RNA interference oligonucleotides for inhibiting perineuronal network formation

Abstract

The present invention discloses RNA interference (RNAi) oligonucleotides, such as siRNA and shRNA, that inhibit the expression of proteins involved in the formation of the perineuronal network. In particular, RNAi oligonucleotides that inhibit the expression of neuroproteoglycan or tendinogenic protein-Rare are provided. An extracellular vesicle comprising the RNAi molecule and a pharmaceutical composition comprising the RNAi oligonucleotide or the extracellular vesicle are also provided. Also disclosed is the use of such pharmaceutical compositions in the treatment of nerve damage or injury.

Description

Technical Field

[0001] The present invention relates to RNA interference (RNAi) oligonucleotides, extracellular vesicles, and compositions containing the RNAi oligonucleotides or extracellular vesicles for inhibiting the expression of proteins involved in perineuronal network formation, and uses thereof. Background Art

[0002] Spinal cord injury is considered a chronic, irreversible condition. To date, there are no effective treatments that can lead to functional recovery after severe spinal cord injury. Several neural mechanisms are behind the limited ability of neurons to regenerate after transection. One of these mechanisms is the perineuronal network (PNN), an extracellular matrix that inhibits the plasticity of neurons in adulthood, thereby also limiting their regenerative capacity.

[0003] The PNN is composed of several proteins of the lectican family of chondroitin sulfate proteoglycans (CsPG): neurocan (NCAN), tenascin-R (TNR), versican (VCAN) and brevican (BCAN) and aggrecan (ACAN), which are highly organized into a ternary stable structure. These proteins are synthesized by neurons to maintain synaptic stability in the adult brain. PNN is a dynamic scaffold involved in the regulation of plasticity. Pathological studies have shown that after spinal cord injury (SCI), the expression of CsPG in the lesion area is significantly increased, which is most likely to hinder the regeneration and plasticity of axons after SCI.

[0004] Protein inhibition using siRNA in the central nervous system (CNS) requires a smart delivery method that can carry siRNA into target cells and maintain their functionality. Exosomes are small lipid nanovesicles that naturally serve as intercellular communication. Several studies have shown that exosomes can be loaded and used as carriers of therapeutic agents.

[0005] Guo et al., (ACS Nano.2019; 13(9): 10015-10028.doi: 10.1021 / acsnano.9b01892; Perets et al., Nano Lett.2019; 19(6): 3422-3431.doi: 10.1021 / acs.nanolett.8b04148) have previously shown that exosomes derived from mesenchymal stem cells (MSC-exo) can specifically accumulate in inflammatory areas in the CNS after intranasal administration. Specifically, WO 2019186558 confirmed that MSC-exo can load siRNA for phosphatase and tensin homolog (PTEN) for delivery and promotion of spinal cord regeneration after complete transection. Since siRNA inhibits the expression of specific proteins in cells, the delivery method needs to maintain this ability and enable siRNA to be taken up by target cells. Exosomes are an excellent delivery system in this regard because they are naturally taken up by their target cells.

[0006] Several methods have been demonstrated to decompose PNNs in order to study their functions. The most common strategy for PNN decomposition involves enzymatic digestion of PNNs using chondroitinase ABC (O'Dell DE, Schreurs BG, Smith-Bell C, Wang D. Neurobiol Learn Mem. 2021; 177 (December 2020): 107358. doi: 10.1016 / j.nlm.2020.107358). Chondroitinase ABC (ChABC) is an enzyme obtained from a bacterium called Proteus vulgaris that works by degrading the glycosaminoglycan side chains of CSPGs. It has been shown that the use of ChABC can temporarily degrade PNNs, allowing neuronal regeneration in the spinal cord after injury. However, ChABC does not selectively degrade specific PNN proteins and may have a range of effects on several other mechanisms (such as immunomodulatory responses) by affecting IL-10. Currently, there are no effective methods and other therapies available to deal with PNN instability. Such an approach could be an effective treatment in the setting of spinal cord injury and is therefore highly desirable. Summary of the invention

[0007] The present invention is based on the development of novel RNA interference (RNAi) oligonucleotides (e.g., siRNA molecules) capable of inhibiting the expression of several proteins that play an important role in the formation of perineuronal networks (PNNs). Specifically, inhibition of neurocan (NCAN), tenascin-R (TNR), or both is achieved.

[0008] As mentioned earlier, PNNs are mainly observed in mature neurons and are involved in plasticity restriction. Therefore, interfering with the formation of PNNs allows greater neuroplasticity and subsequent neural regeneration. Unlike enzymatic degradation, RNA-based inhibition of protein expression is more specific and controllable. Since PNN is a protein-based structure, its structure can be destroyed by inhibiting the expression of one of the proteins that form it. Extracellular vesicles (EVs) derived from mesenchymal stem cells (MSC-exo) are used as a delivery system. These EVs have previously been shown to have a natural ability to accumulate in inflammatory areas and have also exhibited natural therapeutic abilities. Therefore, it is expected that there will be an additive or even synergistic effect between short-term inhibition of PNN formation and MSC-exo. The present invention relates to RNAi oligonucleotides capable of inhibiting the expression of proteins that are part of the PNN matrix, in particular RNAi that inhibits the expression of proteins selected from neurocan (NCAN), tenascin-R (TNR), aggrecan (ACAN), versican (VCAN) and brevican (BCAN), to isolated EVs containing the RNAi molecules or a combination thereof, and to pharmaceutical compositions containing the EVs and their use in the treatment of neurological disorders.

[0009] According to one aspect, the present invention provides an RNAi oligonucleotide selected from siRNA and shRNA, comprising a guide strand, and inhibiting the expression of a protein of the perineuronal network. According to some examples, the protein of the perineuronal network is selected from neurocan (NCAN) and tenascin-R (TNR). According to an example, the present invention provides an RNA interference (RNAi) oligonucleotide selected from siRNA and shRNA, comprising a guide strand containing a nucleic acid sequence selected from SEQ ID NO: 1-5 and 30-43. In some examples, the RNAi oligonucleotide comprising a guide strand containing a nucleic acid sequence selected from SEQ ID NO: 1-5 is used to inhibit the expression of neurocan (NCAN). In some examples, the RNAi oligonucleotide comprising a guide strand containing a nucleic acid sequence selected from SEQ ID NO: 30-43 is used to inhibit the expression of tenascin-R (TNR). Therefore, in some instances, the present invention provides an RNA interference (RNAi) oligonucleotide selected from siRNA and shRNA, which comprises a guide chain containing a nucleic acid sequence selected from SEQ IDNO: 1-5 and 30-43, and is used to inhibit the expression of a protein of the perineuronal network selected from neurocan (NCAN) and tenascin-R (TNR).

[0010] According to some examples, the present invention provides an RNA interference (RNAi) oligonucleotide comprising a guide chain containing a nucleic acid sequence selected from SEQ ID NO: 1-5, 11-15 and 86-95, wherein the RNAi oligonucleotide inhibits the expression of neurocan. According to some examples, the RNAi oligonucleotide is selected from siRNA and shRNA. According to some examples, the RNAi oligonucleotide is siRNA, and the guide chain consists of a nucleic acid sequence selected from SEQ ID NO: 1-5, 11-15 and 86-95. According to some examples, the RNAi oligonucleotide comprises a chain complementary to the guide chain, wherein the complementary chain is complementary to at least 14, 15, 16, 17, 18, 19, 20 or 21 consecutive nucleotides of the guide chain. According to some examples, the complementary chain comprises 14 to 19 nucleotides. According to some examples, the complementary chain comprises a nucleic acid sequence selected from SEQ ID NO: 6-10, 16-20 and 96-105.

[0011] According to other examples, the present invention provides an RNA interference (RNAi) oligonucleotide comprising a guide chain containing a nucleic acid sequence selected from SEQ ID NOs: 30-43 and 58-71, wherein the RNAi oligonucleotide inhibits the expression of tenascin-R (TNR). According to some examples, the RNAi oligonucleotide is selected from siRNA and shRNA. According to some examples, the RNAi oligonucleotide is siRNA, and wherein the guide chain consists of a nucleic acid sequence selected from SEQ ID NOs: 58-71. According to some examples, the RNAi comprises a chain complementary to the guide chain, wherein the complementary chain is complementary to at least 14, 15, 16, 17, 18, 19, 20 or 21 consecutive nucleotides of the guide chain. According to some examples, the complementary chain comprises 14 to 19 nucleotides. According to some examples, the complementary chain comprises a nucleic acid sequence selected from SEQ ID NOs: 44-57 and 72-85.

[0012] According to some examples, the invention provides a conjugate of an RNAi as defined above and another part. According to some examples, the RNAi is coupled to a hydrophobic molecule such as selected from sterols, gangliosides, lipids, vitamins, fatty acids, hydrophobic peptides and combinations thereof. According to some examples, the RNAi is coupled to a hydrophilic part. In some examples, the hydrophilic part is a carbohydrate. In some examples, the carbohydrate is selected from glucose and sucrose.

[0013] According to another aspect, the present invention provides isolated extracellular vesicles (EVs) comprising RNA interference (RNAi) oligonucleotides that inhibit the expression of proteins of the perineuronal network. In some instances, the RNAi oligonucleotides are selected from siRNA and shRNA. In some instances, the proteins of the perineuronal network are selected from neurocan (NCAN), tenascin-R, aggrecan (ACAN), versican (VCAN), short protein glycan (BCAN) and combinations thereof. According to some instances, the EVs are selected from exosomes, microvesicles and combinations thereof. According to some instances, the isolated EVs comprise RNAi oligonucleotides that inhibit the expression of NCAN as described in the present application. According to some embodiments, the isolated EVs comprise RNAi oligonucleotides that inhibit the expression of tenascin-R as described in the present application.

[0014] According to another aspect, the present invention provides a pharmaceutical composition comprising an RNAi oligonucleotide or an isolated EV as defined in the examples and embodiments of the present application, and a pharmaceutically acceptable carrier. According to some embodiments, the pharmaceutical composition is formulated for administration by an administration route selected from intranasal, internal damage, intrathecal, intravenous, intramuscular, subcutaneous, sublingual, oral and intracerebral administration routes. According to some embodiments, the pharmaceutical composition is used to treat neuronal damage or damage in a subject. According to some embodiments, the pharmaceutical composition is used to increase neuroplasticity and / or neural regeneration, optionally after neuronal damage or damage. According to one embodiment, the neuronal damage or damage is spinal cord injury (SCI). According to some specific embodiments, the composition is used for intranasal administration including the composition.

[0015] According to another aspect, the present invention provides a method for treating neuronal injury or damage in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of isolated extracellular vesicles, the vesicles comprising an inhibitor of expression of a protein selected from neurocan (NCAN), tenascin-R (TNR), aggrecan (ACAN), versican (VCAN), brevican (BCAN) and combinations thereof. According to some embodiments, the method comprises administering an EV comprising an RNAi oligonucleotide of the present invention that inhibits expression of NCAN and / or TNR. According to some embodiments, the method comprises administering the EV intranasally. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 Shown in the use of Lipofectamine TMEffects of different anti-TNR siRNAs (20 nM) on TNR gene expression in SK-N-SH cells transfected with 3000 reagent. Relative expression was assessed by qRT-PCR using TaqMan probes. The expression of the GAPDH gene was used as an internal control.

[0017] Figure 2 Shown in the use of Lipofectamine TM Effects of TNR1, TNR2, TNR7, and TNR8 siRNA (20 nM) on TNR expression in SK-N-SH cells transfected with 3000 reagent for 24 hours. Relative expression was assessed by qRT-PCR using TaqMan probes. The expression of the GAPDH gene was used as an internal control.

[0018] Figure 3 Shown in the use of Lipofectamine TM Effects of different anti-NCAN siRNAs (20 nM) on NCAN gene expression in SK-N-SH cells transfected with 3000 reagent. NCAN1 siRNA is represented as duplex 1, NCAN2 as duplex 2, NCAN5 = duplex 5, NCAN6 = duplex 6, NCAN7 = duplex 7, NCAN8 = duplex 8.

[0019] Figure 4 Shown are the effects of transfection of SK-N-SH cells with 10 or 20 nm NCAN5 or NCAN6 siRNA for 48 h on NCAN gene expression.

[0020] Figure 5 Shown is the efficacy of NCAN5 and NCAN6 siRNAs on NCAN gene expression compared to commercially available anti-NCAN siRNAs IDT1, IDT2, and IDT3.

[0021] Fig. 6A and 6B The NCAN gene expression was shown in SK-N-SH cells transfected with 20 nm NCAN5 and NCAN6 siRNA for 48 hours. Fig. 6A ) and protein ( Figure 6B ) expression. At 48 hr after transfection, RNA was isolated and culture medium was collected. Protein levels were assessed using NCAN ELISA kit. Relative expression was assessed by qRT-PCR using TaqMan probes. DETAILED DESCRIPTION

[0022] Unless otherwise defined, all technical and / or scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention belongs. In the event of conflict, the patent specification, including definitions, will control.

[0023] The present invention provides RNA interference oligonucleotides such as siRNA or shRNA, which are capable of inhibiting the expression of at least one protein that forms a perineuronal network (PNN), and subsequently inhibiting the formation of the PNN. Such oligonucleotides can be used to allow nerve regeneration after neuronal injury or damage, which is usually inhibited or prevented by the formation of PNN.

[0024] NCAN

[0025] In one aspect, the present invention provides an RNA silencing oligonucleotide for inhibiting the expression of neurocan. According to some embodiments, the RNA silencing oligonucleotide is an RNA interference (RNAi) oligonucleotide. According to some embodiments, the RNAi oligonucleotide (i.e., siRNA or shRNA) is designed to bind to the sequence of NCAN mRNA within the region of base numbers 1000 to 1300, preferably within the region of base numbers 1100 to 1200 in the sequence SEQ ID NO: 21. According to some embodiments, the RNAi oligonucleotide (i.e., siRNA or shRNA) is designed to bind to the sequence of NCAN mRNA within the region of base numbers 3700 to 4000, preferably within the region of base numbers 3800 to 3900 in the sequence SEQ ID NO: 21. According to some embodiments, the RNAi oligonucleotide (i.e., siRNA or shRNA) is designed to bind to the sequence of NCAN mRNA within the region of base numbers 500 to 800, preferably within the region of base numbers 600 to 700 in the sequence SEQ ID NO: 21. According to some embodiments, the RNAi comprises a guide strand comprising a nucleic acid sequence selected from SEQ ID NOs: 1-5. According to some embodiments, the RNAi is selected from siRNA and shRNA. Therefore, according to some embodiments, the present invention provides an RNA interference (RNAi) oligonucleotide selected from siRNA and shRNA, which comprises a guide strand comprising a nucleic acid sequence selected from SEQ ID NOs: 1-5. According to some embodiments, the RNAi oligonucleotide is used to inhibit the expression of neurocan. The sequences of the present invention are summarized in Table 1. According to some embodiments, the RNAi (e.g., siRNA and shRNA) comprises a guide strand comprising a nucleic acid sequence selected from SEQ ID NOs: 11-15.

[0026] As used herein, the term "polynucleotide" refers to a long nucleic acid comprising more than 150 nucleotides. As used herein, the term "oligonucleotide" refers to a short single-stranded or double-stranded sequence of nucleic acid such as ribonucleic acid (RNA), deoxyribonucleic acid (DNA) or its analogs, and the nucleic acid generally has less than or equal to 150 nucleotides. According to some embodiments, the oligonucleotide is composed of 2 to 150, 10 to 100 or 14 to 50 nucleotides. According to other embodiments, the oligonucleotide is composed of 15 to 40, 17 to 35 or 18 to 30 nucleotides.

[0027] The terms "RNA silencing agent", "RNA silencing molecule" and "RNA silencing oligonucleotide" as used herein are used interchangeably herein and refer to RNA that can inhibit or "silence" the expression of a target gene. In certain embodiments, the RNA silencing agent can prevent the complete processing (e.g., complete translation and / or expression) of an mRNA molecule by a post-transcriptional silencing mechanism, such as by RNA interference degradation of mRNA. RNA silencing agents include non-coding RNA molecules, such as RNA duplexes comprising paired chains, and precursor RNAs that can produce such small non-coding RNAs. Exemplary RNA silencing agents (also referred to as RNA interference oligonucleotides) include dsRNA, such as siRNA, miRNA and shRNA. In one embodiment, the RNA silencing agent can induce RNA interference. In another embodiment, the RNA silencing agent can mediate translation repression.

[0028] The term "RNA interference" refers to the process of sequence-specific post-transcriptional gene silencing mediated by RNA interference oligonucleotides such as short interfering RNA (siRNA) and shRNA in animals. The corresponding process in plants is generally referred to as post-transcriptional gene silencing or RNA silencing, and is also referred to as suppression in fungi. The process of post-transcriptional gene silencing is considered to be an evolutionarily conservative cellular defense mechanism for preventing the expression of foreign genes, and is generally shared by diverse flora and phyla. This protection against foreign gene expression may be a response to the production of double-stranded RNA (dsRNA) derived from viral infection or random integration of transposon elements in the host genome, and evolved by specifically destroying homologous single-stranded RNA or viral genomic RNA.

[0029] The presence of long dsRNA in cells stimulates the activity of a ribonuclease III enzyme known as dicer. Dicer participates in processing dsRNA into short dsRNA fragments known as short interfering RNA (siRNA). The length of the short interfering RNA derived from dicer activity is generally about 21 to about 23 nucleotides, and comprises a duplex of about 19 base pairs. Another feature of the RNAi response is a kind of endonuclease complex, commonly referred to as RNA induced silencing complex (RISC), which mediates the cutting of single-stranded RNA with a sequence complementary to the antisense strand of the siRNA duplex. The cutting of the target RNA occurs in the middle of the region complementary to the antisense strand of the siRNA duplex.

[0030] The terms "small interfering RNA" and "siRNA" refer to small inhibitory RNA duplexes (usually between 18-30 base pairs) that induce RNA interference (RNAi) pathways. Typically, siRNA is chemically synthesized in the form of 21mer, with a 19bp duplex region at the center and a symmetrical 2 base 3'-single-stranded overhang at the end, although the chemically synthesized 25-30 base-long RNA duplexes have recently been described to be compared with 21mer, and the effectiveness at the same position can be improved by up to 100 times. The observed increased effectiveness obtained when using longer RNA to trigger RNAi is theoretically due to providing a substrate (27mer) rather than a product (21mer) for Dicer, which improves the rate or efficiency of siRNA duplexes entering RISC. Shorter siRNAs include, for example, 19 to 20 nucleotides (nt) in the mRNA binding chain. Typically, artificial siRNAs appear as 21mer guide (antisense) chain oligonucleotides interacting with mRNA and a shorter complementary chain (justice, usually 19mer) complementary to the guide chain. As used herein, the term "complementary" refers to the ability of a first polynucleotide to hybridize to a second polynucleotide under certain conditions.

[0031] It has been found that the position of the 3'-single-stranded overhang affects the potency of the siRNA, and that asymmetric duplexes with a 3'-single-stranded overhang on the antisense strand are generally more potent than duplexes with a 3'-single-stranded overhang on the sense strand. This can be attributed to asymmetric strand loading in RISC, as the opposite pattern of efficacy was observed when targeting antisense transcripts.

[0032] According to some embodiments, the RNAi is siRNA. According to some embodiments, the siRNA that inhibits NCAN expression comprises a guide strand comprising a nucleic acid sequence selected from SEQ ID NOs: 1-5. According to some embodiments, the siRNA that inhibits NCAN expression comprises a guide strand comprising a nucleic acid sequence selected from SEQ ID NOs: 11-15 and 86-95. According to some embodiments, the siRNA that inhibits NCAN expression comprises a guide strand comprising a nucleic acid sequence selected from SEQ ID NOs: 11-15 and 86-95. According to some embodiments, the siRNA comprises a guide strand consisting of a nucleic acid sequence selected from SEQ ID NOs: 11-15 and 86-95.

[0033] The terms "guide strand," "antisense strand," and "guide strand oligonucleotide" are used interchangeably herein and refer to the strand of a siRNA or shRNA that guides binding to an mRNA molecule and is therefore complementary thereto.

[0034] As used herein, the term "inhibiting the expression of X" has the meaning of inhibiting the expression of gene X and inhibiting the production of X protein.

[0035] According to other embodiments, the RNAi is shRNA. According to some embodiments, the shRNA that inhibits NCAN expression comprises a nucleic acid sequence selected from SEQ ID NOs: 1-5. According to some embodiments, the shRNA that inhibits NCAN expression comprises a nucleic acid sequence selected from SEQ ID NOs: 11-15 and 86-95.

[0036] The term "shRNA" as used herein refers to an RNA agent having a stem-loop structure, comprising a first and second region of the complementary sequence, the degree of complementarity and orientation of the region being sufficient to allow base pairing to occur between the regions, the first and second regions being connected by a loop region, the loop being caused by a lack of base pairing between nucleotides (or nucleotide analogs) within the loop region. The number of nucleotides in the loop is known in the art and can vary, for example, including 3 to 23, or 5 to 15, or 7 to 13, or 4 to 9, or 9 to 11 nt. Some nucleotides in the loop can participate in base pair interactions with other nucleotides in the loop. Typically, the shRNA molecule has less than about 400 to 500 nucleotides (nt) or less than 100 to 200 nt, wherein at least one segment of at least 14 to 100 nucleotides (e.g., 17 to 50 nt, 19 to 29 nt) is base paired with a complementary sequence located on the same RNA molecule (single RNA strand), and wherein the sequence and the complementary sequence are separated by an unpaired region of at least about 4 to 7 nucleotides (or about 9 to about 15 nt, about 15 to about 100 nt, about 100 to about 1000 nt), which forms a single-stranded loop above the stem structure generated by the two base complementary regions.

[0037] According to some embodiments, the RNAi oligonucleotide (e.g., siRNA or shRNA) is not a natural RNAi, i.e., does not exist in nature, and is artificially designed, chemically modified, and manufactured. According to some embodiments, the siRNA is an artificial siRNA. According to some embodiments, the shRNA is an artificial shRNA.

[0038] The term "neurocan" refers to the human chondroitin sulfate proteoglycan with UniProtKB ID O14594.

