Double emulsion based on protein microgel-polysaccharide covalent complex as well as preparation method and application of double emulsion

Abstract

The invention discloses a double emulsion based on a protein microgel-polysaccharide covalent complex as well as a preparation method and application of the double emulsion. The double emulsion comprises an inner water phase, an oil phase and an outer water phase; wherein the inner water phase comprises NaCl, a hydrophilic functional factor tea polyphenol and water; the oil phase comprises polyglycerol ricinoleate, a hydrophobic functional factor curcumin and medium chain triglyceride; the outer water phase comprises a protein microgel-polysaccharide covalent complex and water. The double emulsion provided by the invention has good environmental stability, obviously enhances the photo-thermal stability and bioavailability of tea polyphenol and curcumin, and can be used for improving neuroinflammation and brain cognitive memory impairment.

Description

Technical Field

[0001] The invention belongs to the technical field of functional nutritional food preparation and processing, and specifically relates to a double emulsion based on a protein microgel-polysaccharide covalent complex and a preparation method and application thereof. Background Art

[0002] Developing "nutrition-fortified foods" by adding one or more nutritional functional factors to meet the nutritional and health needs of different groups of people is of great significance for promoting the development of my country's nutrition and health industry. Curcumin and tea polyphenols are two plant polyphenols with a wide range of natural sources, and they play an outstanding role in preventing and improving neuroinflammation. However, hydrophobic curcumin and hydrophilic tea polyphenols are sensitive to environmental factors such as light, heat, oxygen, and pH. They are extremely unstable during processing, storage, and digestion, and have low oral bioavailability, which seriously limits their application in the food industry.

[0003] Encapsulation and protection of functional factors with the help of food-grade delivery systems with good biocompatibility is an effective strategy to improve their stability and bioavailability. However, traditional delivery systems (such as nanoparticles, micelles or emulsions) are difficult to achieve co-encapsulation of functional factors with different hydrophilicity. In recent years, studies have found that water-in-oil-in-water (W / O / W) double emulsions can solve the above problems, but due to the complexity of their structure, the stability of double emulsions is usually poor, making it difficult to achieve long-term protection of the encapsulated functional factors. Summary of the invention

[0004] The main purpose of the present invention is to provide a double emulsion based on protein microgel-polysaccharide covalent complex and its preparation method and application, so as to overcome the shortcomings of the prior art.

[0005] In order to achieve the above-mentioned invention object, the technical solution adopted by the present invention includes:

[0006] The embodiment of the present invention provides a double emulsion based on a protein microgel-polysaccharide covalent complex, which includes an inner water phase, an oil phase and an outer water phase; wherein the inner water phase includes NaCl, hydrophilic functional factors tea polyphenols (epigallocatechin gallate EGCG, epicatechin gallate ECG, etc.) and water; the oil phase includes polyglycerol ricinoleate (PGPR), hydrophobic functional factors curcumin and medium-chain triglycerides; the outer water phase includes a protein microgel-polysaccharide covalent complex and water.

[0007] The present invention also provides a method for preparing the aforementioned double emulsion based on protein microgel-polysaccharide covalent complex, which comprises:

[0008] Providing an inner aqueous phase comprising NaCl, a hydrophilic functional factor tea polyphenols and water, an oil phase comprising PGPR, a hydrophobic functional factor curcumin and medium-chain triglycerides, and an outer aqueous phase comprising a protein microgel-polysaccharide covalent complex and water;

[0009] The inner water phase is mixed with the oil phase and subjected to a first shearing homogenization treatment to obtain a W / O emulsion;

[0010] And, the W / O emulsion is mixed with an external water phase and subjected to a second shear homogenization treatment to obtain a W / O / W double emulsion, that is, a double emulsion based on a protein microgel-polysaccharide covalent complex.

[0011] The embodiments of the present invention also provide the use of the aforementioned double emulsion based on protein microgel-polysaccharide covalent complex in the preparation of products for preventing and / or improving cognitive memory disorders or neuroinflammation.

[0012] Compared with the prior art, the present invention has the following beneficial effects:

[0013] (1) Compared with commercial single proteins, the present invention uses protein microgel-polysaccharide covalent complex as an oil-water interface emulsifier to significantly enhance the stability of the emulsion. The emulsifier raw materials are not only cheap and easy to obtain, but also have good biosafety and biodegradability. The preparation method is green and safe with good reproducibility.

