1 min, reducing 0.6°C in each cycle, for 10 cycles; step three, 94°C, 20 s, 55°C, 1 min, for 26 cycles; step four, store at 10°C.

[0014] Optional, including:

[0015] Using the KASP molecular marker to identify the genetic haplotype of the hybrid offspring individual plants;

[0016] According to the haplotype identified by amplification, the resistance type of the offspring individual plants is determined:

[0017] If the haplotype is AA, it indicates that the locus carried by the individual plant is the resistant type;

[0018] If the haplotype is CA, it indicates that the individual plant carries a heterozygous locus, which can be screened and retained and the haplotype can be screened again in the self-pollinated progeny;

[0019] If the haplotype is CC, it indicates that the locus carried by the individual plant is aflatoxin susceptible type, and whether to retain the individual plant can be selected according to breeding needs.

[0020] An application of SNP sites related to resistance to infection by Aspergillus flavus in peanut kernels, characterized in that the method uses the KASP molecular marker described in claim 1 to detect the SNP site at 133198521 bp on chromosome B06 in peanut samples through PCR amplification and fluorescence analysis.

[0021] Beneficial effects:

[0022] The purpose of the present invention is to locate significant SNP loci associated with aflatoxin resistance in peanut kernels through GWAS, and to develop KASP molecular markers based on these loci to achieve rapid and accurate genotype identification and improve the breeding efficiency of aflatoxin-resistant peanut varieties. The highlights of the present invention are:

[0023] Precise positioning: GWAS was used to precisely locate SNP sites associated with peanut aflatoxin kernel resistance across the entire genome.

[0024] Efficient markers: Design KASP primers based on the located SNP sites and develop efficient and economical KASP molecular markers.

[0025] Rapid identification: Use KASP typing technology to quickly and accurately identify the genotype of the peanut sample to be tested.

[0026] Breeding acceleration: Provide powerful tools for molecular marker-assisted selection to accelerate the breeding process of aflatoxin-resistant peanut varieties.

[0027] The present invention aims to locate significant single nucleotide polymorphism (SNP) sites associated with peanut aflatoxin resistance through GWAS, and develop KASP molecular markers based on these sites. KASP molecular markers are a molecular marker method based on competitive allele-specific PCR (Kompetitive Allele Specific PCR) technology, which has the advantages of high throughput, low cost, and easy operation. Using KASP molecular markers, rapid and accurate identification of peanut aflatoxin resistance can be achieved, thereby improving the breeding efficiency of peanut varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 A genome-wide association analysis of peanut kernel resistance to Aspergillus flavus infection;

[0029] Figure 2 The analysis of different haplotypes of SNP locus B06_133198521 and the resistance index of peanut kernel to aflatoxin infection;

[0030] Figure 3 The KASP marker typing results in 43 peanut cultivars. DETAILED DESCRIPTION

[0031] The following describes the preferred embodiments of the present invention with reference to the drawings in the specification, so that the technical content is clearer and easier to understand. The present invention can be embodied in many different forms of embodiments, and the protection scope of the present invention is not limited to the embodiments mentioned in the text.

[0032] In the drawings, components with the same structure are indicated by the same numerical reference numerals, and components with similar structures or functions are indicated by similar numerical reference numerals. The size and thickness of each component shown in the drawings are arbitrarily shown, and the present invention does not limit the size and thickness of each component. In order to make the illustration clearer, the thickness of the components is appropriately exaggerated in some places in the drawings.