[0039] According to some embodiments, the RNAi oligonucleotide (e.g., siRNA or shRNA) comprises a complementary strand, i.e., a strand complementary to the guide strand. According to some embodiments, the complementary strand is complementary to at least 14, 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides of the guide strand. According to some embodiments, the complementary strand is complementary to 14 to 19 consecutive nucleotides of the guide strand. According to some embodiments, the complementary strand comprises 14 to 19 nucleotides. According to some embodiments, the complementary strand comprises 14, 15, 16, 17, 18, or 19 nucleotides. According to some embodiments, the complementary strand comprises a nucleic acid sequence selected from SEQ ID NO: 6-10, wherein the complementary strand comprises a nucleic acid complementary to the nucleic acid at the corresponding position in the guide strand sequence at the 1st and 19th positions. According to some embodiments, the complementary strand comprises a nucleic acid sequence selected from SEQ ID NO: 16-20 and 96-105. As shown in Table 1, SEQ ID NO: 1-10 comprises N, which can be any nucleotide. Here and in any embodiment of the present application, where applicable, the N at the 1st position of the guide strand is complementary to the N at the 19th position of the corresponding complementary (sense) strand, and the N at the 19th position of the guide strand is complementary to the N at the 1st position of the corresponding sense strand, the positions being counted from the 5' of the oligonucleotide sequence.

[0040] According to some embodiments, the RNAi oligonucleotide for inhibiting NCAN expression is a siRNA comprising a guide strand comprising a nucleic acid sequence selected from SEQ ID NOs: 1-5, 11-15, and 86-95 or consisting of the nucleic acid sequence. According to another embodiment, the siRNA for inhibiting NCAN expression comprises a complementary strand comprising a nucleic acid sequence selected from SEQ ID NOs: 6-10, 16-20, and 96-105, wherein the complementary strand comprises a nucleic acid at positions 1 and 19 that is complementary to the nucleic acid at the corresponding position in the sequence of the guide strand. According to some embodiments, the siRNA for inhibiting NCAN expression comprises an oligonucleotide pair comprising or consisting of the following nucleic acid sequences: (i) SEQ ID NOs: 1 and 5; (ii) SEQ ID NOs: 2 and 7; (iii) SEQ ID NOs: 3 and 8; or (iv) SEQ ID NOs: 4 and 9; (v) SEQ ID NOs: 5 and 10, wherein the N nucleotide in the guide strand is complementary to the N at the corresponding position in the complementary strand. According to some embodiments, the siRNA that inhibits NCAN expression comprises an oligonucleotide pair comprising or consisting of the following nucleic acid sequences: (i) SEQ ID NOs: 11 and 16; (ii) SEQ ID NOs: 12 and 17; (iii) SEQ ID NOs: 13 and 18; or (iv) SEQ ID NOs: 14 and 9; (v) SEQ ID NOs: 15 and 20; (vi) SEQ ID NOs: 86 and 96; (vii) SEQ ID NOs: 87 and 77; (viii) SEQ ID NOs: 88 and 88; (ix) SEQ ID NOs: 89 and 99; (x) SEQ ID NOs: 90 and 100; (xi) SEQ ID NOs: 91 and 101; (xii) SEQ ID NOs: 92 and 102; (xiii) SEQ ID NOs: 93 and 103; (xiv) SEQ ID NOs: 94 and 104; or (xv) SEQ ID NOs: 95 and 105. According to some embodiments, the present invention provides a siRNA comprising a guide strand comprising a nucleic acid sequence of SEQ ID NO: 11 and a complementary strand comprising a nucleic acid sequence of SEQ ID NO: 16. According to some embodiments, the present invention provides a siRNA comprising a guide strand comprising a nucleic acid sequence of SEQ ID NO: 12 and a complementary strand comprising a nucleic acid sequence of SEQ ID NO: 17. According to some embodiments, the present invention provides a siRNA comprising a guide strand comprising a nucleic acid sequence of SEQ ID NO: 13 and a complementary strand comprising a nucleic acid sequence of SEQ ID NO: 18.

[0041] According to some embodiments, the present invention provides an siRNA comprising a guide strand comprising a nucleic acid sequence of SEQ ID NO: 86 and a complementary strand comprising a nucleic acid sequence of SEQ ID NO: 96. According to some embodiments, the present invention provides an siRNA comprising a guide strand comprising a nucleic acid sequence of SEQ ID NO: 87 and a complementary strand comprising a nucleic acid sequence of SEQ ID NO: 97. According to some embodiments, the present invention provides an siRNA comprising a guide strand comprising a nucleic acid sequence of SEQ ID NO: 88 and a complementary strand comprising a nucleic acid sequence of SEQ ID NO: 98. According to some embodiments, the present invention provides an siRNA comprising a guide strand comprising a nucleic acid sequence of SEQ ID NO: 89 and a complementary strand comprising a nucleic acid sequence of SEQ ID NO: 99. According to some embodiments, the present invention provides an siRNA comprising a guide strand comprising a nucleic acid sequence of SEQ ID NO: 90 and a complementary strand comprising a nucleic acid sequence of SEQ ID NO: 100. According to some embodiments, the present invention provides an siRNA comprising a guide strand comprising a nucleic acid sequence of SEQ ID NO: 91 and a complementary strand comprising a nucleic acid sequence of SEQ ID NO: 101. According to some embodiments, the present invention provides an siRNA comprising a guide strand comprising a nucleic acid sequence of SEQ ID NO: 92 and a complementary strand comprising a nucleic acid sequence of SEQ ID NO: 102. According to some embodiments, the present invention provides an siRNA comprising a guide strand comprising a nucleic acid sequence of SEQ ID NO: 93 and a complementary strand comprising a nucleic acid sequence of SEQ ID NO: 103. According to some embodiments, the present invention provides an siRNA comprising a guide strand comprising a nucleic acid sequence of SEQ ID NO: 94 and a complementary strand comprising a nucleic acid sequence of SEQ ID NO: 104. According to some embodiments, the present invention provides an siRNA comprising a guide strand comprising a nucleic acid sequence of SEQ ID NO: 95 and a complementary strand comprising a nucleic acid sequence of SEQ ID NO: 105. According to some embodiments, the RNAi oligonucleotide for inhibiting NCAN expression is an shRNA comprising a guide strand comprising or consisting of a nucleic acid sequence selected from SEQ ID NOs: 1-5, 11-15 and 86-95. According to another embodiment, the shRNA that inhibits NCAN expression comprises a complementary strand comprising a nucleic acid sequence selected from SEQ ID NOs: 6-10 and 96-105, wherein the complementary strand comprises nucleic acids at positions 1 and 19 that are complementary to nucleic acids at corresponding positions in the sequence of the guide strand.According to some embodiments, the shRNA that inhibits NCAN expression comprises an oligonucleotide pair comprising or consisting of the following nucleic acid sequences: (i) SEQ ID NOs: 1 and 6; (ii) SEQ ID NOs: 2 and 7; (iii) SEQ ID NOs: 3 and 8; or (iv) SEQ ID NOs: 4 and 9; (v) SEQ ID NOs: 5 and 10, wherein the N at the 1st position of the guide strand is complementary to the N at the 19th position of the corresponding sense strand, and the N at the 19th position of the guide strand is complementary to the N at the 1st position of the corresponding sense strand, and the positions are counted from the 5' of the oligonucleotide sequence. According to some embodiments, the shRNA that inhibits NCAN expression comprises an oligonucleotide pair comprising or consisting of the following nucleic acid sequences: (i) SEQ ID NOs: 11 and 16; (ii) SEQ ID NOs: 12 and 17; (iii) SEQ ID NOs: 13 and 18; or (iv) SEQ ID NOs: 14 and 9; (v) SEQ ID NOs: 15 and 20; (vi) SEQ ID NOs: 86 and 96; (vii) SEQ ID NOs: 87 and 77; (viii) SEQ ID NOs: 88 and 88; (ix) SEQ ID NOs: 89 and 99; (x) SEQ ID NOs: 90 and 100; (xi) SEQ ID NOs: 91 and 101; (xii) SEQ ID NOs: 92 and 102; (xiii) SEQ ID NOs: 93 and 103; (xiv) SEQ ID NOs: 94 and 104; or (xv) SEQ ID NOs: 95 and 105. According to some embodiments, the present invention provides a shRNA comprising a guide strand comprising a nucleic acid sequence of SEQ ID NO: 11 and a complementary strand comprising a nucleic acid sequence of SEQ ID NO: 16. According to some embodiments, the present invention provides a shRNA comprising a guide strand comprising a nucleic acid sequence of SEQ ID NO: 12 and a complementary strand comprising a nucleic acid sequence of SEQ ID NO: 17. According to some embodiments, the present invention provides a shRNA comprising a guide strand comprising a nucleic acid sequence of SEQ ID NO: 13 and a complementary strand comprising a nucleic acid sequence of SEQ ID NO: 18.

[0042] According to some embodiments, the RNAi oligonucleotide of the present invention is coupled to another moiety. According to some embodiments, the RNAi oligonucleotide of the present invention is coupled to a hydrophilic moiety. According to some embodiments, the RNAi oligonucleotide of the present invention is coupled to a hydrophobic moiety. Thus, according to some embodiments, the siRNA or shRNA oligonucleotide of the present invention is coupled to a hydrophobic moiety. According to some embodiments, the hydrophobic molecule is bound to the guide strand. According to some embodiments, the hydrophobic molecule is bound to the complementary strand. According to some embodiments, the moiety is a load moiety. The term "load moiety" refers to a moiety that allows or enhances the loading of a molecule in an EV.

[0043] According to one embodiment, the hydrophobic part is selected from sterols, gangliosides, lipids, vitamins, fatty acids, peptides and combinations thereof. According to one embodiment, the RNA interference oligonucleotide is coupled to sterols. In an exemplary embodiment, the part is a cholesterol molecule, so according to such embodiments, the RNA interference oligonucleotide is coupled to cholesterol. According to some embodiments, one chain of the double-stranded RNAi is coupled to a hydrophobic molecule such as cholesterol. According to other embodiments, the two chains of the double-stranded RNAi are coupled to a hydrophobic molecule such as cholesterol. According to other embodiments, the RNA interference oligonucleotide is coupled to a molecule selected from monosialotetrahexosylganglioside (GM1), lipids, vitamins, small molecules, peptides or a combination thereof. In some embodiments, the part is a lipid. For example, in certain embodiments, the part is a palmitoyl group. In some embodiments, the part is a sterol, such as cholesterol. Other hydrophobic parts include, for example, phospholipids, vitamin D, vitamin E, squalene and fatty acids. In another exemplary embodiment, the RNAi oligonucleotide is coupled to myristic acid or a derivative thereof (e.g., a myristoylated oligonucleotide cargo). In some embodiments, the hydrophobic portion is coupled to the end of the oligonucleotide cargo (i.e., "terminal modification"). In other embodiments, the hydrophobic portion is coupled to other portions of the oligonucleotide molecule.

[0044] According to some embodiments, the RNAi oligonucleotide of the invention is conjugated to a hydrophobic moiety selected from the group consisting of sterols, gangliosides, lipids, vitamins, fatty acids, hydrophobic peptides, and combinations thereof.

[0045] According to some embodiments, the siRNA is coupled to cholesterol. According to some embodiments, the cholesterol is coupled to the guide strand of the siRNA. According to other embodiments, the cholesterol is coupled to the complementary strand of the siRNA. According to some embodiments, the cholesterol is coupled to the shRNA.

[0046] According to some embodiments, the present invention provides an siRNA comprising a guide strand comprising a nucleic acid sequence of SEQ ID NO: 11 and a complementary strand comprising a nucleic acid sequence of SEQ ID NO: 16, wherein the siRNA is conjugated to cholesterol. According to some embodiments, the present invention provides an siRNA comprising a guide strand comprising a nucleic acid sequence of SEQ ID NO: 12 and a complementary strand comprising a nucleic acid sequence of SEQ ID NO: 17, wherein the siRNA is conjugated to cholesterol. According to some embodiments, the present invention provides an siRNA comprising a guide strand comprising a nucleic acid sequence of SEQ ID NO: 13 and a complementary strand comprising a nucleic acid sequence of SEQ ID NO: 18, wherein the siRNA is conjugated to cholesterol.

[0047] According to some embodiments, the siRNA or shRNA oligonucleotide for inhibiting the expression of tenascin-R of the present invention is coupled to a hydrophilic part. According to some embodiments, the hydrophilic molecule is bound to the guide strand. According to some embodiments, the hydrophilic molecule is bound to the complementary strand. According to some embodiments, the hydrophilic part is a load part. In some embodiments, the hydrophilic load part is a carbohydrate or a derivative thereof. In some embodiments, the hydrophilic load part is a carbohydrate. According to some embodiments, the carbohydrate derivative is a conjugate of a carbohydrate and a lipid. According to some embodiments, the carbohydrate derivative comprises a carbohydrate attached to a lipid. According to some embodiments, the lipid is selected from phospholipids, fatty acids, triglycerides and amino alcohols such as serine and hydroxyproline. According to some embodiments, the carbohydrate is selected from monosaccharides, disaccharides, trisaccharides, tetrasaccharides and oligosaccharides. According to some embodiments, the carbohydrate is a monosaccharide. According to some embodiments, the monosaccharide is selected from glucose, fructose, ribose, arabinose, galactose, mannose and xylose. According to some embodiments, the monosaccharide is glucose. According to some embodiments, the monosaccharide is fructose. According to some embodiments, the monosaccharide is arabinose. According to some embodiments, the carbohydrate is a disaccharide. According to some embodiments, the disaccharide is selected from sucrose, lactose and maltose. According to some embodiments, the disaccharide is sucrose. According to some embodiments, the carbohydrate is a trisaccharide. According to some embodiments, the trisaccharide is selected from maltotriose and raffinose. According to some embodiments, the carbohydrate is a tetrasaccharide. According to some embodiments, the carbohydrate is an oligosaccharide. According to some embodiments, the sugar is selected from glucose, ribose, arabinose, galactose, mannose, sucrose and maltotriose. According to some embodiments, the hydrophilic load portion is glucose.

[0048] According to some embodiments, the siRNA is coupled to glucose. According to some embodiments, the glucose is coupled to the guide strand of the siRNA. According to other embodiments, the glucose is coupled to the complementary strand of the siRNA. According to some embodiments, the glucose is coupled to the shRNA.

[0049] According to some embodiments, the load moiety is bound to the siRNA or shRNA via a linker. According to some embodiments, the linker is selected from a hydrophilic, hydrophobic and amphipathic linker. According to some embodiments, the linker is DBCO-C6-azide.

[0050] According to some embodiments, the present invention provides a siRNA comprising a guide strand and a complementary strand comprising nucleic acid sequences SEQ ID NO: 11 and SEQ ID NO: 16, respectively, wherein the siRNA is optionally coupled to glucose via a linker. According to some embodiments, the present invention provides a siRNA comprising a guide strand and a complementary strand comprising nucleic acid sequences SEQ ID NO: 12 and SEQ ID NO: 17, respectively, wherein the siRNA is optionally coupled to glucose via a linker. According to some embodiments, the present invention provides a siRNA comprising a guide strand and a complementary strand comprising nucleic acid sequences SEQ ID NO: 13 and SEQ ID NO: 18, respectively, wherein the siRNA is optionally coupled to glucose via a linker.

[0051] The siRNA and shRNA molecules promote sequence-specific degradation of mRNA by RNAi to achieve inhibition of NCAN protein expression or reduction of NCAN gene expression levels, such as by 95%, 90%, 85%, 80%, 75%, 70%, 60%, 50%, 40%, 30%, 20%, 10% or 5%.

[0052] According to another aspect, the invention provides a composition comprising RNAi molecules of the present invention and a carrier. Any of the above definitions, terms and embodiments are also encompassed and applicable herein. The term "carrier" as used herein refers to any compound or composition that can be used to promote the storage, stability, application, cell targeting and / or delivery of a topical composition, including but not limited to suitable solvents, skin conditioners, skin protectants, diluents, emollients, solvents, excipients, pH regulators, salts, colorants, rheology modifiers, thickeners, lubricants, humectants, defoamers, erodible polymers, hydrogels, surfactants, emulsifiers, emulsion stabilizers, adjuvants, surfactants, preservatives, chelating agents, fatty acids, monoglycerides, diglycerides and triesters and derivatives thereof, waxes, oils and water. According to some embodiments, the present invention provides a composition comprising an siRNA molecule comprising a guide strand and a complementary strand pair, wherein the pair comprises or consists of the nucleic acid sequences SEQ ID NOs: 11 and 16, SEQ ID NOs: 12 and 17, or SEQ ID NOs: 13 and 18, optionally wherein the siRNA is coupled to cholesterol or glucose. According to some embodiments, the present invention provides a composition comprising an siRNA molecule comprising a guide strand and a complementary strand pair, wherein the pair comprises or consists of the nucleic acid sequences SEQ ID NOs: 86 and 96, SEQ ID NOs: 87 and 77, SEQ ID NOs: 88 and 88, SEQ ID NOs: 89 and 99, SEQ ID NOs: 90 and 100, SEQ ID NOs: 91 and 101, SEQ ID NOs: 92 and 102, SEQ ID NOs: 93 and 103, SEQ ID NOs: 94 and 104, or SEQ ID NOs: 95 and 105, optionally wherein the siRNA is coupled to cholesterol or glucose. In some embodiments, the carrier is a pharmaceutically acceptable carrier and the composition is a pharmaceutical composition.

[0053] TNR

[0054] In one aspect, the present invention provides an RNA silencing oligonucleotide for inhibiting the expression of tenascin-R (TNR). According to some embodiments, the RNA silencing oligonucleotide is an RNA interference oligonucleotide. According to some embodiments, the RNAi oligonucleotide (i.e., siRNA or shRNA) is designed to bind to a TNR mRNA sequence within the region of base numbers 1600 to 2000, preferably within the region of base numbers 1700 to 1850 in the sequence SEQ ID NO: 22. According to some embodiments, the RNAi oligonucleotide (i.e., siRNA or shRNA) is designed to bind to a TNR mRNA sequence within the region of base numbers 4300 to 4700, preferably within the region of base numbers 4400 to 4500 in the sequence SEQ ID NO: 22. According to some embodiments, the RNAi that inhibits TNR expression comprises a guide strand containing a nucleic acid sequence selected from SEQ ID NOs: 30-43. According to some embodiments, the RNAi that inhibits TNR expression comprises a guide strand containing a nucleic acid sequence selected from SEQ ID NOs: 58-71. According to some embodiments, the RNAi is selected from siRNA and shRNA. Therefore, according to some embodiments, the present invention provides an RNAi oligonucleotide selected from siRNA and shRNA, comprising a guide strand comprising a nucleic acid sequence selected from SEQ ID NO: 30-43 and 58-71. According to some embodiments, the RNAi oligonucleotide is used to inhibit the expression of TNR.

[0055] According to some embodiments, the oligonucleotide consists of 2 to 150, 10 to 100 or 14 to 50 nucleotides. According to other embodiments, the oligonucleotide consists of 15 to 40, 17 to 35 or 18 to 30 nucleotides.

[0056] According to some embodiments, the RNAi is selected from siRNA, miRNA and shRNA.

[0057] According to some embodiments, the RNAi oligonucleotide is a siRNA. According to some embodiments, the siRNA that inhibits TNR expression comprises a guide strand comprising a nucleic acid sequence selected from SEQ ID NOs: 30-43. According to some embodiments, the siRNA comprises a guide strand consisting of a nucleic acid sequence selected from SEQ ID NOs: 30-43. According to some embodiments, the siRNA that inhibits TNR expression comprises a guide strand comprising a nucleic acid sequence selected from SEQ ID NOs: 58-71. According to some embodiments, the siRNA comprises a guide strand consisting of a nucleic acid sequence selected from SEQ ID NOs: 58-71.

[0058] According to other embodiments, the RNAi is a shRNA. According to some embodiments, the shRNA that inhibits TNR expression comprises a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 30-43 and 58-71.

[0059] The term "tenascin-R" refers to a human extracellular matrix glycoprotein belonging to the tenascin family and having UniProtKB of Q92752.

[0060] According to some embodiments, the RNAi oligonucleotide (e.g., siRNA or shRNA) comprises a complementary strand, i.e., a strand complementary to the guide strand. According to some embodiments, the complementary strand is complementary to at least 14, 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides of the guide strand. According to some embodiments, the complementary strand is complementary to 14 to 19 consecutive nucleotides of the guide strand. According to some embodiments, the complementary strand comprises 14 to 19 nucleotides. According to some embodiments, the complementary strand comprises 14, 15, 16, 17, 18, or 19 nucleotides. According to some embodiments, the complementary strand comprises a nucleic acid sequence selected from SEQ ID NO: 44-57, wherein the complementary strand comprises a nucleic acid complementary to the nucleic acid at the corresponding position in the sequence of the guide strand at the 1st and 19th positions. As shown in Table 1, SEQ ID NOs: 30-57 include N, wherein N can be any nucleotide, wherein the N at the 1st position of the guide strand is complementary to the N at the 19th position of the corresponding sense strand, and the N at the 19th position of the guide strand is complementary to the N at the 1st position of the corresponding sense strand, the positions being counted from the 5' of the sequence. In the sequence listing file, T represents U in the RNA molecule sequence. According to some embodiments, the complementary strand comprises a nucleic acid sequence selected from SEQ ID NOs: 72-85.