[0014] (2) Compared with free curcumin or tea polyphenols, the curcumin / tea polyphenols double emulsion provided by the present invention not only solves the problem of curcumin being insoluble in water, but also effectively improves the photothermal stability and bioavailability of curcumin and tea polyphenols, and effectively alleviates lipopolysaccharide (LPS)-induced cognitive dysfunction and neuroinflammation. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments recorded in the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0016] Figure 1a-1b The thickness of the interfacial layer, the interfacial protein adsorption rate (%) and the protein surface load (mg / m2) of the untreated pea protein isolate (PPI), pea protein isolate microgel (referred to as "microgel"), pea protein isolate microgel-sodium alginate physical mixture (referred to as "mixture") and pea protein isolate microgel-sodium alginate covalent complex (referred to as "covalent complex") stabilized at the oil-water interface in the present invention. 2) Figure, the different uppercase and lowercase letters at the top of the column in the figure represent significant differences between the samples (p < 0.05);

[0017] Figure 2 It is an optical microscopic image of the O / W emulsions (PPI-emulsion, microgel-emulsion, mixture-emulsion, covalent complex-emulsion) stabilized by pea protein isolate, pea protein isolate microgel, pea protein isolate microgel-sodium alginate physical mixture and pea protein isolate microgel-sodium alginate covalent complex in the present invention under the stimulation of different environmental factors (light, heat, freeze-thaw);

[0018] Figure 3a-Figure 3b The curcumin and tea polyphenol EGCG in the W / O / W double emulsion of the present invention are 2 , 120min, Figure 3a ) and heating (90°C, 120 min, Figure 3b ) treatment;

[0019] Figure 4 : is the bioaccessibility graph of curcumin and EGCG in the W / O / W double emulsion of the present invention, and the different uppercase and lowercase letters at the top of the column in the graph represent significant differences between the samples (p < 0.05);

[0020] Figure 5a-5d The effect of the curcumin / EGCG double emulsion on the cognitive memory of LPS-inflamed mice, including the autonomous activity ability of mice in the open field test ( Figure 5a ), the total number of arm entries in the Y-maze test ( Figure 5b ) and the percentage of spontaneous alternation ( Figure 5c ), the recognition index in the novel object recognition test ( Figure 5d ), different letters at the top of the bars in the figure represent significant differences between the samples (p<0.05);

[0021] Figure 6a-6f The curcumin / EGCG double emulsion of the present invention has an effect on the inflammatory factors ( Figure 6a :IL-1β; Figure 6b :IL-6; Figure 6c :TNF-α; Figure 6d :IL-10) and inflammatory proteins ( Figure 6e :iNOS; Figure 6f :The effect diagram of COX-2 mRNA expression level, different letters at the top of the column in the figure represent significant differences between samples (p<0.05);

[0022] Figure 7 It is a schematic diagram of the preparation process of a double emulsion based on a protein microgel-polysaccharide covalent complex in a typical embodiment of the present invention. DETAILED DESCRIPTION

[0023] In view of the defects of the prior art, the inventors of this case have proposed the technical solution of the present invention after long-term research and extensive practice. The technical solution mainly utilizes the W / O / W double emulsion stabilized by protein microgel-polysaccharide covalent complex to co-encapsulate curcumin and tea polyphenols to improve their stability, oral bioavailability and biological activity.

[0024] The technical solution of the present invention will be described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0025] Specifically, as one aspect of the technical solution of the present invention, a double emulsion based on a protein microgel-polysaccharide covalent complex comprises an inner water phase, an oil phase and an outer water phase; wherein the inner water phase comprises NaCl, hydrophilic functional factors tea polyphenols (EGCG, ECG, etc.) and water; the oil phase comprises PGPR, hydrophobic functional factors curcumin and medium-chain triglycerides; and the outer water phase comprises a protein microgel-polysaccharide covalent complex and water.

[0026] In some preferred embodiments, the content of NaCl in the internal aqueous phase is 0.5-2 wt %.

[0027] Furthermore, the content of NaCl in the inner water phase is 1 wt %.

[0028] In some preferred embodiments, the concentration of the hydrophilic functional factor tea polyphenols in the inner water phase is 1.0-2.0 mg / mL.

[0029] Furthermore, the concentration of the hydrophilic functional factor tea polyphenols in the inner water phase is 1.4 mg / mL.

[0030] In some preferred embodiments, the volume fraction of PGPR in the oil phase is 2N8%.

[0031] Furthermore, the volume fraction of PGPR in the oil phase is 5%.

[0032] In some preferred embodiments, the concentration of the hydrophobic functional factor curcumin in the oil phase is 0.6 mg / mL.