[0033] Example 1

[0034] The present invention uses peanut genome-wide association analysis to discover a new significant SNP site associated with peanut aflatoxin seed kernel infection resistance, and develops and provides related KASP molecular markers and their applications. The technical solution is as follows:

[0035] In the first aspect, the present invention provides a significant SNP site closely related to the resistance of peanut kernel to Aspergillus flavus and its candidate gene. This key discovery is based on the in-depth analysis and research of the whole peanut genome. The SNP site is precisely located at the 133198521bp position of the peanut B06 chromosome (the reference genome is Arachis subtilis), and its nucleotide sequence polymorphism is C / A (the antisense strand is G / T), and we named it qARI_B06. This site is located in a critical 100kb positioning interval, specifically ranging from 133148521bp to 133248521bp of the B06 chromosome. More specifically, this significant SNP site B06_133198521 is located on the first exon of the candidate key gene AhZIP1, and there is a single base nucleotide mutation, namely G->T, which causes the second amino acid of the AhZIP1 gene to change from alanine (A) to serine (S). This discovery provides important clues for understanding the genetic mechanism of peanut kernel resistance to Aspergillus flavus.

[0036] Based on the above critical SNP site, the present invention further develops and provides KASP molecular marker primers with practical value. The specific sequences of these primers are listed in detail in Table 1, including the universal forward primer of SEQ ID NO.1, the FAM fluorescence-binding specific sequence reverse primer R1 of SEQ ID NO.2, and the HEX fluorescence-binding specific sequence reverse primer R2 of SEQ ID NO.3. These carefully designed primers will play a vital role in the subsequent PCR amplification and genotyping process.

[0037] Table 1 KASP molecular marker primers developed based on the resistance locus of peanut kernel to aflatoxin infection

[0038]

[0039] In the second aspect, the present invention proposes an efficient and accurate method for genotyping peanut kernels for resistance to aflatoxin infection. This method first requires the extraction of high-quality genomic DNA from peanut leaves. Subsequently, the extracted genomic DNA is PCR amplified using the above-mentioned carefully designed KASP marker primer sequence. The preparation of the PCR amplification reaction system is very particular, with a total volume of 5μl, including 2.43μl of genomic DNA, 2.5μl of 2×KASP Master Mix and 0.07μl of KASP Assay Mix (i.e., primer mixed working solution). The primer mixed working solution consists of a universal forward primer (F), a FAM fluorescence-bound specific sequence reverse primer (R1), a HEX fluorescence-bound specific sequence reverse primer (R2) and pure water. The setting of PCR reaction program is also very important, including pre-denaturation step (94°C, 15 minutes), denaturation and annealing step (94°C, 20 seconds; 61-55°C gradient PCR, 1 minute, a total of 10 cycles, each cycle lowering 0.6°C), re-denaturation and extension step (94°C, 20 seconds; 55°C, 1 minute, a total of 26 cycles), and finally stored at 10°C. After amplification, the PCR results are scanned and analyzed by the advanced KASP fluorescence analyzer Pherastar to obtain accurate genotyping results.

[0040] In the third aspect, the present invention also elaborates on the practical application value of the above KASP molecular marker in peanut breeding. When the above KASP marker is used to identify the gene haplotype of the hybrid offspring, we can judge the resistance of the offspring to aflatoxin infection based on the haplotype type identified by amplification. If the haplotype identified by amplification of the offspring single plant is AA (which is consistent with the haplotype of the parent resistant to aflatoxin infection, corresponding to the signal of reverse primer R2), it indicates that the locus carried by the single plant is of the resistant type and has the potential to resist aflatoxin infection; if the heterozygous haplotype CA is identified by amplification of the offspring single plant, it indicates that the single plant carries a heterozygous locus, and such a single plant can be screened and retained and haplotype screening is performed again in the subsequent self-pollinated offspring until a homozygous single plant is obtained; if the haplotype identified by amplification of the offspring single plant is CC (which is consistent with the haplotype of the parent susceptible to aflatoxin infection, corresponding to the signal of reverse primer R1), it indicates that the locus carried by the single plant is of the susceptible type to aflatoxin, and whether to retain the single plant can be selected according to actual needs during the breeding process. This application not only greatly improves the breeding efficiency of peanut varieties resistant to aflatoxin, but also brings a revolutionary breakthrough in the field of peanut breeding.

[0041] The successful completion of this invention benefited from the strong support and funding of the National Key R&D Program of China (2023YFD1202800).