[0061] According to some embodiments, the RNAi oligonucleotide is a siRNA that inhibits TNR expression, comprising a guide strand comprising or consisting of a nucleic acid sequence selected from SEQ ID NOs: 30-43 and 58-71. According to another embodiment, the siRNA comprises a complementary strand comprising a nucleic acid sequence selected from SEQ ID NOs: 44-57 and 72-85, wherein the complementary strand comprises at positions 1 and 19 a nucleic acid complementary to the nucleic acid at the corresponding position in the sequence of the guide strand. According to some embodiments, the present invention provides an siRNA comprising an oligonucleotide pair, wherein the oligonucleotide pair comprises or consists of the following nucleic acid sequences: (i) SEQ ID NOs: 30 and 44; (ii) SEQ ID NOs: 31 and 45; (iii) SEQ ID NOs: 32 and 46 (iv) SEQ ID NOs: 33 and 47; (v) SEQ ID NOs: 34 and 48; (vi) SEQ ID NOs: 45 and 49; (vii) SEQ ID NOs: 56 and 50; (viii) SEQ ID NOs: 37 and 51; (ix) SEQ ID NOs: 38 and 52; (x) SEQ ID NOs: 39 and 53; (xi) SEQ ID NOs: 40 and 54; (xii) SEQ ID NOs: 41 and 55; (xiii) SEQ ID NOs: 42 and 56; or (xiv) SEQ ID NOs: 43 and 57, wherein the N nucleotide in the guide strand is complementary to the N at the corresponding position in the complementary strand. According to some embodiments, the siRNA comprises an oligonucleotide pair comprising or consisting of the following nucleic acid sequences: (i) SEQ ID NOs: 58 and 72; (ii) SEQ ID NOs: 59 and 73; (iii) SEQ ID NOs: 60 and 74; (iv) SEQ ID NOs: 61 and 75; (v) SEQ ID NOs: 62 and 76; (v) SEQ ID NOs: 63 and 77; (vii) SEQ ID NOs: 64 and 78; (viii) SEQ ID NOs: 65 and 79; (ix) SEQ ID NOs: 66 and 80; (x) SEQ ID NOs: 67 and 81; (xi) SEQ ID NOs: 68 and 82; (xii) SEQ ID NOs: 69 and 83; (xiii) SEQ ID NOs: 70 and 84; or (xiv) SEQ ID NOs: 71 and 85. According to some embodiments, the present invention provides a siRNA comprising a guide strand comprising the nucleic acid sequence of SEQ ID NO:58 and a complementary strand comprising the nucleic acid sequence of SEQ ID NO:72.According to some embodiments, the present invention provides an siRNA comprising a guide strand comprising a nucleic acid sequence of SEQ ID NO: 61 and a complementary strand comprising a nucleic acid sequence of SEQ ID NO: 75. According to some embodiments, the present invention provides an siRNA comprising a guide strand comprising a nucleic acid sequence of SEQ ID NO: 62 and a complementary strand comprising a nucleic acid sequence of SEQ ID NO: 76.

[0062] According to some embodiments, the RNAi oligonucleotide is a shRNA for inhibiting the expression of tenascin-R, comprising a guide strand comprising or consisting of a nucleic acid sequence selected from SEQ ID NOs: 30-43 and 58-71. According to another embodiment, the shRNA comprises a complementary strand comprising a nucleic acid sequence selected from SEQ ID NOs: 44-57 and 82-85. According to some embodiments, the shRNA comprises an oligonucleotide pair comprising or consisting of the following nucleic acid sequences: (i) SEQ ID NOs: 30 and 44; (ii) SEQ ID NOs: 31 and 45; (iii) SEQ ID NOs: 32 and 46; (iv) SEQ ID NOs: 33 and 47; (v) SEQ ID NOs: 34 and 48; (vi) SEQ ID NOs: 45 and 49; (vii) SEQ ID NOs: 56 and 50; (viii) SEQ ID NOs: 37 and 51; (ix) SEQ ID NOs: 38 and 52; (x) SEQ ID NOs: 39 and 53; (xi) SEQ ID NOs: 40 and 54; (xii) SEQ ID NOs: 41 and 55; (xiii) SEQ ID NOs: 42 and 56; or (xiv) SEQ ID NOs: 43 and 57, wherein the N nucleotide in the guide strand is complementary to the N at the corresponding position in the complementary strand. According to some embodiments, the shRNA comprises an oligonucleotide pair comprising or consisting of the following nucleic acid sequences: (i) SEQ ID NOs: 58 and 72; (ii) SEQ ID NOs: 59 and 73; (iii) SEQ ID NOs: 60 and 74; (iv) SEQ ID NOs: 61 and 75; (v) SEQ ID NOs: 62 and 76; (vi) SEQ ID NOs: 63 and 77; (vii) SEQ ID NOs: 64 and 78; (viii) SEQ ID NOs: 65 and 79; (ix) SEQ ID NOs: 66 and 80; (x) SEQ ID NOs: 67 and 81; (xi) SEQ ID NOs: 68 and 82; (xii) SEQ ID NOs: 69 and 83; (xiii) SEQ ID NOs: 70 and 84; or (xiv) SEQ ID NOs: 71 and 85. According to some embodiments, the present invention provides a shRNA comprising a guide strand comprising a nucleic acid sequence of SEQ ID NO: 58 and a complementary strand comprising a nucleic acid sequence of SEQ ID NO: 72. According to some embodiments, the present invention provides a shRNA comprising a guide strand comprising a nucleic acid sequence of SEQ ID NO: 61 and a complementary strand comprising a nucleic acid sequence of SEQ ID NO: 75.According to some embodiments, the present invention provides a shRNA comprising a guide strand comprising the nucleic acid sequence of SEQ ID NO:62 and a complementary strand comprising the nucleic acid sequence of SEQ ID NO:76.

[0063] According to some embodiments, the RNAi oligonucleotide for inhibiting the expression of tenascin-R of the present invention is coupled to another moiety. According to some embodiments, the RNAi oligonucleotide of the present invention is coupled to a hydrophobic moiety. According to some embodiments, the RNAi oligonucleotide of the present invention is coupled to a hydrophobic molecule / moiety. According to some embodiments, the siRNA or shRNA oligonucleotide of the present invention is coupled to a hydrophobic molecule. According to some embodiments, the hydrophobic molecule is bound to the guide strand. According to some embodiments, the hydrophobic molecule is bound to the complementary strand.

[0064] According to one embodiment, the hydrophobic part is selected from sterols, gangliosides, lipids, vitamins, fatty acids, peptides and combinations thereof. According to one embodiment, the RNA interference oligonucleotide is coupled to sterols. In an exemplary embodiment, the part is a cholesterol molecule, so according to such embodiments, the RNA interference oligonucleotide is coupled to cholesterol. According to some embodiments, one chain of the double-stranded RNAi is coupled to a hydrophobic molecule such as cholesterol. According to other embodiments, the two chains of the double-stranded RNAi are coupled to a hydrophobic molecule such as cholesterol. According to other embodiments, the RNA interference oligonucleotide is coupled to a molecule selected from monosialotetrahexosylganglioside (GM1), lipids, vitamins, small molecules, peptides or a combination thereof. In some embodiments, the part is a lipid. For example, in certain embodiments, the part is a palmitoyl group. In some embodiments, the part is a sterol, such as cholesterol. Other hydrophobic parts include, for example, phospholipids, vitamin D, vitamin E, squalene and fatty acids. In another exemplary embodiment, the RNAi oligonucleotide is coupled to myristic acid or a derivative thereof (e.g., a myristoylated oligonucleotide cargo). In some embodiments, the hydrophobic portion is coupled to the end of the oligonucleotide cargo (i.e., "terminal modification"). In other embodiments, the hydrophobic portion is coupled to other portions of the oligonucleotide molecule.

[0065] According to some embodiments, the RNAi oligonucleotide of the invention is conjugated to a hydrophobic moiety selected from the group consisting of sterols, gangliosides, lipids, vitamins, fatty acids, hydrophobic peptides, and combinations thereof.

[0066] According to some embodiments, the siRNA for inhibiting the expression of tenascin-R is coupled to cholesterol. According to some embodiments, the cholesterol is coupled to the guide strand of the siRNA. According to other embodiments, the cholesterol is coupled to the complementary strand of the siRNA. According to some embodiments, the cholesterol is coupled to the shRNA. According to some embodiments, the present invention provides a siRNA comprising a guide strand containing the nucleic acid sequence SEQ ID NO: 58 and a complementary strand containing the nucleic acid sequence SEQ ID NO: 72, wherein the siRNA is coupled to cholesterol. According to some embodiments, the present invention provides a siRNA comprising a guide strand containing the nucleic acid sequence SEQ ID NO: 61 and a complementary strand containing the nucleic acid sequence SEQ ID NO: 75, wherein the siRNA is coupled to cholesterol. According to some embodiments, the present invention provides a siRNA comprising a guide strand containing the nucleic acid sequence SEQ ID NO: 62 and a complementary strand containing the nucleic acid sequence SEQ ID NO: 76, wherein the siRNA is coupled to cholesterol.

[0067] According to some embodiments, the siRNA or shRNA oligonucleotide for inhibiting the expression of tenascin-R of the present invention is coupled to a hydrophilic part. According to some embodiments, the hydrophilic molecule is bound to the guide strand. According to some embodiments, the hydrophilic molecule is bound to the complementary strand. According to some embodiments, the hydrophilic part is a load part. In some embodiments, the hydrophilic load part is a carbohydrate or a derivative thereof. In some embodiments, the hydrophilic load part is a carbohydrate. According to some embodiments, the carbohydrate is selected from monosaccharides, disaccharides, trisaccharides, tetrasaccharides and oligosaccharides. According to some embodiments, the carbohydrate derivative is a conjugate of a carbohydrate and a lipid. According to some embodiments, the carbohydrate derivative comprises a carbohydrate attached to a lipid. According to some embodiments, the lipid is selected from phospholipids, fatty acids, triglycerides and amino alcohols such as serine and hydroxyproline. According to some embodiments, the carbohydrate is a monosaccharide. According to some embodiments, the monosaccharide is selected from glucose, fructose ribose, arabinose, galactose, mannose and xylose. According to some embodiments, the monosaccharide is glucose. According to some embodiments, the monosaccharide is fructose. According to some embodiments, the monosaccharide is arabinose. According to some embodiments, the carbohydrate is a disaccharide. According to some embodiments, the disaccharide is selected from sucrose, lactose and maltose. According to some embodiments, the disaccharide is sucrose. According to some embodiments, the carbohydrate is a trisaccharide. According to some embodiments, the trisaccharide is selected from maltotriose and raffinose. According to some embodiments, the carbohydrate is a tetrasaccharide. According to some embodiments, the carbohydrate is an oligosaccharide. According to some embodiments, the sugar is selected from glucose, ribose, arabinose, galactose, mannose, sucrose and maltotriose. According to some embodiments, the hydrophilic load portion is glucose.

[0068] According to some embodiments, the siRNA is coupled to glucose. According to some embodiments, the glucose is coupled to the guide strand of the siRNA. According to other embodiments, the glucose is coupled to the complementary strand of the siRNA. According to some embodiments, the glucose is coupled to the shRNA.

[0069] According to some embodiments, the load moiety is bound to the siRNA or shRNA via a linker. According to some embodiments, the linker is selected from a hydrophilic, hydrophobic and amphipathic linker. According to some embodiments, the linker is DBCO-C6-azide.

[0070] According to some embodiments, the present invention provides a siRNA comprising a guide strand and a complementary strand comprising nucleic acid sequences SEQ ID NO: 58 and SEQ ID NO: 72, respectively, wherein the siRNA is optionally coupled to glucose via a linker. According to some embodiments, the present invention provides a siRNA comprising a guide strand and a complementary strand comprising nucleic acid sequences SEQ ID NO: 61 and SEQ ID NO: 75, respectively, wherein the siRNA is optionally coupled to glucose via a linker. According to some embodiments, the present invention provides a siRNA comprising a guide strand and a complementary strand comprising nucleic acid sequences SEQ ID NO: 62 and SEQ ID NO: 76, respectively, wherein the siRNA is optionally coupled to glucose via a linker.

[0071] According to another aspect, the present invention provides a composition comprising an RNAi oligonucleotide that inhibits TNR expression of the present invention and a carrier. Any of the above definitions, terms and embodiments are also encompassed and applicable here. The term "carrier" as used herein refers to any compound or composition that can be used to promote the storage, stability, application, cell targeting and / or delivery of a topical composition, including but not limited to suitable solvents, skin conditioners, skin protectants, diluents, emollients, solvents, excipients, pH regulators, salts, colorants, rheology modifiers, thickeners, lubricants, humectants, defoamers, erodible polymers, hydrogels, surfactants, emulsifiers, emulsion stabilizers, adjuvants, surfactants, preservatives, chelating agents, fatty acids, monoglycerides, diglycerides and triesters and their derivatives, waxes, oils and water.

[0072] According to some embodiments, the present invention provides a composition comprising an siRNA molecule comprising a guide strand and a complementary strand pair, wherein the pair comprises or consists of the nucleic acid sequences SEQ ID NOs: 58 and 72, SEQ ID NOs: 61 and 75, or SEQ ID NOs: 62 and 76, optionally wherein the siRNA is coupled to cholesterol or glucose. In some embodiments, the carrier is a pharmaceutically acceptable carrier, and the composition is a pharmaceutical composition.

[0073] The siRNA and shRNA molecules promote sequence-specific degradation of mRNA by RNAi to achieve inhibition of TNR protein expression or reduction of TNR gene expression levels, such as by 95%, 90%, 85%, 80%, 75%, 70%, 60%, 50%, 40%, 30%, 20%, 10% or 5%.

[0074] EV

[0075] According to another aspect, the present invention provides an isolated EV comprising an RNA interference (RNAi) oligonucleotide that inhibits the expression of a protein selected from neurocan (NCAN), tenascin-R (TNR) and a combination thereof. The present invention provides an isolated EV loaded with an RNA interference (RNAi) oligonucleotide that inhibits the expression of a protein selected from neurocan (NCAN), tenascin-R (TNR) and a combination thereof. Any of the above definitions, terms and embodiments are also encompassed and applicable here. For EVs, the terms "loaded with" and "comprising" can be used interchangeably when referring to RNAi oligonucleotides.

[0076] According to some embodiments, the present invention provides isolated EVs comprising RNAi oligonucleotides that inhibit the expression of neurocan. According to some embodiments, the present invention provides isolated EVs comprising RNAi oligonucleotides that inhibit the expression of tenascin-R. According to some embodiments, the present invention provides isolated EVs comprising RNAi oligonucleotides that inhibit the expression of neurocan and tenascin-R.

[0077] According to some embodiments, the RNAi oligonucleotide is exogenous. The term "exogenous" as used herein refers to a molecule or substance (e.g., a compound, nucleic acid, or protein) derived from the outside of a given membrane vesicle (e.g., EV), and is not naturally present in the vesicle. For EV, the term refers to a molecule or substance that is not naturally present in the vesicle, nor in the cell from which the EV is derived. According to some embodiments, the term "exogenous" refers to a synthetic (artificially synthesized) non-natural molecule. According to some embodiments, the substance is artificially loaded into the EV or the cell from which the EV is derived. For peptides, proteins, and nucleic acids, the term means that the compound is artificially loaded into the cell from which the EV or the vesicle is derived, or artificially expressed in the cell from which the vesicle is derived, however, the compound is not naturally expressed in the parent cell.

[0078] The terms "extracellular vesicle" and "EV" are used interchangeably herein and refer to cell-derived vesicles that contain a membrane surrounding an internal space. Typically, EVs range in diameter from 30nm to 1500nm, more commonly 40nm to 1200nm, and may contain various cargo molecules in the internal space, displayed on the outer surface of the extracellular vesicle, and / or across the membrane. The cargo molecules may include nucleic acids, proteins, carbohydrates, lipids, small molecules, and / or combinations thereof. EVs can be divided into three subgroups: (I) exosomes: 30-150nm in diameter, derived from endosomal compartments; (II) microvesicles: 100nm-1μm in diameter, released from the cell surface by "encapsulation"; and (III) apoptotic bodies: 1-5μm in diameter, released from apoptotic cells. The term EV also includes the terms "exosomes" and "microvesicles". The terms "exosomes" and "nanovesicles" are used interchangeably herein and refer to EVs with diameters between 30 and 150nm. In some references, exosomes refer to EVs with a diameter between 30 and 100 nm. As used herein, the term "microvesicle" refers to EVs with a diameter between 150 and 1000 nm. Typically, EVs may contain at least a portion of the molecular contents of the cell from which they are derived, such as lipids, fatty acids, polypeptides, polynucleotides, proteins, and / or sugars.

[0079] The EVs of the present invention are mostly spherical, and the terms "size", "particle size", "average particle size" and "particle size" used interchangeably herein refer to the diameter of the EV or the longest dimension of the EV. Any known particle size measurement method can be used to determine the size of the EVs of the present invention. A non-limiting example is nanoparticle tracking analysis (NTA).

[0080] According to some embodiments, the isolated EV is an exosome. According to one embodiment, the exosome has a diameter of 30 to 150 nm, 40 to 120 nm, 50 to 100 nm, 30 to 100 nm, 30 nm to 80 nm, or 60 nm to 80 nm.

[0081] According to another embodiment, the EV is a microvesicle. According to one embodiment, the microvesicle has a diameter of 100 to 1000 nm, 120 to 800 nm, 150 to 600 nm, or 200 to 400 nm. According to another embodiment, the microvesicle has a size of 100 to 300 nm or 150 to 250 nm.

[0082] According to some embodiments, the EV has a diameter of 30 to 250 nm or 50 to 200 nm. According to some embodiments, the EV has a diameter of 70 to 170 nm or 80 to 150 nm.

[0083] The EV may have a size range of, for example, 2nm to 20nm, 2nm to 50nm, 2nm to 100nm, 2nm to 150nm, or 2nm to 200nm. The EV may have a size of 20nm to 50nm, 20nm to 100nm, 20nm to 150nm, or 20nm to 200nm. The EV may have a size of 50nm to 100nm, 50nm to 150nm, or 50nm to 200nm. The EV may have a size of 100nm to 150nm, or 100nm to 200nm. The EV may have a size of 150nm to 200nm. The EV may have a size of 100 to 600nm, 150 to 500nm, or 200 to 400nm.

[0084] The size can be determined by various means. In principle, the size can be determined by size fractionation and filtration through membranes with a relevant size cut-off.

[0085] According to another embodiment, the isolated EVs are a combination of small vesicles and large vesicles (e.g., microvesicles and exosomes).

[0086] As described above, the EV is derived from a cell. The terms "derived from" and "originated from" are used interchangeably herein and refer to a vesicle within, produced by or from a specific cell, cell type or cell population. The terms "mother cell", "producer cell" and "original cell" used herein include any cell from which the extracellular vesicle is derived and isolated. The terms also encompass cells that share the protein, lipid, sugar or nucleic acid components of the extracellular vesicle. For example, a "mother cell" or "producer cell" includes a cell that serves as a source of the extracellular vesicle. According to some embodiments, the cell is a eukaryotic cell.

[0087] The extracellular vesicle (EV) can be derived from a biological cell by any of several means, such as by secretion, budding or spreading from a biological cell. The EV may be something that can be separated from a mesenchymal stem cell (MSC), a neural crest cell (NCC), a mesenchymal stem cell conditioned medium (MSC-CM) or a neural crest cell conditioned medium. The EV may be responsible for or at least have the activity of a maternal cell such as MSC, NCC, NCC-CM or MSC-CM. The EV may be responsible for and perform most or all of the functions of the activity of a maternal cell such as MSC, NCC, NCC-CM or MSC-CM. For example, the EV can be a substitute (or biological substitute) for MSC, NCC, NCC-CM or MSC-CM. For example, the EV can be produced, exuded, released or shed from the biological cell. When the biological cell is in cell culture, particles may be secreted into the cell culture medium.

[0088] Examples of biological cells from which EVs can be derived include adhesion cells expressing mesenchymal markers, such as mesenchymal stem cells, oral mucosal stem cells or olfactory sheathing cells, astrocytes and neural crest cells. Therefore, according to some embodiments, the present invention provides a pharmaceutical composition comprising EVs loaded with the RNAi of the present invention, wherein the EVs are derived from adhesion cells expressing mesenchymal markers. According to one embodiment, the adhesion cells expressing mesenchymal markers are selected from mesenchymal stem cells (MSCs), oral mucosal stem cells and olfactory sheathing cells. According to one embodiment, the cells are mesenchymal stem cells (MSCs). According to one embodiment, the EVs are derived from mesenchymal stem cells (MSCs).

[0089] The term "mesenchymal stem cells" refers to multipotent stromal cells that can differentiate into various cell types, including osteoblasts (bone cells), chondrocytes (cartilage cells), myocytes (muscle cells), and adipocytes (fat cells), as is well known in the art.

[0090] In their pluripotent state, mesenchymal stem cells typically express the following markers: CD105, CD166, CD29, CD90, and CD73, and do not express CD34, CD45, and CD133.

[0091] Mesenchymal stem cells can be isolated from various tissues, including but not limited to bone marrow, adipose tissue, dental pulp, oral mucosa, peripheral blood and amniotic fluid. According to one embodiment, the mesenchymal stem cells are isolated from bone marrow. According to one embodiment, the mesenchymal stem cells are derived from a site selected from bone marrow, adipose tissue, umbilical cord, dental pulp, oral mucosa, peripheral blood and amniotic fluid. According to some embodiments, the EV is derived from MSC derived from bone marrow. According to other embodiments, the EV is derived from MSC derived from adipose tissue. According to some such embodiments, the EV is selected from exosomes, microvesicles and combinations thereof. According to some embodiments, the cells express CD105, CD166, CD29, CD90 and CD73 markers. According to another embodiment, the cells express CD105, CD166, CD29, CD90 and CD73, and do not express CD34, CD45 and CD133. According to some embodiments, the cells are selected from dental pulp stem cells (DPSCs), exfoliated deciduous tooth stem cells (SHEDs), periodontal ligament stem cells (PDLSCs), apical papilla stem cells (SCAPs), and dental follicle progenitor cells (DFPCs).

[0092] According to some such embodiments, the EV comprises or expresses at least a portion of the markers expressed by the cell from which the EV is derived.

[0093] The EV may comprise one or more proteins, oligonucleotides or polynucleotides secreted by a specific cell type (e.g., mesenchymal stem cells or neural crest cells). The EV may comprise one or more proteins or polynucleotides present in a mesenchymal stem cell conditioned medium (MSC-CM). In a specific embodiment, the EV may comprise miRNA derived from MSC or neural crest cells. For example, the EV may comprise 10% or more, 20% or more, 30% or more, 40% or more, 50% or more, 60% or more or 70% or more of these proteins and / or polynucleotides. The EV may substantially comprise about 75% of these proteins and / or polynucleotides. The protein may be defined by reference to a protein list or a gene product of a gene list.

[0094] The EV may have at least one property of a mesenchymal stem cell. The particle may have a biological property, such as a biological activity. The particle may have any biological activity of a MSC. The particle may, for example, have a therapeutic or restorative activity of a MSC.

[0095] Methods for isolating, purifying and expanding mesenchymal stem cells (MSCs) are known in the art and include, for example, the methods disclosed by Caplan and Haynesworth in U.S. Pat. No. 5,486,359 and Jones EA et al., 2002, Isolation and characterization of bone marrow multipotential mesenchymal progenitor cells, Arthritis Rheum. 46(12):3349-60.