[0033] In some preferred embodiments, the content of the protein microgel-polysaccharide covalent complex in the external aqueous phase is 1-4 wt %.

[0034] Furthermore, the content of the protein microgel-polysaccharide covalent complex in the external water phase is 2 wt %.

[0035] In some preferred embodiments, the protein microgel-polysaccharide covalent complex comprises a pea protein isolate microgel-sodium alginate covalent complex.

[0036] In some preferred embodiments, the method for preparing the pea protein isolate microgel-sodium alginate covalent complex comprises:

[0037] Step (1): dispersing pea protein isolate in distilled water, heating in a water bath at 85° C. for 30 min, adding transglutaminase (TGase, 20 U / g protein), heating in a water bath at 45° C. for 4 h, and cooling to prepare pea protein isolate gel; placing the pea protein isolate gel in a certain volume of distilled water (pH=7), shearing and crushing at 10000 rpm for 2 min, and homogenizing at 50 MPa for 3 cycles to prepare pea protein isolate microgel.

[0038] Step (2): Mix equal volumes of pea protein isolate microgel dispersion (4wt%) and sodium alginate dispersion (0.2wt%), adjust the pH to 10, perform 195W ultrasonic pretreatment for 20 min, heat in a 95°C water bath for 6 h, cool to room temperature, terminate the reaction, and prepare a pea protein isolate microgel-sodium alginate covalent complex.

[0039] Another aspect of the embodiments of the present invention further provides a method for preparing the aforementioned double emulsion based on protein microgel-polysaccharide covalent complex, which comprises:

[0040] Providing an inner aqueous phase comprising NaCl, a hydrophilic functional factor tea polyphenols and water, an oil phase comprising PGPR, a hydrophobic functional factor curcumin and medium-chain triglycerides, and an outer aqueous phase comprising a protein microgel-polysaccharide covalent complex and water;

[0041] The inner water phase is mixed with the oil phase and subjected to a first shearing homogenization treatment to obtain a W / O emulsion;

[0042] And, the W / O emulsion is mixed with an external water phase and subjected to a second shear homogenization treatment to obtain a W / O / W double emulsion, that is, a double emulsion based on a protein microgel-polysaccharide covalent complex.

[0043] In some preferred embodiments, the preparation method further comprises:

[0044] The protein is dispersed in water and subjected to a heating treatment, and then TG enzyme is added and subjected to a heating and cooling treatment to obtain a protein gel, and then the protein gel is subjected to a shearing and crushing treatment and a homogenization treatment to obtain a protein microgel;

[0045] And, the protein microgel is mixed with polysaccharide and subjected to Maillard reaction to prepare a protein microgel-polysaccharide covalent complex.

[0046] Furthermore, the protein includes any one or more combinations of pea protein isolate, soy protein, and whey protein, but is not limited thereto.

[0047] Furthermore, the polysaccharide includes any one or more combinations of sodium alginate, sodium hyaluronate, and pectin, but is not limited thereto.

[0048] In some preferred embodiments, the volume ratio of the inner water phase to the oil phase is 2:8 to 4:6.

[0049] Furthermore, the volume ratio of the inner water phase to the oil phase is 3:7.

[0050] In some preferred embodiments, the volume ratio of the W / O emulsion to the external water phase is 2:8 to 5:5.

[0051] Furthermore, the volume ratio of the W / O emulsion to the external water phase is 5:5.

[0052] In some preferred embodiments, the preparation method specifically comprises: performing a first shear homogenization treatment at 10,000 to 15,000 rpm for 3 to 5 minutes.

[0053] In some preferred embodiments, the preparation method specifically comprises: performing a second shear homogenization treatment for 3N5min under the conditions of 7000N10000rpm.

[0054] In some more specific embodiments, the preparation method of the double emulsion based on protein microgel-polysaccharide covalent complex comprises the following steps: mixing the inner aqueous phase (containing 1wt% NaCl, 1.4mg / mL EGCG) and the oil phase (containing 5% v / v PGPR, 0.6mg / mL curcumin) in a volume ratio of 3:7, shearing at 10000rpm for 3min to obtain a W / O emulsion; then the W / O emulsion and the outer aqueous phase (containing 2wt% pea protein isolate microgel-sodium alginate covalent complex, with 2wt% pea protein isolate, pea protein isolate microgel, and pea protein isolate microgel-sodium alginate physical mixture as the control group) in a volume ratio of 5:5, shearing at 7000rpm for 3min to prepare a curcumin / EGCG double emulsion.