[0042] The above shows and describes the basic principles and main features of the present invention and the advantages of the present invention. It is obvious to those skilled in the art that the present invention is not limited to the details of the above exemplary embodiments, and the present invention can be implemented in other specific forms without departing from the spirit or basic features of the present invention. Therefore, no matter from which point of view, the embodiments should be regarded as exemplary and non-restrictive. The scope of the present invention is defined by the attached claims rather than the above description, and it is intended that all changes falling within the meaning and scope of the equivalent elements of the claims are included in the present invention. Any figure mark in the claims should not be regarded as limiting the claims involved.

[0043] In addition, it should be understood that although the present specification is described according to implementation modes, not every implementation mode contains only one independent technical solution. This description of the specification is only for the sake of clarity. Those skilled in the art should regard the specification as a whole. The technical solutions in each embodiment may also be appropriately combined to form other implementation modes that can be understood by those skilled in the art.

Claims

1. A KASP molecular marker method related to peanut aflatoxin infection resistance, characterized in that: The molecular marker is based on a significant SNP site at 133198521bp on peanut chromosome B06 (named qARI_B06), whose nucleotide sequence polymorphism is C / A (antisense strand is G / T), located in the first exon of the candidate key gene AhZIP1, and a KASP molecular marker primer sequence was developed, specifically as shown in SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.

3.

2. The KASP molecular marker according to claim 1, characterized in that SEQ ID NO.1 is a forward primer, and its sequence is: AGGAGGTTTGAATTCATTGGCGT; SEQ ID NO.2 is a specific sequence reverse primer that binds to FAM fluorescence, and its sequence is: ACTCTCATTCTCTCACTTACAATCATGG; SEQ ID NO.3 is a specific sequence reverse primer that binds to HEX fluorescence, and its sequence is: ACTCTCATTCTCTCACTTACAATCATGT.

3. The KASP molecular marker method related to peanut aflatoxin infection resistance according to claim 2, characterized in that: The method comprises the following steps: Extract genomic DNA from peanut leaves; The extracted genomic DNA was amplified by PCR using the KASP molecular marker primer sequences shown in SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3; Prepare PCR reaction system, wherein the total PCR reaction system is 5 μl, including 2.43 μl genomic DNA, 2.5 μl 2×KASP Master Mix, and 0.07 μl KASPAssay Mix (primer mixed working solution); Amplification was performed according to a specific PCR reaction program, and the PCR results were scanned and analyzed by a KASP fluorescence analyzer to determine the genotype of the peanut sample.

4. A KASP molecular marker method related to peanut aflatoxin infection resistance according to claim 3, characterized in that: The PCR reaction program was as follows: step one, 94°C, 15 min; step two, 94°C, 20 s, 61-55°C gradient PCR, 1 min, decreasing 0.6°C in each cycle, for 10 cycles; step three, 94°C, 20 s, 55°C, 1 min, for 26 cycles; step four, storage at 10°C.

5. The KASP molecular marker method related to the infection resistance of peanut kernels with Aspergillus flavus according to claim 2, characterized in that: include: Using the KASP molecular marker to identify the genetic haplotype of the hybrid offspring individual plants; According to the haplotype identified by amplification, the resistance type of the offspring individual plants is determined: If the haplotype is AA, it indicates that the locus carried by the individual plant is the resistant type; If the haplotype is CA, it indicates that the individual plant carries a heterozygous locus, which can be screened and retained and the haplotype can be screened again in the self-pollinated progeny; If the haplotype is CC, it indicates that the locus carried by the individual plant is aflatoxin susceptible type, and whether to retain the individual plant can be selected according to breeding needs.

6. An application of SNP sites related to the infection resistance of peanut kernels to Aspergillus flavus, characterized in that: The method uses the KASP molecular marker described in claim 1 to detect the SNP site at the 133198521 bp on the B06 chromosome in the peanut sample through PCR amplification and fluorescence analysis.

Images