[0096] Mesenchymal stem cell culture can be by diluting BM aspirate (usually 20ml) with an equal volume of Hank's balanced salt solution (HBSS; GIBCOLaboratories, Grand Island, NY, USA), and layering the diluted cells on a Ficoll column (Ficoll-Paque; Pharmacia, Piscataway, NJ, USA) of about 10ml to produce. After centrifugation at 2500x g for 30 minutes, the mononuclear cell layer is removed from the interface and suspended in HBSS. The cells are then centrifuged at 1500x g for 15 minutes and resuspended in complete medium (MEM, medium without deoxyribonucleotides or ribonucleotides; GIBCO), 100 units / ml penicillin (GIBCO), 100 μg / ml streptomycin (GIBCO) and 2mM L-glutamine (GIBCO). The resuspended cells were plated in approximately 25 ml of culture medium in a 10 cm culture dish (Corning Glass Works, Corning, NY) and incubated at 37°C and 5% humidified CO2. After 24 hours of culture, non-adherent cells were discarded and adherent cells were thoroughly washed twice with phosphate buffered saline (PBS). The culture medium was replaced with fresh complete culture medium every 3 or 4 days for a total of approximately 14 days. Adherent cells were then harvested with 0.25% trypsin and 1 mM EDTA (Trypsin / EDTA, GIBCO) at 37°C for 5 min, re-plated in a 6-cm plate, and cultured for another 14 days. The cells were then trypsinized and counted using a cell counting device such as a hemocytometer (Hausser Scientific, Horsham, PA). The cultured cells were recovered by centrifugation and lysed with 5% DMSO and 30% FCS at 1 to 2X 10 per ml. 6 Aliquots of approximately 1 ml were slowly frozen and stored in liquid nitrogen.

[0097] To expand the mesenchymal stem cell fraction, thaw the frozen cells at 37°C, dilute with complete medium, and recover by centrifugation to remove DMSO. Resuspend the cells in complete medium and plate at approximately 5000 cells / cm 2 After 24 hours in culture, non-adherent cells were removed and adherent cells were harvested using trypsin / EDTA, dissociated using a narrow Pasteur pipette, and plated at a concentration of preferably about 1.5 to about 3.0 cells / cm 2 Under these conditions, MSC cultures can grow for about 50 population doublings and expand about 2000-fold (Colter DC. et al., Proc Natl Acad Sci USA. 97:3213-3218, 2000).

[0098] The MSC cultures used in some embodiments of the present invention include three groups of cells defined by their morphological characteristics: small agranular cells (hereinafter referred to as RS-1), small granular cells (hereinafter referred to as RS-2) and large medium granular cells (hereinafter referred to as mature MSCs). The presence and concentration of such cells in the culture can be determined by identifying the presence or absence of various cell surface markers using, for example, immunofluorescence, in situ hybridization, and activity assays.

[0099] According to a specific embodiment, the EV is derived from a cell expressing a marker from a neural crest cell. According to a specific embodiment, the EV is derived from a neural crest cell. According to another embodiment, the neural crest cell is a cranial neural crest cell. According to some embodiments, the cranial neural crest cell includes but is not limited to dental pulp stem cells (DPSC), shedding deciduous tooth stem cells (SHED), periodontal ligament stem cells (PDLSC), apical papilla stem cells (SCAP) and dental follicle progenitor cells (DFPC). According to some embodiments, such cells express mesenchymal markers as defined above.

[0100] The EVs can be produced or isolated in a variety of ways. Such methods may include isolating EVs from mesenchymal stem cells (MSCs) or neural crest cells (NCCs).

[0101] Therefore, the EVs of the present invention are isolated EVs.

[0102] The terms "purification", "purified", "isolation" and "isolated" are used interchangeably herein and refer to the state (e.g., multiple known or unknown amounts and / or concentrations) of an EV population that has undergone one or more purification / isolation processes, such as the selection of desired EVs, or the removal or reduction of residual biological products and / or the removal of unwanted EVs, such as the removal of EVs of a specific size. According to one embodiment, the ratio of EVs to residual maternal cells is at least 2, 3, 4, 5, 6, 8 or 10 times higher than in the starting material, or in certain advantageous embodiments at least 50, 100, 1000 or 2000 times higher. According to some embodiments, the ratio is a weight ratio. In some advantageous embodiments, the term "isolated" has the meaning of being substantially cell-free or cell-free, and can be replaced by it.

[0103] According to some embodiments, the EVs (eg, exosomes) are derived from adherent cells expressing mesenchymal markers. According to some embodiments, the adherent cells expressing mesenchymal markers are selected from mesenchymal stem cells (MSCs) and olfactory ensheathing cells.

[0104] According to some embodiments, the present invention provides an isolated EV loaded with an RNAi oligonucleotide that inhibits the expression of NCAN protein. According to some embodiments, the RNAi is as defined in any one of the above embodiments and aspects. According to some embodiments, the RNAi is selected from siRNA and shRNA. According to some embodiments, the RNAi oligonucleotide is siRNA. According to some embodiments, the siRNA or shRNA that inhibits the expression of NCAN comprises a guide strand containing a nucleic acid sequence selected from SEQ ID NO: 1-5, 11-15 and 86-95. Therefore, in some embodiments, the present invention provides an isolated EV comprising siRNA or shRNA, the siRNA or shRNA comprising a guide strand containing a nucleic acid sequence selected from SEQ ID NO: 1-5, 11-15 and 86-95. According to some embodiments, the siRNA or shRNA comprises a guide strand consisting of a nucleic acid sequence selected from SEQ ID NO: 1-5, 11-15 and 86-95. According to some embodiments, the siRNA comprises a complementary strand. According to some embodiments, the complementary strand is complementary to at least 14, 15, 16, 17, 18, 19, 20 or 21 consecutive nucleotides of the guide strand. According to some embodiments, the complementary strand is complementary to 14 to 19 consecutive nucleotides of the guide strand. According to some embodiments, the complementary strand comprises 14, 15, 16, 17, 18 or 19 nucleotides. According to some embodiments, the complementary strand comprises a nucleic acid sequence selected from SEQ ID NO: 6-10, 16-20 and 96-105, wherein the complementary strand comprises a nucleic acid complementary to the nucleic acid at the corresponding position in the guide strand sequence at the 1st and 19th positions. According to one embodiment, the siRNA or shRNA is coupled to a hydrophobic portion. According to some embodiments, the hydrophobic portion is selected from sterols, gangliosides, lipids, vitamins, fatty acids, peptides and combinations thereof. According to one embodiment, the siRNA or shRNA is coupled to a sterol. In an exemplary embodiment, the moiety is a cholesterol molecule, so according to such embodiments, the siRNA or shRNA is coupled to cholesterol. According to one embodiment, the siRNA or shRNA is coupled to a hydrophilic moiety. According to some embodiments, the hydrophilic moiety is a carbohydrate. According to some embodiments, the carbohydrate is selected from monosaccharides, disaccharides, trisaccharides, tetrasaccharides and oligosaccharides. According to some embodiments, the sugar is selected from glucose, ribose, arabinose, galactose, mannose, sucrose and maltotriose. According to one embodiment, the siRNA or shRNA is coupled to a carbohydrate. In an exemplary embodiment, the moiety is a glucose molecule, so according to such embodiments, the siRNA or shRNA is coupled to glucose.

[0105] According to some embodiments, the present invention provides an isolated EV loaded with a siRNA molecule, wherein the siRNA molecule comprises an oligonucleotide pair comprising or consisting of the following nucleic acid sequences: (i) SEQ ID NOs: 1 and 6; (ii) SEQ ID NOs: 2 and 7; (iii) SEQ ID NOs: 3 and 8; or (iv) SEQ ID NOs: 4 and 9; (v) SEQ ID NOs: 5 and 10, wherein the N nucleotide in the guide chain is complementary to the N at the corresponding position in the complementary chain. According to some embodiments, the present invention provides an isolated EV loaded with a siRNA molecule, wherein the siRNA molecule comprises an oligonucleotide pair comprising or consisting of the following nucleic acid sequences: (i) SEQ ID NOs: 11 and 16; (ii) SEQ ID NOs: 12 and 17; (iii) SEQ ID NOs: 13 and 18; or (iv) SEQ ID NOs: 14 and 9; (v) SEQ ID NOs: 15 and 20; (vi) SEQ ID NOs: 86 and 96; (vii) SEQ ID NOs: 87 and 77; (viii) SEQ ID NOs: 88 and 88; (ix) SEQ ID NOs: 89 and 99; (x) SEQ ID NOs: 90 and 100; (xi) SEQ ID NOs: 91 and 101; (xii) SEQ ID NOs: 92 and 102; (xiii) SEQ ID NOs: 93 and 103; (xiv) SEQ ID NOs: 94 and 104; or (xv) SEQ ID NOs: 95 and 105. According to some embodiments, the present invention provides an isolated EV loaded with a siRNA molecule, the siRNA molecule comprising a guide strand comprising a nucleic acid sequence of SEQ ID NO: 11 and a complementary strand comprising a nucleic acid sequence of SEQ ID NO: 16. According to some embodiments, the present invention provides an isolated EV loaded with a siRNA molecule, the siRNA molecule comprising a guide strand comprising a nucleic acid sequence of SEQ ID NO: 12 and a complementary strand comprising a nucleic acid sequence of SEQ ID NO: 17. According to some embodiments, the present invention provides an isolated EV loaded with a siRNA molecule, the siRNA molecule comprising a guide strand comprising a nucleic acid sequence of SEQ ID NO: 13 and a complementary strand comprising a nucleic acid sequence of SEQ ID NO: 18. According to some embodiments, the present invention provides an isolated EV loaded with a siRNA molecule, the siRNA molecule comprising a guide strand and a complementary strand comprising nucleic acid sequences of SEQ ID NO: 86 and 96, respectively. According to some embodiments, the present invention provides an isolated EV loaded with a siRNA molecule, the siRNA molecule comprising a guide strand and a complementary strand comprising nucleic acid sequences of SEQ ID NO: 87 and 97, respectively.According to some embodiments, the present invention provides an isolated EV loaded with siRNA molecules, the siRNA molecules comprising a guide strand and a complementary strand comprising nucleic acid sequences SEQ ID NOs: 88 and 98, respectively. According to some embodiments, the present invention provides an isolated EV loaded with siRNA molecules, the siRNA molecules comprising a guide strand and a complementary strand comprising nucleic acid sequences SEQ ID NOs: 89 and 99, respectively. According to some embodiments, the present invention provides an isolated EV loaded with siRNA molecules, the siRNA molecules comprising a guide strand and a complementary strand comprising nucleic acid sequences SEQ ID NOs: 90 and 100, respectively. According to some embodiments, the present invention provides an isolated EV loaded with siRNA molecules, the siRNA molecules comprising a guide strand and a complementary strand comprising nucleic acid sequences SEQ ID NOs: 91 and 101, respectively. According to some embodiments, the present invention provides an isolated EV loaded with siRNA molecules, the siRNA molecules comprising a guide strand and a complementary strand comprising nucleic acid sequences SEQ ID NOs: 92 and 102, respectively. According to some embodiments, the present invention provides an isolated EV loaded with siRNA molecules, the siRNA molecules comprising a guide strand and a complementary strand comprising nucleic acid sequences SEQ ID NO: 93 and 103, respectively. According to some embodiments, the present invention provides an isolated EV loaded with siRNA molecules, the siRNA molecules comprising a guide strand and a complementary strand comprising nucleic acid sequences SEQ ID NO: 94 and 104, respectively. According to some embodiments, the present invention provides an isolated EV loaded with siRNA molecules, the siRNA molecules comprising a guide strand and a complementary strand comprising nucleic acid sequences SEQ ID NO: 95 and 105, respectively. According to some embodiments, the siRNA is coupled to cholesterol. According to some embodiments, the siRNA is coupled to glucose. According to some embodiments, the EV is an exosome, a microvesicle, or a combination thereof. According to some embodiments, the EV is an exosome. According to some embodiments, the EV is derived from a mesenchymal stem cell. According to some embodiments, the EV is derived from a bone marrow MSC. According to some embodiments, the EV is an exosome.

[0106] According to some embodiments, the RNAi oligonucleotide that inhibits the expression of NCAN protein is shRNA. According to some embodiments, the present invention provides an isolated EV loaded with shRNA that inhibits the expression of NCAN, the shRNA comprising a guide strand comprising a nucleic acid sequence selected from SEQ ID NOs: 1-5, 11-15 and 86-95 or consisting of the nucleic acid sequence. According to another embodiment, the shRNA comprises a complementary strand comprising a nucleic acid sequence selected from SEQ ID NOs: 6-10, 16-20 and 96-105, wherein the complementary strand comprises a nucleic acid complementary to the nucleic acid at the corresponding position in the sequence of the guide strand at the 1st and 19th positions. According to some embodiments, the shRNA that inhibits the expression of NCAN comprises an oligonucleotide pair comprising or consisting of the following nucleic acid sequences: (i) SEQ ID NOs: 1 and 6; (ii) SEQ ID NOs: 2 and 7; (iii) SEQ ID NOs: 3 and 8; or (iv) SEQ ID NOs: 4 and 9; (v) SEQ ID NOs: 5 and 10, wherein the N nucleotide in the guide strand is complementary to the N at the corresponding position in the complementary strand. According to some embodiments, the shRNA that inhibits NCAN expression comprises an oligonucleotide pair comprising or consisting of the following nucleic acid sequences: (i) SEQ ID NOs: 11 and 16; (ii) SEQ ID NOs: 12 and 17; (iii) SEQ ID NOs: 13 and 18; (iv) SEQ ID NOs: 14 and 9; (v) SEQ ID NOs: 15 and 20; (vi) SEQ ID NOs: 86 and 96; (vii) SEQ ID NOs: 87 and 77; (viii) SEQ ID NOs: 88 and 88; (ix) SEQ ID NOs: 89 and 99; (x) SEQ ID NOs: 90 and 100; (xi) SEQ ID NOs: 91 and 101; (xii) SEQ ID NOs: 92 and 102; (xiii) SEQ ID NOs: 93 and 103; (xiv) SEQ ID NOs: 94 and 104; or (xv) SEQ ID NOs: 95 and 105. According to some embodiments, the present invention provides an isolated EV loaded with a shRNA molecule, the shRNA molecule comprising a guide strand comprising a nucleic acid sequence of SEQ ID NO: 11 and a complementary strand comprising a nucleic acid sequence of SEQ ID NO: 16. According to some embodiments, the present invention provides an isolated EV loaded with a shRNA molecule, the shRNA molecule comprising a guide strand comprising a nucleic acid sequence of SEQ ID NO: 12 and a complementary strand comprising a nucleic acid sequence of SEQ ID NO: 17.According to some embodiments, the present invention provides an isolated EV loaded with a shRNA molecule, the shRNA molecule comprising a guide strand comprising a nucleic acid sequence of SEQ ID NO: 13 and a complementary strand comprising a nucleic acid sequence of SEQ ID NO: 18. According to some embodiments, the present invention provides an isolated EV loaded with a shRNA molecule, the shRNA molecule comprising a guide strand and a complementary strand comprising nucleic acid sequences of SEQ ID NO: 86 and 96, respectively. According to some embodiments, the present invention provides an isolated EV loaded with a shRNA molecule, the shRNA molecule comprising a guide strand and a complementary strand comprising nucleic acid sequences of SEQ ID NO: 87 and 97, respectively. According to some embodiments, the present invention provides an isolated EV loaded with a shRNA molecule, the shRNA molecule comprising a guide strand and a complementary strand comprising nucleic acid sequences of SEQ ID NO: 88 and 98, respectively. According to some embodiments, the present invention provides an isolated EV loaded with a shRNA molecule, the shRNA molecule comprising a guide strand and a complementary strand comprising nucleic acid sequences of SEQ ID NO: 89 and 99, respectively. According to some embodiments, the present invention provides isolated EVs loaded with shRNA molecules, the shRNA molecules comprising a guide strand and a complementary strand comprising nucleic acid sequences SEQ ID NOs: 90 and 100, respectively. According to some embodiments, the present invention provides isolated EVs loaded with shRNA molecules, the shRNA molecules comprising a guide strand and a complementary strand comprising nucleic acid sequences SEQ ID NOs: 91 and 101, respectively. According to some embodiments, the present invention provides isolated EVs loaded with shRNA molecules, the shRNA molecules comprising a guide strand and a complementary strand comprising nucleic acid sequences SEQ ID NOs: 92 and 102, respectively. According to some embodiments, the present invention provides isolated EVs loaded with shRNA molecules, the shRNA molecules comprising a guide strand and a complementary strand comprising nucleic acid sequences SEQ ID NOs: 93 and 103, respectively. According to some embodiments, the present invention provides isolated EVs loaded with shRNA molecules, the shRNA molecules comprising a guide strand and a complementary strand comprising nucleic acid sequences SEQ ID NOs: 94 and 104, respectively. According to some embodiments, the present invention provides an isolated EV loaded with a shRNA molecule, the shRNA molecule comprising a guide strand and a complementary strand comprising the nucleic acid sequences SEQ ID NO: 95 and 105, respectively. According to some embodiments, the shRNA is coupled to cholesterol. According to some embodiments, the shRNA is coupled to glucose. According to some embodiments, the EV is an exosome, a microvesicle, or a combination thereof. According to some embodiments, the EV is an exosome. According to some embodiments, the EV is derived from mesenchymal stem cells. According to some embodiments, the EV is derived from bone marrow mesenchymal stem cells. According to some embodiments, the EV is an exosome.

[0107] According to some embodiments, the present invention provides isolated EVs loaded with RNA interference (RNAi) oligonucleotides, such as siRNA or shRNA, that inhibit the expression of tenascin-R. According to some embodiments, the RNAi oligonucleotide is as defined in any one of the above embodiments. According to some embodiments, the RNAi oligonucleotide is selected from siRNA and shRNA. According to some embodiments, the RNAi oligonucleotide is siRNA. According to some embodiments, the siRNA or shRNA that inhibits TNR expression comprises a guide strand containing a nucleic acid sequence selected from SEQ ID NO: 30-43 and 58-71. According to some embodiments, the present invention provides siRNA or shRNA, comprising a guide strand containing a nucleic acid sequence selected from SEQ ID NO: 30-43 and 58-71. According to some embodiments, the siRNA or shRNA comprises a guide strand consisting of a nucleic acid sequence selected from SEQ ID NO: 30-43 and 58-71. According to some embodiments, the siRNA comprises a complementary strand. According to some embodiments, the complementary strand is complementary to at least 14, 15, 16, 17, 18, 19, 20 or 21 consecutive nucleotides of the guide strand. According to some embodiments, the complementary strand is complementary to 14 to 19 consecutive nucleotides of the guide strand. According to some embodiments, the complementary strand comprises 14, 15, 16, 17, 18 or 19 nucleotides. According to some embodiments, the complementary strand comprises a nucleic acid sequence selected from SEQ ID NO: 44-57 and 72-85, wherein the complementary strand comprises a nucleic acid complementary to the nucleic acid at the corresponding position in the sequence of the guide strand at the 1st and 19th positions. According to one embodiment, the siRNA or shRNA is coupled to a hydrophobic portion. According to some embodiments, the hydrophobic portion is selected from sterols, gangliosides, lipids, vitamins, fatty acids, peptides and combinations thereof. According to one embodiment, the siRNA or shRNA is coupled to a sterol. In an exemplary embodiment, the portion is a cholesterol molecule, so according to such embodiments, the siRNA or shRNA is coupled to cholesterol. According to one embodiment, the siRNA or shRNA is coupled to a hydrophilic moiety. According to some embodiments, the hydrophilic moiety is a carbohydrate. According to some embodiments, the carbohydrate is selected from monosaccharides, disaccharides, trisaccharides, tetrasaccharides and oligosaccharides. According to some embodiments, the sugar is selected from glucose, ribose, arabinose, galactose, mannose, sucrose and maltotriose. According to one embodiment, the siRNA or shRNA is coupled to a carbohydrate. In an exemplary embodiment, the moiety is a glucose molecule, so according to such embodiments, the siRNA or shRNA is coupled to glucose.According to some embodiments, the present invention provides an isolated EV loaded with a siRNA molecule, the siRNA molecule comprising an oligonucleotide pair comprising or consisting of the following nucleic acid sequences: (i) SEQ ID NOs: 30 and 44; (ii) SEQ ID NOs: 31 and 45; (iii) SEQ ID NOs: 32 and 46 (iv) SEQ ID NOs: 33 and 47; (v) SEQ ID NOs: 34 and 48; (vi) SEQ ID NOs: 45 and 49; (vii) SEQ ID NOs: 56 and 50; (viii) SEQ ID NOs: 37 and 51; (ix) SEQ ID NOs: 38 and 52; (x) SEQ ID NOs: 39 and 53; (xi) SEQ ID NOs: 40 and 54; (xii) SEQ ID NOs: 41 and 55; (xiii) SEQ ID NOs: 42 and 56; or (xiv) SEQ ID NOs: 43 and 57, wherein the N nucleotide in the guide strand is complementary to the N at the corresponding position in the complementary strand. According to some embodiments, the present invention provides an isolated EV loaded with a siRNA molecule, wherein the siRNA molecule comprises an oligonucleotide pair comprising or consisting of the following nucleic acid sequences: (i) SEQ ID NOs: 58 and 72; (ii) SEQ ID NOs: 59 and 73; (iii) SEQ ID NOs: 60 and 74; (iv) SEQ ID NOs: 61 and 75; (v) SEQ ID NOs: 62 and 76; (v) SEQ ID NOs: 63 and 77; (vii) SEQ ID NOs: 64 and 78; (viii) SEQ ID NOs: 65 and 79; (ix) SEQ ID NOs: 66 and 80; (x) SEQ ID NOs: 67 and 81; (xi) SEQ ID NOs: 68 and 82; (xii) SEQ ID NOs: 69 and 83; (xiii) SEQ ID NOs: 70 and 84; or (xiv) SEQ ID NOs: 71 and 85. According to some embodiments, the present invention provides an isolated EV loaded with a siRNA molecule, the siRNA molecule comprising a guide strand comprising a nucleic acid sequence of SEQ ID NO: 58 and a complementary strand comprising a nucleic acid sequence of SEQ ID NO: 72. According to some embodiments, the present invention provides an isolated EV loaded with a siRNA molecule, the siRNA molecule comprising a guide strand comprising a nucleic acid sequence of SEQ ID NO: 61 and a complementary strand comprising a nucleic acid sequence of SEQ ID NO: 75. According to some embodiments, the present invention provides an isolated EV loaded with a siRNA molecule, the siRNA molecule comprising a guide strand comprising a nucleic acid sequence of SEQ ID NO: 62 and a complementary strand comprising a nucleic acid sequence of SEQ ID NO: 76.According to some embodiments, the siRNA is coupled to cholesterol. According to some embodiments, the siRNA is coupled to glucose. According to some embodiments, the EV is an exosome, a microvesicle, or a combination thereof. According to some embodiments, the EV is an exosome. According to some embodiments, the EV is derived from mesenchymal stem cells. According to some embodiments, the EV is derived from bone marrow mesenchymal stem cells.