[0055] Furthermore, the preparation method of the pea protein isolate microgel comprises the following steps: dispersing 10wt% of pea protein isolate in distilled water, heating in a water bath at 85°C for 30min, adding TG enzyme (20U / g protein), heating in a water bath at 45°C for 4h, cooling, and obtaining pea protein isolate gel; placing the pea protein isolate gel in a certain volume of distilled water (pH=7), shearing and crushing at 10000rpm for 2min, and homogenizing at 50MPa for 3 cycles to obtain pea protein isolate microgel.

[0056] Furthermore, the preparation method of the pea protein isolate microgel-sodium alginate physical mixture comprises the following steps: mixing equal volumes of 4wt% pea protein isolate microgel dispersion and 0.2wt% sodium alginate dispersion, adjusting the pH to 7, and obtaining a pea protein isolate microgel-sodium alginate physical mixture dispersion with a concentration of 2wt%.

[0057] Furthermore, the preparation method of the pea protein isolate microgel-sodium alginate covalent complex comprises the following steps: mixing equal volumes of a 4wt% pea protein isolate microgel dispersion and a 0.2wt% sodium alginate dispersion, adjusting the pH to 10, ultrasonic pretreatment at 195W for 20min, heating in a 95°C water bath for 6h, cooling at room temperature, terminating the reaction, and obtaining a pea protein isolate microgel-sodium alginate covalent complex dispersion with a concentration of 2wt%.

[0058] In some preferred embodiments, the preparation process diagram of the double emulsion based on the protein microgel-polysaccharide covalent complex of the present invention is as follows Figure 7 shown.

[0059] Another aspect of the embodiments of the present invention further provides the use of a double emulsion based on a protein microgel-polysaccharide covalent complex in preparing a product for preventing and / or improving cognitive memory disorders or neuroinflammation.

[0060] For example, the double emulsion is used as a functional factor / drug carrier in the preparation of a product for preventing and / or improving cognitive memory disorders or neuroinflammation.

[0061] The technical solution of the present invention is further described in detail below in conjunction with several preferred embodiments and drawings. This embodiment is implemented on the premise of the technical solution of the invention, and a detailed implementation method and specific operation process are given, but the protection scope of the present invention is not limited to the following embodiments.

[0062] Unless otherwise specified, the experimental materials used in the following examples can be purchased from conventional biochemical reagent companies.

[0063] Example 1

[0064] Different oil-water interface emulsifiers were prepared according to the following method, specifically including:

[0065] The method for preparing the pea protein isolate dispersion is as follows: commercially available pea protein isolate powder is dispersed in a certain volume of distilled water, and stirred evenly to prepare a pea protein isolate dispersion with a mass fraction of 2%.

[0066] Preparation method of pea protein isolate microgel: Disperse commercially available pea protein isolate powder in a certain volume of distilled water, stir evenly to obtain a pea protein isolate dispersion with a mass fraction of 10%, then heat in a water bath at 85°C for 30 minutes, add TG enzyme (20U / g protein) after cooling, heat in a water bath at 45°C for 4 hours, and obtain pea protein isolate gel after cooling. Place the pea protein isolate gel in a certain volume of distilled water (pH=7), shear crush (10000rpm, 2min) and high-pressure homogenization (50MPa, 3 cycles) to prepare a pea protein isolate microgel dispersion with a mass fraction of 2%.

[0067] Preparation method of pea protein isolate microgel-sodium alginate physical mixture: prepare a pea protein isolate microgel dispersion with a mass fraction of 4% according to the above method, then mix it with a sodium alginate dispersion with a mass fraction of 0.2% in equal volumes, adjust the pH to 7, and prepare a pea protein isolate microgel-sodium alginate physical mixture dispersion with a protein concentration of 2wt%.

[0068] Preparation method of pea protein isolate microgel-sodium alginate covalent complex: prepare a pea protein isolate microgel dispersion with a mass fraction of 4% according to the above method, then mix it with an equal volume of a sodium alginate dispersion with a mass fraction of 0.2%, adjust the pH to 10, perform 195W ultrasonic pretreatment for 20 minutes, heat in a 95°C water bath for 6 hours, and cool to room temperature to terminate the reaction to prepare a pea protein isolate microgel-sodium alginate covalent complex dispersion with a protein concentration of 2wt%.

[0069] The interfacial layer thickness, interfacial protein adsorption rate and protein surface loading of the above different emulsifiers at the oil-water interface are shown in Figure 1a-1b .Depend on Figure 1a-1b It can be seen that compared with untreated pea protein isolate, pea protein isolate microgel, and pea protein isolate microgel-sodium alginate physical mixture, the pea protein isolate microgel-sodium alginate covalent complex has the thickest interfacial layer (40.68±4.63nm) formed at the oil-water interface and the highest interfacial protein adsorption rate (46.92±1.17%).

[0070] Example 2

[0071] O / W emulsions with different interface compositions and structures were prepared according to the following method, and the stability of the emulsions under the stimulation of different environmental factors (heat, light, freeze-thaw) was investigated.

[0072] The preparation method of O / W emulsions with different interface compositions and structures is as follows: a dispersion of 2% by mass of pea protein isolate, pea protein isolate microgel, pea protein isolate microgel-sodium alginate physical mixture and pea protein isolate microgel-sodium alginate covalent complex is used as the aqueous phase, and they are mixed with medium-chain triglycerides in a volume ratio of 8:2, and sheared at 10000rpm for 3min to prepare different O / W emulsions.

[0073] Thermal stability test: The freshly prepared emulsion was heated in a 90°C water bath for 3 h, and its optical microscopic image was taken.

[0074] Light stability test: The freshly prepared emulsion was placed in a xenon lamp aging box at 0.35 W / cm 2 The samples were irradiated under a light intensity of 300 nm for 3 h and the optical microscopic images were taken.

[0075] Freeze-thaw stability test: The freshly prepared emulsion was placed in a -80°C refrigerator for 24 h, and an optical microscopic image was taken after the sample was thawed at room temperature.

[0076] After different emulsions are heated, exposed to light or freeze-thawed, their microstructure changes are as follows: Figure 2 As shown. Figure 2 It can be seen that compared with the emulsion stabilized by untreated pea protein isolate, the emulsion stabilized by pea protein isolate microgel and pea protein isolate microgel-sodium alginate system showed better environmental stability.

[0077] Example 3

[0078] The pea protein isolate microgel-sodium alginate covalent complex with excellent interfacial properties was selected as the external aqueous phase emulsifier, and the W / O / W double emulsion of co-encapsulated curcumin and EGCG was prepared according to the following method.

[0079] The hydrophilic EGCG was dissolved in a 1wt% NaCl aqueous solution to prepare an inner aqueous phase with an EGCG concentration of 1.4 mg / mL; the lipophilic curcumin was dispersed in a medium-chain triglyceride containing 5% v / v PGPR to prepare an oil phase with a curcumin concentration of 0.6 mg / mL; a 2wt% pea protein isolate microgel-sodium alginate covalent complex dispersion was used as the outer aqueous phase; the inner aqueous phase and the oil phase were mixed in a volume ratio of 3:7, and sheared at 10000rpm for 3min to obtain a W / O primary emulsion, and then the W / O primary emulsion was mixed with the outer aqueous phase in a volume ratio of 5:5, and sheared at 7000rpm for 3min to prepare a W / O / W double emulsion co-encapsulating curcumin and EGCG.

[0080] The free curcumin and EGCG dispersed in distilled water were used as the control group, and the encapsulated curcumin and EGCG were exposed to light (0.35 W / m 2 The retention rates under the conditions of 0.1% (0.1% ... Figure 3a-Figure 3b As shown. Figure 3a-Figure 3b It can be seen that compared with free curcumin and EGCG, the photothermal stability of encapsulated curcumin and EGCG was significantly improved, and the double emulsion stabilized by pea protein isolate microgel-sodium alginate covalent complex showed more prominent protective effects on curcumin and EGCG.

[0081] Example 4

[0082] The bioaccessibility of curcumin and EGCG in the double emulsion was evaluated by an in vitro digestion model simulating digestion at different stages (oral, gastric, and intestinal) as described below.

[0083] Before the experiment, 1.25× simulated salivary fluid (SSF), simulated gastric fluid (SGF) and simulated intestinal fluid (SIF) were prepared according to the INFOGEST method.

[0084] Simulated oral digestion: 10 mL of the emulsion was mixed with 8 mL of 1.25×SSF, 50 μL of 0.3 M CaCl2·(H2O)2 solution was added, the pH of the mixture was adjusted to 7 with 2 M HCl and 2 M NaOH, and the final volume was supplemented to 20 mL with distilled water, and the sample was then incubated in a water bath with a magnetic stirrer at 37 °C for 2 min.

[0085] Simulated gastric digestion: Mix 15 mL of the above oral digestion fluid with 12 mL of 1.25×SGF, add 7.5 μL of 0.3 M CaCl2·(H2O)2 solution and 1 mL of pepsin solution (final concentration of 2000 U / mL), adjust the pH to 3 with 2 M HCl, and make up the final volume to 30 mL with distilled water, then incubate the sample in a water bath with a magnetic stirrer at 37 °C for 2 h.