[0108] According to some embodiments, the RNAi oligonucleotide that inhibits the expression of tenascin-R is shRNA. According to some embodiments, the present invention provides an isolated EV loaded with an shRNA that inhibits the expression of TNR, the shRNA comprising a guide strand comprising or consisting of a nucleic acid sequence selected from SEQ ID NOs: 30-43 and 58-71. According to another embodiment, the shRNA comprises a complementary strand comprising a nucleic acid sequence selected from SEQ ID NOs: 44-57 and 72-85, wherein the complementary strand comprises a nucleic acid at positions 1 and 19 that is complementary to the nucleic acid at the corresponding position in the sequence of the guide strand. According to some embodiments, the present invention provides an isolated EV loaded with an shRNA molecule, the shRNA molecule comprising an oligonucleotide pair comprising the following nucleic acid sequences: (i) SEQ ID NOs: 30 and 44; (ii) SEQ ID NOs: 31 and 45; (iii) SEQ ID NOs: 32 and 46 (iv) SEQ ID NOs: 33 and 47; (v) SEQ ID NOs: 34 and 48; (vi) SEQ ID NOs: 45 and 49; (vii) SEQ ID NOs: 56 and 50; (viii) SEQ ID NOs: 37 and 51; (ix) SEQ ID NOs: 38 and 52; (x) SEQ ID NOs: 39 and 53; (xi) SEQ ID NOs: 40 and 54; (xii) SEQ ID NOs: 41 and 55; (xiii) SEQ ID NOs: 42 and 56; or (xiv) SEQ ID NOs: 43 and 57, wherein the N nucleotide in the guide strand is complementary to the N at the corresponding position in the complementary strand. According to some embodiments, the present invention provides an isolated EV loaded with an shRNA molecule, wherein the shRNA molecule comprises an oligonucleotide pair comprising the following nucleic acid sequences: (i) SEQ ID NOs: 58 and 72; (ii) SEQ ID NOs: 59 and 73; (iii) SEQ ID NOs: 60 and 74; (iv) SEQ ID NOs: 61 and 75; (v) SEQ ID NOs: 62 and 76; (vi) SEQ ID NOs: 63 and 77; (vii) SEQ ID NOs: 64 and 78; (viii) SEQ ID NOs: 65 and 79; (ix) SEQ ID NOs: 66 and 80; (x) SEQ ID NOs: 67 and 81; (xi) SEQ ID NOs: 68 and 82; (xii) SEQ ID NOs: 69 and 83; (xiii) SEQ ID NOs: 70 and 84; or (xiv) SEQ ID NOs: 71 and 85.According to some embodiments, the present invention provides an isolated EV loaded with a shRNA molecule, the shRNA molecule comprising a guide strand comprising a nucleic acid sequence of SEQ ID NO: 58 and a complementary strand comprising a nucleic acid sequence of SEQ ID NO: 72. According to some embodiments, the present invention provides an isolated EV loaded with a shRNA molecule, the shRNA molecule comprising a guide strand comprising a nucleic acid sequence of SEQ ID NO: 61 and a complementary strand comprising a nucleic acid sequence of SEQ ID NO: 75. According to some embodiments, the present invention provides an isolated EV loaded with a shRNA molecule, the shRNA molecule comprising a guide strand comprising a nucleic acid sequence of SEQ ID NO: 62 and a complementary strand comprising a nucleic acid sequence of SEQ ID NO: 76. According to some embodiments, the shRNA is coupled to cholesterol. According to some embodiments, the shRNA is coupled to glucose. According to some embodiments, the EV is an exosome, a microvesicle, or a combination thereof. According to some embodiments, the EV is derived from a mesenchymal stem cell. According to some embodiments, the EV is derived from a bone marrow mesenchymal stem cell. According to some embodiments, the EV is an exosome.

[0109] According to some embodiments, the present invention provides isolated EVs loaded with RNA interference (RNAi) oligonucleotides, such as siRNA or shRNA, that inhibit the expression of NCAN and TNR. According to some embodiments, the siRNA and / or shRNA molecules that inhibit the expression of NCAN and TNR are as described above.

[0110] According to some embodiments, the isolated EV of the present invention further comprises chondroitinase ABC or a nucleic acid molecule encoding it. According to some embodiments, the isolated EV of the present invention further comprises a compound selected from matrix metalloproteinases (MMPs), disintegrins and metalloproteinases with thrombospondin motifs (ADAMTS), nucleic acid molecules encoding them, and hyaluronic acid (HA).

[0111] Mesenchymal stem cell-derived EVs can be produced by culturing mesenchymal stem cells in a culture medium to modulate it.

[0112] The cells can be cultured for about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 days or longer, for example 3 days. The conditioned medium can be obtained by separating the cells from the culture medium. The conditioned medium can be centrifuged at, for example, 500 x g. It can be concentrated by membrane filtration. The membrane can include a membrane of >1000 kDa. The conditioned medium can be concentrated by about 50 times or more.

[0113] It should be understood that polynucleotides or oligonucleotides such as siRNA or shRNA can also be directly loaded into the EV. In one embodiment, the RNAi oligonucleotide is directly loaded onto the EV by electroporation and / or using a transfection agent. In an alternative embodiment, the loading is performed without electroporation and / or without a transfection agent.

[0114] According to one embodiment, the EV is incubated with the RNAi oligonucleotide inhibitor for a period of time sufficient to allow the particle to be loaded with the nucleic acid-based inhibitor. The length of time sufficient to allow the EV to be loaded with the nucleic acid-based inhibitor cargo can be optimized for a specific type of cargo, and if modified to include a hydrophobic modification, it can be optimized for the type of modification. Typically, an incubation of about 1 hour or less is sufficient to allow particles to efficiently load nucleic acid cargo. In many cases, hydrophobic modified cargoes are efficiently loaded into exosomes within a very fast period of time, such as within 5 minutes. Therefore, in some embodiments, efficient loading is performed within an incubation period of 5 minutes or less, such as 1-5 minutes. In an exemplary embodiment, efficient loading is performed within an incubation period of 5 minutes, 10 minutes, 15 minutes, 20 minutes, and 30 minutes. In other embodiments, efficient loading can be performed within 1 hour, within 2 hours, within 3 hours, within 4 hours, within 5 hours, within 6 hours, within 7 hours, within 8 hours, within 9 hours, within 10 hours, within 12 hours, within 24 hours, within 48 hours, etc.

[0115] Loading EVs with oligonucleotides is not highly temperature dependent. In an exemplary embodiment, exosomes are loaded at or around 37°C. In other embodiments, EVs (e.g., exosomes) can be loaded at or around room temperature. In other embodiments, exosomes can be loaded at or around 4°C.

[0116] According to some embodiments, the EV can be loaded without ultracentrifugation. According to other embodiments, the loading further comprises ultracentrifugation. According to some embodiments, the preparation method further comprises a step of purifying or isolating the loaded EV. According to one embodiment, the separation is achieved by centrifugation, such as ultracentrifugation. According to another embodiment, the separation is achieved by filtration. According to one embodiment, the ratio of EV to residual maternal cells after purification is at least 2, 3, 4, 5, 6, 8 or 10 times higher than in the initial material, or in certain advantageous embodiments at least 50, 100 or 1000 times higher. According to some embodiments, the EV is a cell-free EV.

[0117] According to some embodiments, the present invention provides a method for preparing EVs (e.g., exosomes), the method comprising incubating EVs with conjugated RNAi oligonucleotides, such as siRNA or shRNA, at a temperature of 25 to 42° C. for 0.5 to 5 hours. According to some embodiments, the conjugate of the siRNA or shRNA is a conjugate with cholesterol. According to some embodiments, the conjugate of the siRNA or shRNA is a conjugate with glucose.

[0118] According to one embodiment, the method further comprises the step of isolating the loaded EVs by applying centrifugation, such as ultracentrifugation. According to some embodiments, another hydrophobic moiety may be used instead of cholesterol. According to one embodiment, the RNAi oligonucleotide is a siRNA.

[0119] According to other embodiments, the EVs loaded with RNAi oligonucleotides of the present invention can be obtained from cells artificially loaded with RNAi oligonucleotides or polynucleotides encoding and capable of expressing or producing the RNAi inhibitor in cells. In this case, the polynucleotide / oligonucleotide reagent is linked to a nucleic acid construct under the control of a cis-acting regulatory element (e.g., a promoter) that can direct the expression of the reagent in a constitutive or inductive manner.

[0120] The nucleic acid reagent can be delivered using an appropriate gene delivery vector / method (transfection, transduction, etc.). Optionally, a suitable expression system is used. Examples of suitable constructs include, but are not limited to, pcDNA3, pcDNA3.1 (+ / -), pGL3, PzeoSV2 (+ / -), pDisplay, pEF / myc / cyto, pCMV / myc / cyto, each of which can be purchased from Invitrogen Co.

[0121] The expression construct can also be a virus. Examples of viral constructs include, but are not limited to, adenoviral vectors, retroviral vectors, vaccinia virus vectors, adeno-associated virus vectors, polyoma virus vectors, alphavirus vectors, rhabdovirus vectors, lentivirus vectors, and herpes virus vectors.

[0122] Viral constructs such as retroviral constructs include at least one transcription promoter / enhancer or site-limited element, or other elements of post-transcriptional modification control gene expression by other means such as alternative splicing, nuclear RNA export or messenger. Such vector constructs also include packaging signals, long terminal repeats (LTR) or parts thereof, and positive and negative strand primer binding sites suitable for the virus used, unless it is already present in the viral construct. In addition, such constructs generally include a signal sequence for secreting the peptide from the host cell where the peptide is placed. Preferably, the signal sequence for this purpose is a mammalian signal sequence or a signal sequence of a peptide variant of the present invention. Optionally, the construct may also include a signal for instructing polyadenylation, and one or more restriction sites and a translation termination sequence. For example, such constructs generally include 5'LTR, tRNA binding site, packaging signal, the origin of second strand DNA synthesis and 3'LTR or parts thereof.

[0123] The viral dose used for infection can be at least 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10 11 , 10 12 , 10 13 , 10 14 , 10 15 or higher pfu or virus particles.

[0124] Double-stranded RNA can be synthesized by adding two opposing promoters to the ends of a gene segment, with one promoter placed directly 5' of the gene and the opposing promoter placed directly 3' of the gene segment. The dsRNA can then be transcribed with a suitable polymerase.

[0125] In another embodiment, the polynucleotide or oligonucleotide reagent can be incubated with cells in culture, resulting in efficient uptake of the nucleic acid by the cells. For such embodiments, preferably the nucleic acid reagent is hydrophobically modified, as further described below.

[0126] Regardless of the method used to load the particles with the nucleic acid reagents described herein, the cells are then incubated for a period of time sufficient to produce EVs, such as exosomes. The exosomes separated from the culture medium contain exosomes loaded with nucleic acid molecules taken up, produced or expressed by the cells. Therefore, in one embodiment, a method for loading EVs with oligonucleotide cargo is provided, the method comprising incubating cells capable of producing EVs (e.g., producing exosomes) with oligonucleotides for a period of time sufficient to allow the oligonucleotides to be internalized by the cells, culturing the cells for a period of time sufficient to allow exosomes to be secreted, and isolating exosomes loaded with the oligonucleotides from the culture medium.

[0127] According to some embodiments, the present invention provides isolated EVs prepared according to any of the above embodiments.

[0128] According to another aspect, the present invention provides a composition comprising a plurality of EVs according to any one of the above embodiments and a carrier. According to some embodiments, the carrier is a pharmaceutically acceptable carrier, and the composition is a pharmaceutical composition.

[0129] According to another aspect, the present invention provides a pharmaceutical composition comprising (i) the RNAi oligonucleotide described in any one of the above aspects and embodiments, (ii) the isolated EV described in any one of the above aspects and embodiments, or (iii) a combination of (i) and (ii), and a pharmaceutically acceptable carrier. Any of the above definitions, terms and embodiments are also covered and applicable here. According to some embodiments, the present invention provides a pharmaceutical composition comprising an isolated EV loaded with an RNA interference (RNAi) oligonucleotide, wherein the RNAi oligonucleotide inhibits the expression of a protein selected from neurocan (NCAN), tenascin-R (TNR), aggrecan (ACAN), versican (VCAN), brevican (BCAN) and a combination thereof. According to one embodiment, the present invention provides a pharmaceutical composition comprising an isolated EV loaded with an RNA interference (RNAi) oligonucleotide, wherein the RNAi oligonucleotide inhibits the expression of a protein selected from neurocan, tenascin-R and a combination thereof.

[0130] According to some embodiments, the present invention provides a pharmaceutical composition comprising an anti-NCAN siRNA or shRNA as described in any one of the above aspects and embodiments, and a pharmaceutically acceptable carrier. According to some embodiments, the present invention provides a pharmaceutical composition comprising an anti-TNR siRNA or shRNA as described in any one of the above aspects and embodiments, and a pharmaceutically acceptable carrier.

[0131] According to some embodiments, the present invention provides a pharmaceutical composition comprising an isolated EV loaded with an RNAi oligonucleotide that inhibits the expression of NCAN protein. According to some embodiments, the RNAi oligonucleotide is as defined in any one of the above embodiments. According to some embodiments, the RNAi oligonucleotide is selected from siRNA and shRNA. According to some embodiments, the RNAi oligonucleotide is siRNA. According to some embodiments, the siRNA or shRNA that inhibits NCAN expression comprises a guide chain containing a nucleic acid sequence selected from SEQ ID NO: 1-5, 11-15 and 86-95. According to some embodiments, the siRNA or shRNA comprises a guide chain consisting of a nucleic acid sequence selected from SEQ ID NO: 1-5, 11-15 and 86-95. According to some embodiments, the siRNA comprises a complementary chain. According to some embodiments, the complementary chain is complementary to at least 14, 15, 16, 17, 18, 19, 20 or 21 consecutive nucleotides of the guide chain. According to some embodiments, the complementary chain is complementary to 14 to 19 consecutive nucleotides of the guide chain. According to some embodiments, the complementary strand comprises 14, 15, 16, 17, 18 or 19 nucleotides. According to some embodiments, the complementary strand comprises a nucleic acid sequence selected from SEQ ID NOs: 6-10, 16-20 and 96-105, wherein the complementary strand comprises a nucleic acid complementary to the nucleic acid at the corresponding position in the sequence of the guide strand at the 1st and 19th positions. According to one embodiment, the siRNA or shRNA is coupled to a hydrophobic moiety. According to some embodiments, the hydrophobic moiety is selected from sterols, gangliosides, lipids, vitamins, fatty acids, peptides and combinations thereof. According to one embodiment, the siRNA or shRNA is coupled to a sterol. In an exemplary embodiment, the moiety is a cholesterol molecule, and thus according to such embodiments, the siRNA or shRNA is coupled to cholesterol. According to one embodiment, the siRNA or shRNA is coupled to a hydrophilic moiety. According to some embodiments, the hydrophilic moiety is a carbohydrate. According to some embodiments, the carbohydrate is selected from monosaccharides, disaccharides, trisaccharides, tetrasaccharides and oligosaccharides. According to some embodiments, the sugar is selected from glucose, ribose, arabinose, galactose, mannose, sucrose and maltotriose. According to one embodiment, the siRNA or shRNA is coupled to a carbohydrate. In an exemplary embodiment, the moiety is a glucose molecule, so according to this type of embodiment, the siRNA or shRNA is coupled to glucose.

[0132] According to some embodiments, the present invention provides a pharmaceutical composition comprising isolated EVs loaded with siRNA molecules, wherein the siRNA molecules comprise oligonucleotide pairs comprising or consisting of the following nucleic acid sequences: (i) SEQ ID NOs: 1 and 6; (ii) SEQ ID NOs: 2 and 7; (iii) SEQ ID NOs: 3 and 8; or (iv) SEQ ID NOs: 4 and 9; (v) SEQ ID NOs: 5 and 10, wherein the N nucleotide in the guide chain is complementary to the N at the corresponding position in the complementary chain. According to some embodiments, the present invention provides a pharmaceutical composition comprising an isolated EV loaded with an siRNA molecule, wherein the siRNA molecule comprises an oligonucleotide pair comprising or consisting of the following nucleic acid sequences: (i) SEQ ID NOs: 11 and 16; (ii) SEQ ID NOs: 12 and 17; (iii) SEQ ID NOs: 13 and 18; or (iv) SEQ ID NOs: 14 and 9; (v) SEQ ID NOs: 15 and 20; (vi) SEQ ID NOs: 86 and 96; (vii) SEQ ID NOs: 87 and 77; (viii) SEQ ID NOs: 88 and 88; (ix) SEQ ID NOs: 89 and 99; (x) SEQ ID NOs: 90 and 100; (xi) SEQ ID NOs: 91 and 101; (xii) SEQ ID NOs: 92 and 102; (xiii) SEQ ID NOs: 93 and 103; (xiv) SEQ ID NOs: 94 and 104; or (xv) SEQ ID NOs: IDNO: 95 and 105. According to some embodiments, the present invention provides a pharmaceutical composition comprising an isolated EV loaded with a siRNA molecule, the siRNA molecule comprising a guide strand comprising a nucleic acid sequence of SEQ ID NO: 11 and a complementary strand comprising a nucleic acid sequence of SEQ ID NO: 16. According to some embodiments, the present invention provides a pharmaceutical composition comprising an isolated EV loaded with a siRNA molecule, the siRNA molecule comprising a guide strand comprising a nucleic acid sequence of SEQ ID NO: 12 and a complementary strand comprising a nucleic acid sequence of SEQ ID NO: 17. According to some embodiments, the present invention provides a pharmaceutical composition comprising an isolated EV loaded with a siRNA molecule, the siRNA molecule comprising a guide strand comprising a nucleic acid sequence of SEQ ID NO: 13 and a complementary strand comprising a nucleic acid sequence of SEQ ID NO: 18. According to some embodiments, the present invention provides a pharmaceutical composition comprising an isolated EV loaded with a siRNA molecule, the siRNA molecule comprising a guide strand and a complementary strand comprising nucleic acid sequences of SEQ ID NO: 86 and 96, respectively.According to some embodiments, the present invention provides a pharmaceutical composition comprising an isolated EV loaded with siRNA molecules, the siRNA molecules comprising a guide strand and a complementary strand comprising nucleic acid sequences SEQ ID NOs: 87 and 97, respectively. According to some embodiments, the present invention provides a pharmaceutical composition comprising an isolated EV loaded with siRNA molecules, the siRNA molecules comprising a guide strand and a complementary strand comprising nucleic acid sequences SEQ ID NOs: 88 and 98, respectively. According to some embodiments, the present invention provides a pharmaceutical composition comprising an isolated EV loaded with siRNA molecules, the siRNA molecules comprising a guide strand and a complementary strand comprising nucleic acid sequences SEQ ID NOs: 89 and 99, respectively. According to some embodiments, the present invention provides a pharmaceutical composition comprising an isolated EV loaded with siRNA molecules, the siRNA molecules comprising a guide strand and a complementary strand comprising nucleic acid sequences SEQ ID NOs: 90 and 100, respectively. According to some embodiments, the present invention provides a pharmaceutical composition comprising an isolated EV loaded with siRNA molecules, the siRNA molecules comprising a guide strand and a complementary strand comprising nucleic acid sequences SEQ ID NOs: 91 and 101, respectively. According to some embodiments, the present invention provides a pharmaceutical composition comprising an isolated EV loaded with siRNA molecules, the siRNA molecules comprising a guide strand and a complementary strand comprising nucleic acid sequences SEQ ID NO: 92 and 102, respectively. According to some embodiments, the present invention provides a pharmaceutical composition comprising an isolated EV loaded with siRNA molecules, the siRNA molecules comprising a guide strand and a complementary strand comprising nucleic acid sequences SEQ ID NO: 93 and 103, respectively. According to some embodiments, the present invention provides a pharmaceutical composition comprising an isolated EV loaded with siRNA molecules, the siRNA molecules comprising a guide strand and a complementary strand comprising nucleic acid sequences SEQ ID NO: 94 and 104, respectively. According to some embodiments, the present invention provides a pharmaceutical composition comprising an isolated EV loaded with siRNA molecules, the siRNA molecules comprising a guide strand and a complementary strand comprising nucleic acid sequences SEQ ID NO: 95 and 105, respectively. According to some embodiments, the siRNA is coupled to cholesterol. According to some embodiments, the siRNA is coupled to glucose. According to some embodiments, the EV is an exosome, a microvesicle, or a combination thereof. According to some embodiments, the EV is derived from a mesenchymal stem cell.

[0133] According to some embodiments, the present invention provides a pharmaceutical composition comprising an isolated EV loaded with an shRNA molecule, wherein the shRNA molecule comprises an oligonucleotide pair comprising or consisting of the following nucleic acid sequences: (i) SEQ ID NOs: 1 and 6; (ii) SEQ ID NOs: 2 and 7; (iii) SEQ ID NOs: 3 and 8; or (iv) SEQ ID NOs: 4 and 9; (v) SEQ ID NOs: 5 and 10, wherein the N nucleotide in the guide chain is complementary to the N at the corresponding position in the complementary chain. According to some embodiments, the present invention provides a pharmaceutical composition comprising an isolated EV loaded with an shRNA molecule, wherein the shRNA molecule comprises an oligonucleotide pair comprising or consisting of the following nucleic acid sequences: (i) SEQ ID NOs: 11 and 16; (ii) SEQ ID NOs: 12 and 17; (iii) SEQ ID NOs: 13 and 18; or (iv) SEQ ID NOs: 14 and 9; (v) SEQ ID NOs: 15 and 20; (vi) SEQ ID NOs: 86 and 96; (vii) SEQ ID NOs: 87 and 77; (viii) SEQ ID NOs: 88 and 88; (ix) SEQ ID NOs: 89 and 99; (x) SEQ ID NOs: 90 and 100; (xi) SEQ ID NOs: 91 and 101; (xii) SEQ ID NOs: 92 and 102; (xiii) SEQ ID NOs: 93 and 103; (xiv) SEQ ID NOs: 94 and 104; or (xv) SEQ IDNO: 95 and 105. According to some embodiments, the shRNA is coupled to cholesterol. According to some embodiments, the shRNA is coupled to glucose. According to some embodiments, the EV is an exosome, a microvesicle, or a combination thereof. According to some embodiments, the EV is derived from a mesenchymal stem cell.