[0086] Simulated intestinal digestion: Mix the above 20 mL of gastric digestion fluid with 8 mL of 1.25× SIF, add 40 μL of 0.3 M CaCl2·(H2O)2 solution, 4 mL of bile salt solution, 2.5 mL of lipase solution and 2.5 mL of trypsin solution. Before the experiment, the bile salts and digestive enzymes were pre-dissolved in 1.25× SIF. The pH of the mixed system was adjusted to 7 using 2 M HCl and 2 M NaOH, and the final volume was supplemented to 40 mL with distilled water. Then, the sample was incubated in a water bath magnetic stirrer at 37°C for 2 h, during which the pH was continuously maintained at 7 with 1 M NaOH solution. In the final system, the concentration of bile salts was 10 mM, the activity of trypsin was 100 U / mL, and the activity of lipase was 2000 U / mL.

[0087] After the simulated intestinal digestion was completed, the digestion fluid was collected and centrifuged at 4000rpm for 40min. The micellar phase of the middle layer was collected and mixed with an equal volume of anhydrous ethanol, stored at 4°C overnight, and centrifuged at 8000rpm for 20min. The supernatant was collected and filtered using an aqueous membrane with a pore size of 0.45μm, and then the absorbance of curcumin and EGCG in the filtrate was measured at 424.5nm and 276nm, respectively, and the content of functional factors in the micellar phase was determined according to their corresponding standard curves. Finally, the bioaccessibility of curcumin and EGCG was calculated according to the following formula:

[0088] Bioaccessibility (%) = content of functional factors in micellar phase / total content of functional factors × 100

[0089] Bioaccessibility of curcumin and EGCG in different double emulsions Figure 4 Compared with free curcumin and EGCG, the bioaccessibility of encapsulated curcumin and EGCG was significantly enhanced, and in the double emulsion stabilized by pea protein isolate microgel-sodium alginate covalent complex, the bioaccessibility of curcumin and EGCG was as high as 55.88% and 98.98%, which were approximately 14.66 times and 2.59 times that of their free states, respectively.

[0090] Example 5

[0091] Curcumin / EGCG double emulsion stabilized by pea protein isolate microgel-sodium alginate covalent complex was selected for dietary intervention in LPS-inflamed mice, and then the effects of curcumin / EGCG double emulsion on cognitive memory of LPS-inflamed mice were evaluated through behavioral tests (including open field, novel object recognition and Y-maze).

[0092] Animal grouping and treatment: After 7 days of adaptive feeding, 84 8-week-old C57BL / 6J male mice were randomly divided into 6 groups, each with 14 mice, namely the control group, LPS model group, LPS+curcumin group, LPS+EGCG group, LPS+curcumin / EGCG double emulsion group and empty double emulsion group. Free curcumin, free EGCG, curcumin / EGCG double emulsion and empty double emulsion were given by gavage for five consecutive weeks according to the groups, and normal saline was given by gavage to the control group and the model group. On the 29th day of the experiment, except for the control group, the mice in the other groups were intraperitoneally injected with LPS (250μg / kg / d) 30min after gavage for 7 consecutive days. The control group was intraperitoneally injected with an equal volume of normal saline. On the 32nd day of the experiment, behavioral tests were performed. On the 36th day of the experiment, the mice were sacrificed, and their brain tissues were collected and stored in a -80℃ refrigerator for use.

[0093] Open field test: usually used to evaluate the exploratory behavior and anxiety state of mice, as well as their ability to adapt to new environments. Mice were placed in a white movement monitoring box (40cm×40cm×40cm) for 5 minutes, allowed to move freely, and the total movement distance (mm) was recorded by computer video tracking system software. Before each test, all mice had to adapt to the laboratory environment for at least 1 hour, and the monitoring box was cleaned with 75% ethanol each time to reduce interference with the results.