[0134] According to some embodiments, the present invention provides a pharmaceutical composition comprising an isolated EV loaded with an RNAi oligonucleotide that inhibits TNR protein expression. According to some embodiments, the RNAi oligonucleotide is as defined in any one of the above embodiments. According to some embodiments, the RNAi is selected from siRNA and shRNA. According to some embodiments, the RNAi oligonucleotide is siRNA. According to some embodiments, the siRNA or shRNA that inhibits TNR expression comprises a guide strand containing a nucleic acid sequence selected from SEQ ID NO: 30-43 and 58-71. According to some embodiments, the siRNA or shRNA comprises a guide strand consisting of a nucleic acid sequence selected from SEQ ID NO: 30-43 and 58-71. According to some embodiments, the siRNA comprises a complementary strand, i.e., a strand complementary to the guide strand. According to some embodiments, the complementary strand is complementary to at least 14, 15, 16, 17, 18, 19, 20 or 21 consecutive nucleotides of the guide strand. According to some embodiments, the complementary strand is complementary to 14 to 19 consecutive nucleotides of the guide strand. According to some embodiments, the complementary strand comprises 14, 15, 16, 17, 18 or 19 nucleotides. According to some embodiments, the complementary strand comprises a nucleic acid sequence selected from SEQ ID NOs: 44-57 and 72-85, wherein the complementary strand comprises a nucleic acid complementary to the nucleic acid at the corresponding position in the sequence of the guide strand at the 1st and 19th positions. According to one embodiment, the siRNA or siRNA that inhibits TNR expression is coupled to a hydrophobic portion. According to some embodiments, the hydrophobic portion is selected from sterols, gangliosides, lipids, vitamins, fatty acids, peptides and combinations thereof. According to one embodiment, the siRNA or shRNA is coupled to a sterol. In an exemplary embodiment, the portion is a cholesterol molecule, and thus according to such embodiments, the siRNA or shRNA is coupled to cholesterol. According to one embodiment, the siRNA or shRNA is coupled to a hydrophilic portion. According to some embodiments, the hydrophilic portion is a carbohydrate. According to some embodiments, the carbohydrate is selected from monosaccharides, disaccharides, trisaccharides, tetrasaccharides and oligosaccharides. According to some embodiments, the sugar is selected from glucose, ribose, arabinose, galactose, mannose, sucrose and maltotriose. According to one embodiment, the siRNA or shRNA is coupled to a carbohydrate. In an exemplary embodiment, the moiety is a glucose molecule, so according to this type of embodiment, the siRNA or shRNA is coupled to glucose.

[0135] According to some embodiments, the present invention provides a pharmaceutical composition comprising an EV loaded with a siRNA molecule that inhibits TNR expression, wherein the siRNA molecule comprises a guide strand comprising a nucleic acid sequence selected from SEQ ID NOs: 30-43 and 58-71 or consisting of the nucleic acid sequence. According to another embodiment, the siRNA comprises a complementary strand comprising a nucleic acid sequence selected from SEQ ID NOs: 44-57 and 72-85, wherein the complementary strand comprises a nucleic acid at positions 1 and 19 that is complementary to the nucleic acid at the corresponding position in the sequence of the guide strand. According to some embodiments, the present invention provides a pharmaceutical composition comprising an isolated EV loaded with a siRNA molecule, wherein the siRNA molecule comprises an oligonucleotide pair comprising or consisting of the following nucleic acid sequences: (i) SEQ ID NOs: 30 and 44; (ii) SEQ ID NOs: 31 and 45; (iii) SEQ ID NOs: 32 and 46 (iv) SEQ ID NOs: 33 and 47; (v) SEQ ID NOs: 34 and 48; (vi) SEQ ID NOs: 45 and 49; (vii) SEQ ID NOs: 56 and 50; (viii) SEQ ID NOs: 37 and 51; (ix) SEQ ID NOs: 38 and 52; (x) SEQ ID NOs: 39 and 53; (xi) SEQ ID NOs: 40 and 54; (xii) SEQ ID NOs: 41 and 55; (xiii) SEQ ID NOs: 42 and 56; or (xiv) SEQ ID NOs: 43 and 57, wherein the N nucleotide in the guide strand is complementary to the N at the corresponding position in the complementary strand. According to some embodiments, the present invention provides a pharmaceutical composition comprising an isolated EV loaded with an siRNA molecule, wherein the siRNA molecule comprises an oligonucleotide pair comprising or consisting of the following nucleic acid sequences: (i) SEQ ID NOs: 58 and 72; (ii) SEQ ID NOs: 59 and 73; (iii) SEQ ID NOs: 60 and 74; (iv) SEQ ID NOs: 61 and 75; (v) SEQ ID NOs: 62 and 76; (vi) SEQ ID NOs: 63 and 77; (vii) SEQ ID NOs: 64 and 78; (viii) SEQ ID NOs: 65 and 79; (ix) SEQ ID NOs: 66 and 80; (x) SEQ ID NOs: 67 and 81; (xi) SEQ ID NOs: 68 and 82; (xii) SEQ ID NOs: 69 and 83; (xiii) SEQ ID NOs: 70 and 84; or (xiv) SEQ ID NOs: 71 and 85.According to some embodiments, the present invention provides a pharmaceutical composition comprising an isolated EV loaded with a siRNA molecule, the siRNA molecule comprising a guide strand comprising a nucleic acid sequence of SEQ ID NO: 58 and a complementary strand comprising a nucleic acid sequence of SEQ ID NO: 72. According to some embodiments, the present invention provides a pharmaceutical composition comprising an isolated EV loaded with a siRNA molecule, the siRNA molecule comprising a guide strand comprising a nucleic acid sequence of SEQ ID NO: 61 and a complementary strand comprising a nucleic acid sequence of SEQ ID NO: 75. According to some embodiments, the present invention provides a pharmaceutical composition comprising an isolated EV loaded with a siRNA molecule, the siRNA molecule comprising a guide strand comprising a nucleic acid sequence of SEQ ID NO: 62 and a complementary strand comprising a nucleic acid sequence of SEQ ID NO: 76. According to some embodiments, the siRNA is coupled to cholesterol. According to some embodiments, the siRNA is coupled to glucose. According to some embodiments, the EV is an exosome, a microvesicle, or a combination thereof. According to some embodiments, the EV is derived from a mesenchymal stem cell.

[0136] According to some embodiments, the present invention provides a pharmaceutical composition comprising an isolated EV loaded with an shRNA molecule, wherein the shRNA molecule comprises an oligonucleotide pair comprising or consisting of the following nucleic acid sequences: (i) SEQ ID NOs: 30 and 44; (ii) SEQ ID NOs: 31 and 45; (iii) SEQ ID NOs: 32 and 46 (iv) SEQ ID NOs: 33 and 47; (v) SEQ ID NOs: 34 and 48; (vi) SEQ ID NOs: 45 and 49; (vii) SEQ ID NOs: 56 and 50; (viii) SEQ ID NOs: 37 and 51; (ix) SEQ ID NOs: 38 and 52; (x) SEQ ID NOs: 39 and 53; (xi) SEQ ID NOs: 40 and 54; (xii) SEQ ID NOs: 41 and 55; (xiii) SEQ ID NOs: 42 and 56; or (xiv) SEQ ID NOs: 43 and 57, wherein the N nucleotide in the guide strand is complementary to the N at the corresponding position in the complementary strand. According to some embodiments, the present invention provides a pharmaceutical composition comprising an isolated EV loaded with an shRNA molecule, wherein the shRNA molecule comprises an oligonucleotide pair comprising or consisting of the following nucleic acid sequences: (i) SEQ ID NOs: 58 and 72; (ii) SEQ ID NOs: 59 and 73; (iii) SEQ ID NOs: 60 and 74; (iv) SEQ ID NOs: 61 and 75; (v) SEQ ID NOs: 62 and 76; (v) SEQ ID NOs: 63 and 77; (vii) SEQ ID NOs: 64 and 78; (viii) SEQ ID NOs: 65 and 79; (ix) SEQ ID NOs: 66 and 80; (x) SEQ ID NOs: 67 and 81; (xi) SEQ ID NOs: 68 and 82; (xii) SEQ ID NOs: 69 and 83; (xiii) SEQ ID NOs: 70 and 84; or (xiv) SEQ ID NOs: 71 and 85. According to some embodiments, the present invention provides a pharmaceutical composition comprising an isolated EV loaded with a shRNA molecule comprising a guide strand comprising a nucleic acid sequence of SEQ ID NO: 58 and a complementary strand comprising a nucleic acid sequence of SEQ ID NO: 72. According to some embodiments, the present invention provides a pharmaceutical composition comprising an isolated EV loaded with a shRNA molecule comprising a guide strand comprising a nucleic acid sequence of SEQ ID NO: 61 and a complementary strand comprising a nucleic acid sequence of SEQ ID NO: 75.According to some embodiments, the present invention provides a pharmaceutical composition comprising an isolated EV loaded with a shRNA molecule, wherein the shRNA molecule comprises a guide strand comprising a nucleic acid sequence of SEQ ID NO: 62 and a complementary strand comprising a nucleic acid sequence of SEQ ID NO: 76. According to some embodiments, the siRNA is coupled to cholesterol. According to some embodiments, the siRNA is coupled to glucose. According to some embodiments, the EV is an exosome, a microvesicle, or a combination thereof. According to some embodiments, the EV is derived from a mesenchymal stem cell.

[0137] According to some embodiments, the present invention provides a pharmaceutical composition comprising an isolated EV loaded with the RNAi oligonucleotide of the present invention that inhibits the expression of NCAN protein and an EV loaded with the RNAi oligonucleotide of the present invention that inhibits the expression of TNR protein.

[0138] The siRNA and shRNA molecules promote sequence-specific degradation of mRNA by RNAi to achieve 95%, 90%, 85%, 80%, 75%, 70%, 60%, 50%, 40%, 30%, 20%, 10% or 5% inhibition of expression of a desired protein (e.g., NCAN or TNR) or a reduction in the expression level of a desired gene (e.g., NCAN or TNR).

[0139] The term "pharmaceutical composition" as used herein refers to a composition comprising the siRNA, shRNA or RNAi-loaded EVs of the present invention, particularly EVs (eg, exosomes), formulated together with one or more pharmaceutically acceptable carriers.

[0140] The preparation of the pharmaceutical composition can be adjusted according to the application. Specifically, the pharmaceutical composition can be prepared using methods known in the art so as to provide a rapid, continuous or delayed release of the active ingredient after being applied to a mammal. For example, the preparation can be selected from plasters, granules, lotions, liniments, lemonade, aromatic waters, powders, syrups, eye ointments, liquids and solutions, aerosols, sprays, extracts, elixirs, ointments, fluid extracts, emulsions, suspensions, decoctions, infusions, ophthalmic solutions, tablets, suppositories, injections, spirits, capsules, creams, lozenges, tinctures, pastes, pills and any one of soft or hard gelatin capsules.

[0141] As used herein, the term "pharmaceutically acceptable carrier" or "pharmaceutically acceptable excipient" refers to any and all solvents, dispersion media, preservatives, antioxidants, coating agents, isotonic and absorption delaying agents, surfactants, fillers, disintegrants, binders, diluents, lubricants, glidants, pH regulators, buffers, enhancers, wetting agents, solubilizers, surfactants, antioxidants, etc. that are compatible with drug administration. The use of such media and agents for pharmaceutically active substances is well known in the art. The composition may contain other active compounds that provide supplementary, additional or enhanced therapeutic functions. Solid carriers or excipients such as lactose, starch or talc, or liquid carriers such as water, fatty oils or liquid paraffin. Other examples of the carrier include culture media such as DMEM or RPMI; low temperature storage media containing components that scavenge free radicals, provide pH buffering, swelling / osmotic support, energy substrates and ion concentrations, and balance intracellular conditions at low temperatures; and mixtures of organic solvents and water.

[0142] According to any of the above embodiments, the pharmaceutical composition is formulated for administration by an administration route selected from intranasal, intralesional, intrathecal, intravenous, intramuscular, subcutaneous, sublingual, oral and intracerebral administration routes. According to one embodiment, the pharmaceutical composition is formulated for intranasal administration. According to some embodiments, such pharmaceutical compositions take the form of liquid solutions, nasal drops, sprays, metered powders or powders. According to other embodiments, the pharmaceutical composition is formulated for injection, such as intralesional, intrathecal or intravenous injection. According to such embodiments, the pharmaceutical composition takes the form of a sterile injection solution.

[0143] According to some embodiments, the pharmaceutical composition is formulated for administration via an administration route selected from the group consisting of intranasal, intralesional, intrathecal, intravenous, intramuscular, subcutaneous, sublingual, oral, and intracerebral administration routes.

[0144] According to one embodiment, the pharmaceutical composition is formulated for intranasal administration.

[0145] According to some embodiments, the present invention provides an intranasal pharmaceutical composition comprising an EV loaded with a siRNA or shRNA molecule that inhibits NCAN expression, wherein the siRNA or shRNA molecule comprises a guide strand comprising or consisting of a nucleic acid sequence selected from SEQ ID NOs: 1-5, 11-15, and 86-95, wherein the complementary strand comprises a nucleic acid complementary to a nucleic acid at a corresponding position in the sequence of the guide strand at positions 1 and 19. According to another embodiment, the siRNA or shRNA that inhibits NCAN expression comprises a complementary strand comprising a nucleic acid sequence selected from SEQ ID NOs: 6-10, 16-20, and 96-105, wherein the complementary strand comprises a nucleic acid complementary to a nucleic acid at a corresponding position in the sequence of the guide strand at positions 1 and 19. According to some embodiments, the present invention provides an intranasal pharmaceutical composition comprising EVs loaded with siRNA or shRNA molecules that inhibit NCAN expression, wherein the siRNA or shRNA molecules comprise a guide chain containing or consisting of the following nucleic acid sequences: (i) SEQ ID NOs: 1 and 6; (ii) SEQ ID NOs: 2 and 7; (iii) SEQ ID NOs: 3 and 8; or (iv) SEQ ID NOs: 4 and 9; (v) SEQ ID NOs: 5 and 10, wherein the N nucleotide in the guide chain is complementary to the N at the corresponding position in the complementary chain. According to some embodiments, the present invention provides an intranasal pharmaceutical composition comprising an EV loaded with a siRNA or shRNA molecule that inhibits NCAN expression, wherein the siRNA or shRNA molecule comprises a guide chain containing or consisting of the following nucleic acid sequences: (i) SEQ ID NOs: 11 and 16; (ii) SEQ ID NOs: 12 and 17; (iii) SEQ ID NOs: 13 and 18; or (iv) SEQ ID NOs: 14 and 9; (v) SEQ ID NOs: 15 and 20; (vi) SEQ ID NOs: 86 and 96; (vii) SEQ ID NOs: 87 and 77; (viii) SEQ ID NOs: 88 and 88; (ix) SEQ ID NOs: 89 and 99; (x) SEQ ID NOs: 90 and 100; (xi) SEQ ID NOs: 91 and 101; (xii) SEQ ID NOs: 92 and 102; (xiii) SEQ ID NOs: 93 and 103; (xiv) SEQ ID NOs: NO: 94 and 104; or (xv) SEQ ID NO: 95 and 105. According to some embodiments, the present invention provides an intranasal pharmaceutical composition comprising isolated EVs loaded with siRNA molecules, wherein the siRNA molecules comprise a guide strand and a complementary strand comprising nucleic acid sequences SEQ ID NO: 11 and 16, respectively.According to some embodiments, the present invention provides an intranasal pharmaceutical composition comprising an isolated EV loaded with siRNA molecules, wherein the siRNA molecules comprise a guide strand and a complementary strand comprising nucleic acid sequences SEQ ID NOs: 12 and 17, respectively. According to some embodiments, the present invention provides an intranasal pharmaceutical composition comprising an isolated EV loaded with siRNA molecules, wherein the siRNA molecules comprise a guide strand and a complementary strand comprising nucleic acid sequences SEQ ID NOs: 13 and 18, respectively. According to some embodiments, the siRNA or shRNA is coupled to cholesterol. According to some embodiments, the siRNA or shRNA is coupled to glucose. According to some embodiments, the EV is an exosome, a microvesicle, or a combination thereof. According to some embodiments, the EV is derived from a mesenchymal stem cell.

[0146] According to some embodiments, the present invention provides an intranasal pharmaceutical composition comprising an EV loaded with a siRNA or shRNA molecule that inhibits TNR expression, wherein the siRNA or shRNA molecule comprises a guide strand comprising a nucleic acid sequence selected from SEQ ID NOs: 30-43 and 58-71 or consisting of the nucleic acid sequence. According to another embodiment, the siRNA or shRNA comprises a complementary strand comprising a nucleic acid sequence selected from SEQ ID NOs: 44-57 and 72-85, wherein the complementary strand comprises a nucleic acid at positions 1 and 19 that is complementary to the nucleic acid at the corresponding position in the sequence of the guide strand. According to some embodiments, the present invention provides an intranasal pharmaceutical composition comprising an EV loaded with a siRNA or shRNA molecule that inhibits TNR expression, wherein the siRNA or shRNA molecule comprises a guide chain containing or consisting of the following nucleic acid sequences: (i) SEQ ID NOs: 30 and 44; (ii) SEQ ID NOs: 31 and 45; (iii) SEQ ID NOs: 32 and 46 (iv) SEQ ID NOs: 33 and 47; (v) SEQ ID NOs: 34 and 48; (vi) SEQ ID NOs: 45 and 49; (vii) SEQ ID NOs: 56 and 50; (viii) SEQ ID NOs: 37 and 51; (ix) SEQ ID NOs: 38 and 52; (x) SEQ ID NOs: 39 and 53; (xi) SEQ ID NOs: 40 and 54; (xii) SEQ ID NOs: 41 and 55; (xiii) SEQ ID NOs: 42 and 56; or (xiv) SEQ ID NOs: 43 and 57, wherein the N nucleotide in the guide strand is complementary to the N at the corresponding position in the complementary strand.According to some embodiments, the present invention provides an intranasal pharmaceutical composition comprising an EV loaded with a siRNA or shRNA molecule that inhibits TNR expression, wherein the siRNA or shRNA molecule comprises a guide chain containing or consisting of the following nucleic acid sequences: (i) SEQ ID NOs: 58 and 72; (ii) SEQ ID NOs: 59 and 73; (iii) SEQ ID NOs: 60 and 74; (iv) SEQ ID NOs: 61 and 75; (v) SEQ ID NOs: 62 and 76; (v) SEQ ID NOs: 63 and 77; (vii) SEQ ID NOs: 64 and 78; (viii) SEQ ID NOs: 65 and 79; (ix) SEQ ID NOs: 66 and 80; (x) SEQ ID NOs: 67 and 81; (xi) SEQ ID NOs: 68 and 82; (xii) SEQ ID NOs: 69 and 83; (xiii) SEQ ID NOs: 70 and 84; or (xiv) SEQ ID NOs: 71 and 85. According to some embodiments, the present invention provides an intranasal pharmaceutical composition comprising an isolated EV loaded with a siRNA molecule, the siRNA molecule comprising a guide strand comprising a nucleic acid sequence of SEQ ID NO: 58 and a complementary strand comprising a nucleic acid sequence of SEQ ID NO: 72. According to some embodiments, the present invention provides an intranasal pharmaceutical composition comprising an isolated EV loaded with a siRNA molecule, the siRNA molecule comprising a guide strand comprising a nucleic acid sequence of SEQ ID NO: 61 and a complementary strand comprising a nucleic acid sequence of SEQ ID NO: 75. According to some embodiments, the present invention provides an intranasal pharmaceutical composition comprising an isolated EV loaded with a siRNA molecule, the siRNA molecule comprising a guide strand comprising a nucleic acid sequence of SEQ ID NO: 62 and a complementary strand comprising a nucleic acid sequence of SEQ ID NO: 76. According to some embodiments, the siRNA or shRNA is coupled to cholesterol. According to some embodiments, the siRNA or shRNA is coupled to glucose. According to some embodiments, the EV is an exosome, a microvesicle, or a combination thereof. According to some embodiments, the EV is derived from a mesenchymal stem cell.

[0147] According to some embodiments, the isolated EV of the present invention further comprises chondroitinase ABC (chABC) or a nucleic acid molecule encoding it. According to some embodiments, the isolated EV of the present invention further comprises a compound selected from matrix metalloproteinases (MMPs), disintegrins and metalloproteinases with thrombospondin motifs (ADAMTS), nucleic acid molecules encoding them, and hyaluronic acid (HA).

[0148] According to any one of the above embodiments, the pharmaceutical composition of the present invention is used to induce nerve regeneration after nerve damage. According to any one of the above embodiments, the pharmaceutical composition of the present invention is used to prevent the inhibition of nerve regeneration after nerve damage. According to any one of the above embodiments, the pharmaceutical composition of the present invention is used to treat a nervous system disease, disorder, injury or condition. According to one embodiment, the nervous system condition is spinal cord injury.

[0149] According to any of the above embodiments, the pharmaceutical composition is for use in treating a neurological disease, disorder or condition. According to some embodiments, the pharmaceutical composition is for use in treating neuronal injury or damage in a subject.

[0150] The term "neurological disease, disorder or condition" refers to a disease, disorder or condition of the brain, spinal column and / or the nerves connecting them.

[0151] According to specific embodiments, the condition is caused by an injury. According to one embodiment, the injury is to the spinal cord, i.e. a spinal cord injury (SCI). According to other embodiments, the neurological disease, disorder or condition is a neuronal injury.

[0152] The terms "spinal cord injury" and "SCI" ​​are used interchangeably herein and refer to damage to the spinal cord. According to one embodiment, the injury is the result of trauma. According to another embodiment, the injury or damage is the result of degeneration or disease. Depending on the location of the spinal cord and nerve roots damaged, symptoms may vary greatly, such as from pain to paralysis to incontinence. Spinal cord injuries are described as "incomplete" injuries of varying degrees, which can range from no effect on the patient to "complete" injuries (i.e., complete loss of function). There are many causes of spinal cord injury, but they are usually associated with major trauma caused by motor vehicle accidents, falls, sports injuries, and violence. Therefore, according to one embodiment, the SCI is selected from complete and incomplete SCI. According to some embodiments, the spinal cord injury is selected from acute or chronic SCI. The spinal cord injury may be prone to secondary tissue damage, including but not limited to glial scar formation, myelin inhibition, demyelination, cell death, lack of neurotrophic support, ischemia, free radical formation, and excitotoxicity.

[0153] Such spinal cord diseases include, but are not limited to, autoimmune diseases (eg, multiple sclerosis), inflammatory diseases (eg, arachnoiditis), neurodegenerative diseases, poliomyelitis, spina bifida, and spinal tumors.

[0154] Subjects that can be treated according to the teachings of the present invention include mammalian subjects, such as humans, mice, rats, monkeys, dogs, and cats. In one embodiment, the subject is a human subject.

[0155] The term "treating" a condition or patient refers to taking steps to obtain a beneficial or desired result, including a clinical result. Beneficial or desired clinical results include, but are not limited to, improving or eliminating, substantially inhibiting, slowing or reversing the progression of a disease, condition or disorder, substantially improving or alleviating the clinical or aesthetic symptoms of a condition, substantially preventing the appearance of clinical or aesthetic symptoms of a disease, condition or disorder, and providing protection from harmful or annoying symptoms. Treatment further refers to accomplishing one or more of the following: (a) reducing the severity of the disease; (b) limiting the development of symptoms characteristic of the disorder being treated; (c) limiting the worsening of symptoms characteristic of the disorder being treated; (d) limiting the recurrence of the disorder in patients who previously suffered from the disorder; and / or (e) limiting the recurrence of symptoms in patients who were previously asymptomatic for the disorder. According to some embodiments, the term "treating" includes neural regeneration, axonal propagation, reduced astrogliosis, and reduced microgliosis at the site of injury. According to other embodiments, the term encompasses improvement of symptoms associated with the disease or condition. According to one embodiment, the term "treating" includes improving motor parameters. According to one embodiment, the improvement in a motor parameter comprises a 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% improvement in a motor parameter compared to an untreated subject. According to some embodiments, treatment comprises a reduction in astrogliosis and / or microgliosis at the site of injury. According to one embodiment, a reduction in astrogliosis and / or microgliosis comprises a 10%, 20%, 30%, 40%, 50%, 60%, 70%, or 80% reduction in astrogliosis and / or microgliosis compared to an untreated subject.

[0156] The pharmaceutical composition of the present invention can be applied using any known method. The term "application" of a substance, compound or medicament to a subject can be performed using one of various methods known to those skilled in the art. For example, the compound or medicament can be administered intranasally (e.g., by inhalation), intrathecal (entering the spinal canal or subarachnoid space), intraarterially, intradermally, intramuscularly, intraperitoneally, intravenously, subcutaneously, ocularly, sublingually, orally (by ingestion), intracerebrally and transdermally (by absorption, e.g., by skin catheter). The compound or medicament can also be appropriately introduced by a reloadable or biodegradable polymer device or other device (e.g., patch and pump) or a formulation providing an extension, slow or controlled release of the compound or medicament. Administration can also be performed, for example, once, multiple times and / or in one or more extended time periods. According to some embodiments, the composition is administered 1, 2, 3, 4, 5 or 6 times a day. According to other embodiments, the composition is administered 1, 2, 3, 4, 5 or 6 times a month. In some embodiments, administration includes both direct administration (including self-administration) and indirect administration (including prescribing behavior). For example, as used herein, a physician who instructs a patient to self-administer a drug or has another person administer a drug and / or provides a patient with a prescription for a drug is administering the drug to the patient. According to one embodiment, the pharmaceutical composition of the present invention is administered intranasally. According to another embodiment, the pharmaceutical composition of the present invention is administered intralesionally. According to another embodiment, the pharmaceutical composition of the present invention is administered near the lesion or injury. According to one embodiment, the pharmaceutical composition is administered orally.

[0157] According to one embodiment, the pharmaceutical composition is administered intranasally.

[0158] For a 70 kg human, an exemplary dose of membrane vesicles (e.g., exosomes) that can be administered (e.g., intranasally) per treatment can be in the range of 1 x 10 6 – 1x 10 20 and / or 1x 10 9 – 1x 10 15 between.

[0159] According to some embodiments, the pharmaceutical composition according to any one of the above embodiments is used to enhance nerve regeneration. According to some embodiments, the pharmaceutical composition according to any one of the above embodiments is used to enhance neuronal plasticity.

[0160] According to another aspect, the present invention provides a method for treating neuronal injury or damage in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of an isolated EV, the EV comprising an inhibitor of expression of a protein selected from neurocan (NCAN), tenascin-R (TNR), aggrecan (ACAN), versican (VCAN), short proteoglycan (BCAN) and a combination thereof. According to some embodiments, the present invention provides a method for inducing nerve regeneration after nerve damage in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of an isolated EV, the EV comprising an inhibitor of expression of a protein selected from neurocan (NCAN), tenascin-R (TNR), aggrecan (ACAN), versican (VCAN), short proteoglycan (BCAN) and a combination thereof. According to some embodiments, the administration is intranasal administration. According to other embodiments, the method further comprises administering chondroitinase ABC. According to other embodiments, the method further comprises administering matrix metalloproteinases (MMPs), disintegrin metalloproteinases with thrombospondin motifs (ADAMTSs) or HA.

[0161] The term "therapeutically effective amount" of EV, when administered to a subject, will have the intended therapeutic effect, e.g., treatment of neuronal damage or impairment such as SCI. The full therapeutic effect is not necessarily achieved by administration of a single dose, but may only be achieved after administration of a series of doses. Therefore, the therapeutically effective amount may be administered in one or more doses. The exact effective amount required for the subject will depend, for example, on the size, health and age of the subject, the nature and extent of the cognitive impairment, the therapeutic agent or combination of therapeutic agents selected for administration, and the mode of administration. A skilled person can readily determine the effective amount in a given situation by routine experimentation.

[0162] In another aspect, the present invention provides a method for inhibiting or reducing the expression level of the NCAN gene in a cell in vivo or in vitro, the method comprising introducing the siRNA or shRNA molecule, EV or pharmaceutical composition according to any one of the above embodiments and aspects into the cell, so that the expression level of the NCAN gene is inhibited or reduced by at least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%, at least 60%, at least 50%, at least 40%, at least 30%, at least 20%, at least 10% or at least 5%. According to some embodiments, the siRNA or shRNA that inhibits the expression of the NCAN molecule comprises a guide chain containing a nucleic acid sequence selected from SEQ ID NO: 1-5, 11-15 and 86-95 or consisting of the nucleic acid sequence. According to another embodiment, the siRNA or shRNA comprises a complementary chain containing a nucleic acid sequence selected from SEQ ID NO: 6-10, 16-20 and 96-105, wherein the complementary chain comprises a nucleic acid complementary to the nucleic acid at the corresponding position in the sequence of the guide chain at the 1st and 19th positions. According to some embodiments, the siRNA or shRNA that inhibits NCAN expression comprises an oligonucleotide pair, which comprises or consists of the following nucleic acid sequences: (i) SEQ ID NOs: 1 and 6; (ii) SEQ ID NOs: 2 and 7; (iii) SEQ ID NOs: 3 and 8; or (iv) SEQ ID NOs: 4 and 9; (v) SEQ ID NOs: 5 and 10, wherein the N nucleotide in the guide strand is complementary to the N at the corresponding position in the complementary strand. According to some embodiments, the siRNA or shRNA that inhibits NCAN expression comprises an oligonucleotide pair comprising or consisting of the following nucleic acid sequences: (i) SEQ ID NOs: 11 and 16; (ii) SEQ ID NOs: 12 and 17; (iii) SEQ ID NOs: 13 and 18; or (iv) SEQ ID NOs: 14 and 9; (v) SEQ ID NOs: 15 and 20; (vi) SEQ ID NOs: 86 and 96; (vii) SEQ ID NOs: 87 and 77; (viii) SEQ ID NOs: 88 and 88; (ix) SEQ ID NOs: 89 and 99; (x) SEQ ID NOs: 90 and 100; (xi) SEQ ID NOs: 91 and 101; (xii) SEQ ID NOs: 92 and 102; (xiii) SEQ ID NOs: 93 and 103; (xiv) SEQ ID NOs: 94 and 104; or (xv) SEQ ID NOs: 95 and 105.According to some embodiments, the siRNA or shRNA that inhibits NCAN expression comprises an oligonucleotide pair comprising or consisting of the nucleic acid sequences SEQ ID NOs: 11 and 16. According to some embodiments, the siRNA or shRNA that inhibits NCAN expression comprises an oligonucleotide pair comprising or consisting of the nucleic acid sequences SEQ ID NOs: 12 and 17. According to some embodiments, the siRNA or shRNA that inhibits NCAN expression comprises an oligonucleotide pair comprising or consisting of the nucleic acid sequences SEQ ID NOs: 13 and 18. According to some embodiments, the siRNA or shRNA is coupled to cholesterol. According to some embodiments, the siRNA or shRNA is coupled to glucose.

[0163] In another aspect, the present invention provides a method for inhibiting or reducing the expression level of a TNR gene in a cell in vivo or in vitro, the method comprising introducing the siRNA or shRNA molecule, EV or pharmaceutical composition according to any one of the above embodiments and aspects into the cell, so that the expression level of the TNR gene is inhibited or reduced by at least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%, at least 60%, at least 50%, at least 40%, at least 30%, at least 20%, at least 10% or at least 5%. According to some embodiments, the siRNA or shRNA that inhibits the expression of the TNR molecule comprises a guide chain containing a nucleic acid sequence selected from SEQ ID NO: 30-43 and 58-71 or consisting of the nucleic acid sequence. According to another embodiment, the siRNA or shRNA that inhibits the expression of TNR comprises a complementary chain containing a nucleic acid sequence selected from SEQ ID NO: 44-57 and 72-85, wherein the complementary chain comprises a nucleic acid complementary to the nucleic acid at the corresponding position in the sequence of the guide chain at the 1st and 19th positions. According to some embodiments, the siRNA or shRNA that inhibits TNR expression comprises an oligonucleotide pair comprising or consisting of the following nucleic acid sequences: (i) SEQ ID NOs: 30 and 44; (ii) SEQ ID NOs: 31 and 45; (iii) SEQ ID NOs: 32 and 46 (iv) SEQ ID NOs: 33 and 47; (v) SEQ ID NOs: 34 and 48; (vi) SEQ ID NOs: 45 and 49; (vii) SEQ ID NOs: 56 and 50; (viii) SEQ ID NOs: 37 and 51; (ix) SEQ ID NOs: 38 and 52; (x) SEQ ID NOs: 39 and 53; (xi) SEQ ID NOs: 40 and 54; (xii) SEQ ID NOs: 41 and 55; (xiii) SEQ ID NOs: 42 and 56; or (xiv) SEQ ID NOs: 43 and 57, wherein the N nucleotide in the guide strand is complementary to the N at the corresponding position in the complementary strand.According to some embodiments, the siRNA or shRNA that inhibits TNR expression comprises an oligonucleotide pair comprising or consisting of the following nucleic acid sequences: (i) SEQ ID NOs: 58 and 72; (ii) SEQ ID NOs: 59 and 73; (iii) SEQ ID NOs: 60 and 74; (iv) SEQ ID NOs: 61 and 75; (v) SEQ ID NOs: 62 and 76; (v) SEQ ID NOs: 63 and 77; (vii) SEQ ID NOs: 64 and 78; (viii) SEQ ID NOs: 65 and 79; (ix) SEQ ID NOs: 66 and 80; (x) SEQ ID NOs: 67 and 81; (xi) SEQ ID NOs: 68 and 82; (xii) SEQ ID NOs: 69 and 83; (xiii) SEQ ID NOs: 70 and 84; or (xiv) SEQ ID NOs: 71 and 85. According to some embodiments, the siRNA or shRNA that inhibits TNR expression comprises an oligonucleotide pair comprising or consisting of the nucleic acid sequences SEQ ID NOs: 58 and 72. According to some embodiments, the siRNA or shRNA that inhibits TNR expression comprises an oligonucleotide pair comprising or consisting of the nucleic acid sequences SEQ ID NOs: 61 and 75. According to some embodiments, the siRNA or shRNA that inhibits TNR expression comprises an oligonucleotide pair comprising or consisting of the nucleic acid sequences SEQ ID NOs: 62 and 76. According to some embodiments, the siRNA or shRNA is coupled to cholesterol. According to some embodiments, the siRNA or shRNA is coupled to glucose.

[0164] Table 1. Sequences of the present invention

[0165]

[0166]

[0167]

[0168]

[0169]

[0170]

[0171] N can be any nucleotide, wherein the N at position 1 of the guide strand is complementary to the N at position 19 of the corresponding sense strand, and the N at position 19 of the guide strand is complementary to the N at position 1 of the corresponding sense strand, the positions being counted from the 5' of the sequence. In the sequence listing file, T represents U in the RNA molecule sequence.

[0172] References without a specific number mean one or more. The term "and / or" is used to indicate that one or both of the stated situations may occur, for example, A and / or B includes (A and B) and (A or B).

[0173] The term "or" as used herein indicates that alternatives can be combined where appropriate; that is, the term "or" includes each listed alternative individually as well as combinations thereof if the combinations are not mutually exclusive.

[0174] The terms "comprising", "including", "having" and "containing" are used interchangeably herein and have the meaning of "consisting at least in part of...". When interpreting each statement in this specification that includes the term "comprising", features other than the one or more features beginning with the term may also be present. Related terms such as "comprising" should be interpreted in the same manner. The terms "having" and "comprising" may also encompass the meanings of "consisting of..." and "consisting essentially of..." and may be replaced by these terms. The term "consisting of..." does not include any components, steps or procedures that are not specifically described or listed. The term "consisting essentially of..." means that the composition or component may include additional ingredients, but only if the additional ingredients do not substantially change the basic and novel characteristics of the claimed composition or method.

[0175] As used herein, the term "about" when referring to a measurable value such as an amount, duration, etc., is meant to encompass variations of + / - 10%, + / - 5%, + / - 1% or even + / - 0.1% from the specified value.

[0176] Having now generally described the invention, the invention will be more readily understood by reference to the following examples, which are provided for purposes of illustration and are not intended to limit the invention.

[0177] Example

[0178] Example 1. Design of siRNA for inhibiting neurocan expression

[0179] An extensive bioinformatics analysis was performed to find the best sequences that can be used to design siRNAs to inhibit the expression of neuroligin (NCAN, mRNA sequence in SEQ ID NO: 21). The sense and antisense (guide) sequences of the resulting siRNAs are presented in Table 2. In some cases, the sequence complementary to the guide (antisense) polynucleotide contains 14 to 19 nucleotides. siRNAs directed to three specific regions on the NCAN gene sequence provided the most significant effects. The regions are nucleotide numbers 1000-1300, 3700-4000, 500-800 and 1-150.

[0180] Table 2. Sequences used to prepare NCAN siRNA

[0181]

[0182]

[0183] S—sense; A—antisense; start / end point refers to the position on the gene having the nucleic acid sequence SEQ ID NO: 21.

[0184] These sequences were selected based on best homology across multiple species including human, mouse, rat, and rhesus (monkey) and best probability of suppression after accounting for mismatches.

[0185] Example 2. Design of siRNA to inhibit tenascin-R expression

[0186] An extended bioinformatics analysis was performed to find the best sequences that can be used to design siRNAs to inhibit the expression of tenascin-R (TNR, mRNA sequence in SEQ ID NO: 22). The sense and antisense (guide) sequences of the resulting siRNAs are presented in Table 3. In some cases, the sequence complementary to the guide (antisense) polynucleotide contains 14 to 19 nucleotides. siRNAs directed to two specific regions on the TNR gene sequence provided the most significant effects. The regions are nucleotide numbers 1600-2000 and 4300-4700.

[0187] Table 3. Sequences used to prepare TNR siRNA

[0188]

[0189]

[0190]

[0191] S—sense; A—antisense; start / end point refers to the position on the gene having the nucleic acid sequence SEQ ID NO:22.

[0192] These sequences were selected based on the best homology across multiple species including human, mouse, rat, and rhesus (monkey) and the best probability of suppression after considering mismatches.

[0193] Example 3

[0194] Exosome purification protocol

[0195] Human MSCs were purchased from Lonza (Basel, Switzerland). The cells were cultured and expanded. The cells were cultured with exosome-free platelet lysate (Rabin Medical Center, Israel), and the culture medium was collected after 3 days. Exosomes were purified using a standard differential centrifugation protocol, which included separating the culture medium and centrifuging it at 300g for 10 min. The supernatant was recovered, centrifuged at 2000g for 30 min, and then re-centrifuged at 10000g for 30 min. The supernatant was then passed through a 0.22 μm filter and centrifuged at 100000g for 70 min. The pellet containing exosomes and proteins was washed in PBS and then centrifuged at 100000g for 70 min. The pellet was resuspended in 200 μl sterile PBS. All centrifugations were performed at 4°C. Exosomes were characterized using NanoSight technology, electron microscopy, and Western blotting, with calnexin as a negative marker and CD9 and CD81 as positive markers.

[0196] Loading NCAN or TNR siRNA into MSC-exo

[0197] siRNA, such as those obtained in Examples 1 and 2, was conjugated to cholesterol-TEG at the 3' position of the sense (guide) strand. Cholesterol was used as a loading agent / enhancer for siRNA entry into exosomes. The loading protocol was performed by mixing cholesterol-teg-siRNA molecules (1 ul of 100 μM) with 40 μl of 10 6 -10 8 The exosomes were co-incubated at 37°C for 2-4 hours.

[0198] After incubation, free cholesterol-teg-siRNA is washed away, for example by 30 kDa Amicon and / or 100G ultracentrifugation for 2-4 hours. The pellet containing the loaded exosomes is used for in vivo and in vitro experiments.

[0199] To quantify the amount of siRNA in the loaded exosomes, a fluorescent marker (eg, cy3) was coupled to the 5' of the sense strand and the fluorescent signal was compared to a calibration curve.

[0200] Specifically, EVs were loaded with the following anti-NCAN siRNAs: sirna_3816G (comprising oligonucleotides with the sequences UACAGUGGCAUGGACAUUCUA and GAAUGUCCAUGCCACUGUA), sirna_1172GA (comprising oligonucleotides with the sequences UGAGCUCGGAAGCAGUAGCCG and GCUACUGCUUCCGAGCUCA), and sirna_632GA (comprising oligonucleotides with the sequences UGGGCCUCAGCGAAGGUCCGU and GGACCUUCGCUGAGGCCCA); and the following anti-TNR siRNA: sirna_1715 (comprising oligonucleotides with the sequences CUAAUGACAGCGUAGACGCUG and GCGUCUACGCUGUCAUUAG), sirna_4436 (comprising oligonucleotides with the sequences UUGGUCCGGUGGCAGUUCUUA and AGAACUGCCACCGGACCAA) and sirna_1809 (comprising oligonucleotides with the sequences CACGGUGGUCUCUGUGAUCGU and GAUCACAGAGACCACCGUG).

[0201] Another analytical method to determine loading efficacy is HPLC, which allows detection of siRNA in exosomes by molecular characteristics and provides an analytical measure of quantity.

[0202] Example 4

[0203] Several sequences with the best SVM scores were tested for their efficacy and their ability to reduce TNR gene expression on SK-N-SH cells (neuroblastoma cell line). The results were obtained 24 hours after transfection of the cells with Lipofectamine reagent and 20 nM siRNA molecules against TNR. From these results, we selected the most effective duplexes for further studies. The anti-TNR siRNAs tested are presented in Table 4. As described in the table, some siRNAs were coupled with cholesterol (chol), cy3 or FAM. In all siRNAs, the guide oligonucleotide contained 21 nt and the sense oligonucleotide contained 19 nt, except for TNR6 which contained 20 and 15 nt respectively. This first screening revealed the most effective molecules.

[0204] Table 4. Anti-TNR siRNA (duplex) used in the experiment

[0205]

[0206]

[0207] TNR6*-shorter siRNA

[0208] Different anti-TNR siRNA (20nM) were used to express Lipofectamine TM The effect of 3000 reagent transfected SK-N-SH cells on TNR expression is shown in Figure 1 Relative expression was assessed by qRT-PCR using TaqMan probes. The expression of the GAPDH gene was used as an internal control.

[0209] From the results, TNR2 (sirna_1715, sequence CUAAUGACAGCGUAGACGCUG and GCGUCUACGCUGUCAUUAG) and TNR7 (sirna_1809, sequence CACGGUGGUCUCUGUGAUCGU and GAUCACAGAGACCACCGUG) showed the best results. These siRNAs target two different sites on the TnR gene. TNR2 is cholesterol-coupled and TNR7 is uncoupled.

[0210] To find the best conditions for the analysis, we investigated sirna_1715 and sirna_1809 siRNAs conjugated or unconjugated with cholesterol, sirna_1715-TNR1 and TNR2 (with cholesterol), and sirna_1809-TNR7 and TNR8 (with cholesterol). Different time points and different siRNA concentrations were tested to find the most effective siRNA duplex and the best transfection conditions.

[0211] The results of the 24-hour transfection are presented in Figure 2 The relative expression was assessed by qRT-PCR using TaqMan probes. The expression of the GAPDH gene was used as an internal control. From these results, it can be seen that TNR1 and TNR2 (sirna_1715) provided the best results, with a 40-50% reduction in the expression of TNR. The results were statistically significant. These siRNAs were further studied to determine their ability to reduce TnR expression in cells when loaded into EVs.

[0212] Protein expression of TNR after transfection and after addition of siTNR-loaded EVs was assessed using western blotting (of lysates and culture media) or ELISA using antibodies specific for TNR.