[0094] Y-maze test: widely used to study learning, memory and navigation in rodents. The Y-maze consists of equiangular arms (length: height: width = 35 cm: 15 cm: 5 cm). Before each test, the mouse was placed in an empty box for 5 minutes, and then allowed to explore from the center of the Y-maze for 5 minutes. The movement route and order of entering the arms of the mouse were recorded. The spontaneous alternation percentage (%) was calculated according to the following formula:

[0095] Spontaneous alternation percentage (%) = number of consecutive entries into three different arms / (total number of entries into arms - 2) × 100

[0096] Novel object recognition test: a common method for evaluating short-term non-spatial recognition memory in mice, which includes three stages: adaptation period (day 1), familiarization period (day 2), and test period (day 3). The operating procedures of the adaptation period are basically the same as those of the open field test. During the familiarization period, two objects with the same appearance, color, and texture were placed diagonally in the white motion monitoring box, and then the mice were allowed to explore freely for 10 minutes. During the test period, an old object in the familiarization period was replaced with a new object similar to it, and then the mice were allowed to explore freely from the center of the test box for 5 minutes. The duration of the mouse sniffing the new and old objects was recorded, and the recognition index (%) was calculated according to the following formula:

[0097] Recognition index (%) = duration of exploring new objects / duration of exploring old objects × 100

[0098] Effects of curcumin / EGCG double emulsion on cognitive memory in LPS-inflamed mice Figure 5a-5d As shown. Figure 5a and 5b It can be seen that there is no significant difference in the autonomous activity ability of mice in each group, which indicates that LPS, curcumin or EGCG intervention does not change the autonomous activity ability of mice. The results of the alternation percentage of mice in the Y maze test show that ( Figure 5c ), compared with the control group, the proportion of mice in the LPS group that entered three different arms continuously was significantly reduced, indicating that intraperitoneal injection of LPS significantly reduced the working memory ability of mice; there was no significant difference between the curcumin, EGCG and empty double emulsion groups and the LPS group, but EGCG / curcumin double emulsion could significantly increase this proportion and alleviate the working memory damage caused by LPS. In addition, Figure 5d The results of the novel object recognition test showed that EGCG / curcumin double emulsion could significantly improve the learning and memory ability of LPS-inflamed mice, and its effect was higher than that of free curcumin and EGCG.

[0099] Example 6

[0100] The relative mRNA expression levels of inflammatory factors (IL-1β, IL-6, TNF-α and IL-10) and inflammatory proteins (iNOS and COX-2) in the brain of each group of mice were investigated according to the following method. The specific operation steps include:

[0101] RNA extraction and reverse transcription: Weigh about 70 mg of brain tissue, add it to a grinding tube containing 0.7 mL of Trizol RNA extraction reagent, put in 2 grinding beads, and use an electric homogenizer to fully homogenize for about 1 to 2 minutes. Then, extract RNA according to the steps, use a Quawell 5000UV-Vis spectrophotometer to evaluate the purity of RNA and dilute it to a uniform concentration. According to the instructions of the reverse transcription kit, prepare the reverse transcription system, mix gently, and perform the reverse transcription reaction. After the reaction, store the cDNA in a -80°C refrigerator for use.

[0102] Real-time quantitative PCR: Use SYBR Green PCR Master mix for fluorescence quantification. According to the kit instructions, prepare the PCR reaction solution according to Table 1 and perform two-step PCR amplification according to Table 2.

[0103] Table 1 Real-time quantitative PCR reaction system

[0104] Reagents Volume (μL) Sample (cDNA) 2 Upstream primer (10 μM) 1 Downstream primer (10 μM) 1 Double distilled water 6 Mix 10

[0105] Table 2 Real-time quantitative PCR reaction program design

[0106]

[0107] The target gene primer information of real-time quantitative PCR is shown in Table 3. GAPDH was used as an internal reference and 2- ΔΔCt Methods The relative expression levels of genes were calculated.

[0108] Table 3 Primer sequences (5′-3′) of target genes for real-time quantitative PCR

[0109] Gene Upstream primer Downstream primer IL-1β TGACGGACCCCAAAAGATGA TCTCCACAGCCACAATGAGT IL-6 CTCTGGCGGAGCTATTGAGA AAGTCTCCTGCGTGGAGAAA TNF-α CTCATGCACCACCATCAAGG ACCTGACCACTCTCCCTTTG IL-10 TTAATAAGCTCCAAGACCAAGG CATCATGTATGCTTCTATGCA iNOS GGAGCGAGTTGTGGATTG CCAGGAAGTAGGTGAGGG COX-2 GAAGTCTTTGGTCTGGTGCCT GCTCCTGCTTGAGTATGTCG GAPDH TGGAGAAACCTGCCAAGTATGA TGGAAGAATGGGAGTTGCTGT

[0110] like Figure 6a-6e As shown in the figure, the results of real-time quantitative PCR showed that compared with the control group, intraperitoneal injection of LPS significantly upregulated the expression of proinflammatory factors (IL-1β, IL-6, TNF-α) and inflammatory proteins (iNOS, COX-2) in the brain, while both curcumin and EGCG interventions were able to significantly downregulate the high expression of proinflammatory mediators induced by LPS, and the anti-inflammatory effect of curcumin / EGCG double emulsion was the best. In addition, curcumin / EGCG double emulsion significantly improved the low expression of anti-inflammatory factor IL-10 induced by LPS. In contrast, there was no significant difference between the curcumin, EGCG and LPS groups, indicating that emulsion encapsulation significantly improved the biological activity of curcumin and EGCG in alleviating brain inflammation in mice.

[0111] In addition, the inventors of this case also referred to the aforementioned embodiments and conducted experiments with other raw materials, process operations, and process conditions described in this specification, and obtained relatively ideal results.

[0112] It should be understood that the technical solution of the present invention is not limited to the above-mentioned specific implementation cases. Any technical deformation made according to the technical solution of the present invention without departing from the scope of protection of the purpose of the present invention and the claims shall fall within the protection scope of the present invention.

Claims

1. A double emulsion based on protein microgel-polysaccharide covalent complex, characterized in that: It includes an inner water phase, an oil phase and an outer water phase; wherein the inner water phase includes NaCl, hydrophilic functional factor tea polyphenols and water; the oil phase includes polyglycerol ricinoleate, hydrophobic functional factor curcumin and medium chain triglycerides; the outer water phase includes protein microgel-polysaccharide covalent complex and water.

2. The double emulsion according to claim 1, characterized in that: The content of NaCl in the inner water phase is 0.5-2wt%; And / or, the tea polyphenols include EGCG and / or ECG; And / or, the concentration of the hydrophilic functional factor tea polyphenols in the inner water phase is 1.0-2.0 mg / mL.

3. The double emulsion according to claim 1, characterized in that: The volume fraction of polyglycerol ricinoleate in the oil phase is 2 to 8%; And / or, the concentration of the hydrophobic functional factor curcumin in the oil phase is 0.6 mg / mL.

4. The double emulsion according to claim 1, characterized in that: The content of the protein microgel-polysaccharide covalent complex in the external aqueous phase is 1 to 4 wt %; And / or, the protein microgel-polysaccharide covalent complex comprises a pea protein isolate microgel-sodium alginate covalent complex.

5. The method for preparing a double emulsion based on a protein microgel-polysaccharide covalent complex according to any one of claims 1 to 4, characterized in that: include: Providing an inner aqueous phase comprising NaCl, a hydrophilic functional factor tea polyphenols and water, an oil phase comprising polyglycerol ricinoleate, a hydrophobic functional factor curcumin and medium-chain triglycerides, and an outer aqueous phase comprising a protein microgel-polysaccharide covalent complex and water; The inner water phase is mixed with the oil phase and subjected to a first shearing homogenization treatment to obtain a W / O emulsion; And, the W / O emulsion is mixed with an external water phase and subjected to a second shear homogenization treatment to obtain a W / O / W double emulsion, that is, a double emulsion based on a protein microgel-polysaccharide covalent complex.

6. The preparation method according to claim 5, characterized in that: Also includes: The protein is dispersed in water and heated, and then transglutaminase is added and heated and cooled to obtain a protein gel, and then the protein gel is sheared, crushed, and homogenized to obtain a protein microgel; And, the protein microgel is mixed with polysaccharide and subjected to Maillard reaction to obtain a protein microgel-polysaccharide covalent complex.

7. The preparation method according to claim 6, characterized in that: The protein includes any one or more combinations of pea protein isolate, soy protein, and whey protein; And / or, the polysaccharide includes any one or more combinations of sodium alginate, sodium hyaluronate and pectin.

8. The preparation method according to claim 5, characterized in that: The volume ratio of the inner water phase to the oil phase is 2:8 to 4:6: And / or, the volume ratio of the W / O emulsion to the external water phase is 2:8 to 5:

5.

9. The preparation method according to claim 5, characterized in that: Specifically include: The first shearing homogenization treatment is carried out at 10000-15000 rpm for 3-5 minutes; And / or, a second shearing homogenization treatment is performed at 7000-10000 rpm for 3-5 min.

10. Use of the double emulsion based on protein microgel-polysaccharide covalent complex according to any one of claims 1 to 4 in the preparation of products for preventing and / or improving cognitive memory disorders or neuroinflammation, preferably use of the double emulsion as a functional factor / drug carrier in the preparation of products for preventing and / or improving cognitive memory disorders or neuroinflammation.

Images