[0213] Example 5

[0214] Several sequences with the best SVM scores were tested for their efficacy and ability to reduce NCAN gene expression on SK-N-SH cells. We first evaluated the efficacy of the NCAN siRNA novel duplexes in reducing NCAN RNA levels as follows: TM SK-N-SH cells were transfected with si-NCAN duplexes (20 nM) using 3000 reagent for 24 hours. Relative expression was assessed by qRT-PCR using TaqMan probes. The expression of the GAPDH gene was used as an internal control. The most effective duplexes were then selected for further study. The anti-NCAN siRNAs tested are presented in Table 5. As described in the table, some siRNA sequences were coupled to cholesterol (chol), cy3 or FAM.

[0215] Table 5. Anti-NCAN siRNA (duplex) used in the experiment

[0216] Duplex# Sequences from reports 3' end 5' end NCAN1 NCAN_3816 (SEQ ID NOs: 11 and 16) - - NCAN2 NCAN_3816 Cholesterol - NCAN3 NCAN_3816 - cy3 NCAN4 NCAN_3816 Cholesterol cy3 NCAN5 NCAN_1172 (SEQ ID NOs: 12 and 17) - - NCAN6 NCAN_1172 Cholesterol - NCAN7 NCAN_632 (SEQ ID NOs: 13 and 18) - - NCAN8 NCAN_632 Cholesterol -

[0217] The results are presented in Figure 3 In the figure NCAN1 siRNA is represented as duplex 1, NCAN2 as duplex 2, etc. It can be seen that siRNA sirna_1172 (sequences UGAGCUCGGAAGCAGUAGCCG and GCUACUGCUUCCGAGCUCA) without or with cholesterol (NCAN5 and NCAN6, respectively) provided the best results.

[0218] To find the optimal conditions for the analysis, we examined another time point and different siRNA concentrations (10 nM). We found that at 48 h post-transfection, RNA expression levels decreased more than 24 h post-transfection, and there was no significant difference in the relative expression of NCAN after transfection with 10 nM compared to 20 nM ( Figure 4 ). Relative expression was assessed by qRT-PCR using TaqMan probes. The expression of the GAPDH gene was used as an internal control.

[0219] In addition, the efficacy of NCAN5 and NCAN6 was compared with the efficacy of commercially available anti-NCAN siRNA purchased from IDT (Integrated DNA Technologies) called IDT1, IDT2 and IDT3. TMSK-N-SH cells were transfected with 20 nM anti-NCAN siRNA duplexes (NurExone or IDT) using 3000 reagent and reverse transfection. 48 hr after transfection, relative expression was assessed by qRT-PCR using TaqMan probes. The expression of the GAPDH gene was used as an internal control. Figure 5 It can be seen that the efficacy of NCAN5 and NCAN6 is higher than that of the commercial siRNA.

[0220] Example 6

[0221] Since NCAN is a secreted chondroitin sulfate proteoglycan, the effects of different anti-NCAN siRNA duplexes on the secretion of NCAN protein in the culture medium were evaluated. TM SK-N-SH cells were transfected with si-NCAN duplex (20 nM) using 3000 reagent. 48 hr after transfection, RNA was isolated and culture medium was collected. Protein levels were assessed using NCAN ELISA kit. Relative expression was assessed by qRT-PCR using TaqMan probe. Results are presented in Fig. 6A and 6B As can be seen, gene expression was reduced by more than 50% by NCAN5 and NCAN6, while protein expression was reduced by about 80% by NCAN5 and about 60% by NCAN6.

[0222] Example 7

[0223] ReN cell VM (Catalog No. SCC008, Millipore) was cultured at 5×10 4 cells / cm 2 The inoculation density was cultured, and the culture medium was regularly replaced every 48 hours. ReN cell proliferation medium consists of ReNcell NSC maintenance medium (catalog number SCM005, Sigma), supplemented with 20ng / ml hEGF (catalog number GF001, Merck) and hbFGF (catalog number GFP03, Merck). After the cells reached a monolayer about 4 days after inoculation, the proliferation medium was replaced with a differentiation medium, which consisted of a maintenance medium without supplements. The cells were continuously monitored. The culture medium was replaced every 48 hours. After 2 weeks, according to the manufacturer's instructions, the cells were completely differentiated into adult neurons, accompanied by the formation of PNNs (neuronal perineuronal networks).

[0224] To confirm successful differentiation into neural cells, PNNs were stained with Wisteria flos flavonoids agglutinin (WFA) (Catalog No. FL-1351-2, Vector laboratories) according to the manufacturer's instructions, and neurons were labeled with NeuN (1:500) (Ab177487, Abcam).

[0225] In addition, the enrichment level of neural markers was assessed by NeuN-Taqman assay (Cat. No. AB431182, Rhenium) using RT-qPCR. The assessment of enrichment was calculated compared to undifferentiated ReN cells based on relative quantitative calculations (ΔΔCT).

[0226] After this, the cells were treated with previously optimized EV (2×10 8 Particles / cm 2 ) for 48 hours. The treatment will include initial EVs, EVs loaded with anti-NCAN-siRNA, or EVs loaded with anti-TNR-siRNA. The anti-NCAN-siRNAs used were sirna_3816G (SEQ ID NOs: 11 and 16), sirna_1172GA (SEQ ID NOs: 12 and 17), and sirna_632GA (SEQ ID NOs: 13 and 18). The anti-TNR-siRNAs used were sirna_1715 (SEQ ID NOs: 58 and 72), sirna_4436 (SEQ ID NOs: 51 and 75), and sirna_1809 (SEQ ID NOs: 62 and 76). Subsequently, RNA was isolated using the QIAGEN RNeasy Mini kit (Catalog No. 74104), and RT-qPCR was used to assess the levels of NCAN and TNR RNA. In addition, fluorescent staining was performed using the WFA antibody according to the manufacturer's instructions to observe any reduction in PNN formation. It should be noted that the protocol can be further optimized.

[0227] In addition, a similar assay was performed on differentiated REN cells after scratch injury of the cells, and the sprouting and proliferation of neuronal cells were observed and quantified by confocal microscopy to determine the effects of the treatment on neural regeneration.

[0228] Example 8.

[0229] PNN structural integrity can be measured by histological staining of the spinal cord and brain by labeling one or more of their structural proteins, such as in Christensen et al., Nat Commun. 2021; 12(1): 1-17. doi: 10.1038 / s41467-020-20241-w or et al., J Neurosci. 2017; 37(5): 1269-1283. doi: 10.1523 / JNEUROSCI.2504-16.2016. For this procedure, rats or mice were treated with 20 μl of either original or loaded with exosomes (10 7-10 8 The treatment is carried out by intranasal administration of siRNA of the selected target (exosomes / μl). In some examples, the mice or rats are treated with exosomes loaded with siRNA that inhibits the production of NCAN. The exosomes are, for example, the exosomes described in Example 3. Specifically, exosomes containing siRNA as described in Tables 1 and 2 are used. After the treatment, the animals are killed, the brain / spinal cord is fixed with 5% paraformaldehyde (PFA), and the related structural proteins of PNN are labeled with the first and second antibodies. The PNN structures from treated and untreated animals are comparatively analyzed to measure the inhibitory effect of the siRNA on PNN formation / integrity / decomposition.

[0230] Another efficacy experiment was performed in vivo to test the efficacy of the above treatment after complete spinal cord transection and / or impaction. Motor function was examined. The efficacy of the treatment was measured by motor improvement and sensory recovery using a scale called the BBB score.

[0231] Example 9. In vivo efficacy of anti-NCAN and anti-TNR siRNA

[0232] Rats underwent complete spinal cord transection at T10 and were divided into four treatment groups:

[0233] 1. Exosomes loaded with anti-NCAN siRNA sirna_3816G (sequences UACAGUGGCAUGGACAUUCUA and GAAUGUCCAUGCCACUGUA);

[0234] 2. Exosomes loaded with anti-NCAN siRNA sirna_1172GA (sequences UGAGCUCGGAAGCAGUAGCCG and GCUACUGCUUCCGAGCUCA);

[0235] 3. Exosomes loaded with anti-NCAN siRNA sirna_632GA (sequences UGGGCCUCAGCGAAGGUCCGU and GGACCUUCGCUGAGGCCCA);

[0236] 4. Exosomes loaded with anti-TNR siRNA sirna_1715 sequences CUAAUGACAGCGUAGACGCUG and GCGUCUACGCUGUCAUUAG);

[0237] 5. Exosomes loaded with anti-TNR siRNA sirna_4436 (sequences UUGGUCCGGUGGCAGUUCUUA and AGAACUGCCACCGGACCAA);

[0238] 6. Exosomes loaded with anti-TNR siRNA sirna_1809 (comprising oligonucleotides with the sequences CACGGUGGUCUCUGUGAUCGU and GAUCACAGAGACCACCGUG).

[0239] 7.siRNA sirna_3816G

[0240] 8.siRNA sirna_1172GA

[0241] 9.siRNA sirna_632GA

[0242] 10.siRNA sirna_1715

[0243] 11.siRNA sirna_4436

[0244] 12. Exosomes only (n=4)

[0245] 13. Saline (n=6)

[0246] Rats received 5 days of treatment starting on the day of surgery, followed by 2 days of rest and then another 5 days of treatment.

[0247] Starting 1 week after surgery, the rats exercised on a treadmill 5 days per week and underwent a weekly Dorsal Von Frey test, were weighed, and walking was recorded for BBB scoring. At week 10, the spinal cords of the rats were scanned by MRI.

[0248] Two weeks after surgery, reflex recovery was tested by tail and paw pinching.

[0249] The health of the rats was assessed by their tendency to self-feed in the rats that received treatment after injury. Rats that underwent SCI surgery tended to self-feed.

[0250] Sagittal MRI images, axial sections, and cross-sectional area images at 4 mm caudal and rostral to the T10 center in healthy rats or to the injured center in untreated and treated rats were analyzed, and the ratio of the caudal to rostral area, representing the regeneration of tissue downstream of the injury, was calculated.

[0251] Example 10. Loading NCAN or TNR siRNA into MSC-exo

[0252] siRNA, such as those obtained in Examples 1 and 2, was coupled to glucose or sucrose at the 3' position of the sense (guide) strand. Glucose or sucrose was used as a loading agent / enhancer for siRNA entry into exosomes. The loading protocol was performed by mixing glucose-siRNA molecules (1 ul of 100 μM) with 40 μl of 10 6-10 8 The exosomes were incubated at 37°C for 2-4 hours.

[0253] After incubation, free glucose-siRNA or sucrose-siRNA is washed away, for example, by 30 kDa Amicon and / or 100G ultracentrifugation for 2-4 hours. The pellet containing the loaded exosomes is used for in vivo and in vitro experiments.

[0254] To quantify the amount of siRNA in the loaded exosomes, a fluorescent marker (eg, cy3) was coupled to the 5' of the sense strand and the fluorescent signal was compared to a calibration curve.

[0255] Specifically, EVs were loaded with the following anti-NCAN siRNAs conjugated to glucose: sirna_3816G (comprising oligonucleotides with the sequences UACAGUGGCAUGGACAUUCUA and GAAUGUCCAUGCCACUGUA), sirna_1172GA (comprising oligonucleotides with the sequences UGAGCUCGGAAGCAGUAGCCG and GCUACUGCUUCCGAGCUCA), and sirna_632GA (comprising oligonucleotides with the sequences UGGGCCUCAGCGAAGGUCCGU and GGACCUUCGCUGAGGCCCA); and The following anti-TNR siRNAs: sirna_1715 (comprising an oligonucleotide having the sequence CUAAUGACAGCGUAGACGCUG and GCGUCUACGCUGUCAUUAG), sirna_4436 (comprising an oligonucleotide having the sequence UUGGUCCGGUGGCAGUUCUUA and AGAACUGCCACCGGACCAA), and sirna_1809 (comprising an oligonucleotide having the sequence CACGGUGGUCUCUGUGAUCGU and GAUCACAGAGACCACCGUG).

[0256] Although the present invention has been described above by way of preferred embodiments thereof, modifications may be made thereto without departing from the spirit and essence of the invention as defined in the appended claims.

Claims

1. An RNA interference (RNAi) oligonucleotide selected from siRNA and shRNA, comprising a guide strand containing a nucleic acid sequence selected from SEQ ID NO: 1-5 and 30-43, for inhibiting the expression of a protein of a perineuronal network.

2. The RNAi oligonucleotide according to claim 1, wherein the protein of the perineuronal network is selected from neurocan (NCAN) and tenascin-R (TNR).

3. The RNAi oligonucleotide according to claim 2, wherein the RNAi oligonucleotide inhibits the expression of neurocan protein, and the guide strand comprises a nucleic acid sequence selected from SEQ ID NO: 1-5.

4. The RNAi oligonucleotide according to claim 3, wherein the RNAi oligonucleotide inhibits the expression of neurocan protein, and the guide strand comprises a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 11-15 and 86-95.

5. The RNAi oligonucleotide according to claim 3 or 4, wherein the RNAi is siRNA, and wherein the guide strand consists of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 1-5, 11-15 and 86-95.

6. The RNAi oligonucleotide according to any one of claims 3 to 5, comprising a strand complementary to the guide strand, wherein the complementary strand is complementary to at least 14, 15, 16, 17, 18, 19, 20 or 21 consecutive nucleotides of the guide strand.

7. The RNAi oligonucleotide according to claim 6, wherein the complementary strand comprises a nucleic acid sequence selected from SEQ ID NOs: 6-10, and wherein the complementary strand comprises nucleic acids at positions 1 and 19 that are complementary to nucleic acids at corresponding positions in the sequence of the guide strand.

8. The RNAi oligonucleotide according to claim 7, wherein the complementary strand comprises a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 16-20 and 96-105.

9. The RNAi oligonucleotide according to claim 3, wherein the RNAi oligonucleotide is a siRNA comprising a guide strand and a complementary strand, wherein the guide strand comprises a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 11-15 and 86-95, and the complementary strand comprises a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 16-20 and 96-105.

10. The RNAi oligonucleotide of claim 3, wherein the RNAi is a siRNA comprising a guide strand and a complementary strand pair, wherein the pair comprises or consists of nucleic acid sequences SEQ ID NOs: 11 and 16, SEQ ID NOs: 12 and 17, or SEQ ID NOs: 13 and 18.

11. The RNAi oligonucleotide of claim 3, wherein the RNAi oligonucleotide is a siRNA comprising a guide strand and a complementary strand pair, wherein the pair comprises or consists of the nucleic acid sequences of SEQ ID NOs: 86 and 96, SEQ ID NOs: 87 and 77, SEQ ID NOs: 88 and 88, SEQ ID NOs: 89 and 99, SEQ ID NOs: 90 and 100, SEQ ID NOs: 91 and 101, SEQ ID NOs: 92 and 102, SEQ ID NOs: 93 and 103, SEQ ID NOs: 94 and 104, or SEQ ID NOs: 95 and 105.

12. The RNAi oligonucleotide of claim 2, wherein the RNAi oligonucleotide inhibits expression of tenascin-R (TNR), and the guide strand comprises a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 30-43.

13. The RNAi oligonucleotide of claim 12, wherein the RNAi oligonucleotide inhibits expression of tenascin-R (TNR), and the guide strand comprises a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 58-71.

14. The RNAi oligonucleotide according to claim 12 or 13, wherein the RNAi is a siRNA, and wherein the guide strand consists of a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 30-43 and 58-71.

15. The RNAi oligonucleotide of any one of claims 12 to 14, comprising a strand complementary to the guide strand, wherein the complementary strand is complementary to at least 14, 15, 16, 17, 18, 19, 20 or 21 consecutive nucleotides of the guide strand.

16. The RNAi oligonucleotide of claim 15, wherein the complementary strand comprises a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 44-57, and wherein the complementary strand comprises nucleic acids at positions 1 and 19 that are complementary to nucleic acids at corresponding positions in the sequence of the guide strand.

17. The RNAi oligonucleotide of claim 16, wherein the complementary strand comprises a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 72-85.

18. The RNAi oligonucleotide according to claim 12, wherein the RNAi is a siRNA comprising a guide strand and a complementary strand, wherein the guide strand comprises a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 44-57, and the complementary strand comprises a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 72-85.

19. The RNAi oligonucleotide of claim 12, wherein the RNAi oligonucleotide is a siRNA comprising a guide strand and a complementary strand pair, wherein the pair comprises or consists of the nucleic acid sequences SEQ ID NOs: 58 and 72, SEQ ID NOs: 61 and 75, or SEQ ID NOs: 62 and 76.

20. The RNAi oligonucleotide according to any one of claims 1 to 19, which is coupled to a hydrophobic molecule.

21. The RNAi oligonucleotide of claim 20, wherein the hydrophobic moiety is selected from the group consisting of sterols, gangliosides, lipids, vitamins, fatty acids, hydrophobic peptides, and combinations thereof.

22. The RNAi oligonucleotide of claim 21, wherein the hydrophobic moiety is cholesterol.

23. The RNAi oligonucleotide according to any one of claims 1 to 19, which is conjugated to a carbohydrate.

24. The RNAi oligonucleotide of claim 23, wherein the carbohydrate is selected from glucose and sucrose.

25. An isolated extracellular vesicle (EV) comprising an RNA interference (RNAi) oligonucleotide selected from siRNA and shRNA that inhibits the expression of a protein of the perineuronal network.

26. The isolated EV according to claim 25, wherein the protein is selected from neurocan (NCAN), tenascin-R, aggrecan (ACAN), versican (VCAN), brevican (BCAN) and any combination thereof.

27. The isolated EV according to claim 25 or 26, wherein the EV is selected from exosomes, microvesicles and combinations thereof.

28. The isolated EV of claim 27, wherein the extracellular vesicles are exosomes.

29. The isolated EV according to any one of claims 25 to 28, wherein the extracellular vesicles are derived from adherent cells expressing mesenchymal markers.

30. The isolated EV according to claim 29, wherein the adherent cells expressing mesenchymal markers are selected from mesenchymal stem cells (MSC) and olfactory ensheathing cells.

31. The isolated EV according to any one of claims 26 to 30, wherein the RNAi oligonucleotide inhibits the expression of NCAN.

32. An isolated EV according to claim 31, wherein the RNAi oligonucleotide is the RNAi oligonucleotide according to any one of claims 3 to 11.

33. The isolated EV of claim 32, wherein the RNAi oligonucleotide is a siRNA comprising a guide strand and a complementary strand pair, wherein the pair comprises, or consists of, nucleic acid sequences of SEQ ID NOs: 11 and 16, SEQ ID NOs: 12 and 17, SEQ ID NOs: 13 and 18, SEQ ID NOs: 86 and 96, SEQ ID NOs: 87 and 77, SEQ ID NOs: 88 and 88, SEQ ID NOs: 89 and 99, SEQ ID NOs: 90 and 100, SEQ ID NOs: 91 and 101, SEQ ID NOs: 92 and 102, SEQ ID NOs: 93 and 103, SEQID NOs: 94 and 104, or SEQ ID NOs: 95 and 105.

34. The isolated EV of claim 33, wherein the isolated EV is an exosome.

35. The isolated EV of claim 34, wherein the isolated EV is isolated from mesenchymal stem cells.

36. An isolated EV according to any one of claims 26 to 30, wherein the RNAi oligonucleotide inhibits the expression of tenascin-R.

37. An isolated EV according to claim 36, wherein the RNAi oligonucleotide is the RNAi according to any one of claims 12 to 19.

38. An isolated EV according to claim 37, wherein the RNAi oligonucleotide is a siRNA comprising a guide strand and a complementary strand pair, wherein the pair comprises or consists of the nucleic acid sequences SEQ ID NOs: 58 and 72, SEQ ID NOs: 61 and 75, or SEQ ID NOs: 62 and 76.

39. The isolated EV of claim 38, wherein the isolated EV is an exosome.

40. The isolated EV of claim 39, wherein the isolated EV is isolated from mesenchymal stem cells.

41. An isolated EV according to any one of claims 26 to 40, wherein the EV comprises RNAi oligonucleotides that inhibit the expression of NCAN and Tenascin-R.

42. An isolated EV according to claim 41, wherein the RNAi oligonucleotide that inhibits NCAN expression is the RNAi oligonucleotide according to any one of claims 3 to 11, and the RNAi oligonucleotide that inhibits tenascin-R expression is the RNAi oligonucleotide according to any one of claims 12 to 19.

43. The isolated EV according to any one of claims 25 to 40, further comprising a compound selected from chondroitinase ABC, matrix metalloproteinases (MMPs), disintegrin metalloproteinases with thrombospondin motifs (ADAMTSs), nucleic acid molecules encoding them, and hyaluronic acid (HA).

44. A pharmaceutical composition comprising the RNAi oligonucleotide according to any one of claims 1 to 24 or the isolated EV according to any one of claims 25 to 43, and a pharmaceutically acceptable excipient.

45. The pharmaceutical composition of claim 44, formulated for administration via an administration route selected from the group consisting of intranasal, intralesional, intrathecal, intravenous, intramuscular, subcutaneous, sublingual, oral, and intracerebral administration routes.

46. ​​The pharmaceutical composition of claim 45, formulated for intranasal administration.

47. The pharmaceutical composition according to any one of claims 44 to 46, further comprising a compound selected from chondroitinase ABC, HA, matrix metalloproteinases (MMPs), disintegrins and metalloproteinases with thrombospondin motifs (ADAMTS).

48. A pharmaceutical composition according to any one of claims 44 to 47 for use in nerve regeneration following nerve injury, or for treating neuronal injury or damage in a subject, or for inducing nerve regeneration.

49. A pharmaceutical composition for use according to claim 48, wherein the neuronal injury or damage is spinal cord injury (SCI).

50. The pharmaceutical composition of claim 48 or 49, wherein the use comprises intranasal administration of the composition.

51. A method for inducing neural regeneration or treating neuronal injury or damage in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of isolated extracellular vesicles, the vesicles comprising RNAi oligonucleotides that inhibit the expression of a protein selected from neurocan (NCAN), tenascin-R, aggrecan (ACAN), versican (VCAN), brevican (BCAN) and combinations thereof.

52. The method of claim 51, wherein the RNAi oligonucleotide that inhibits NCAN expression is the RNAi according to any one of claims 3 to 11, and the RNAi oligonucleotide that inhibits tenascin-R expression is the RNAi oligonucleotide according to any one of claims 12 to 19.

53. The method of claim 51 or 52, wherein the administration is intranasal or injection.

54. The method of any one of claims 51 to 53, further comprising administering a compound selected from chondroitinase ABC, matrix metalloproteinases (MMPs), disintegrin metalloproteinases with thrombospondin motifs (ADAMTSs), nucleic acid molecules encoding the same, and hyaluronic acid (HA).

Images