Brain-targeted liposome for delivering mRNA (messenger ribonucleic acid) as well as preparation method and application thereof

Abstract

The invention belongs to the technical field of medicines, and particularly relates to a brain-targeted liposome for delivering mRNA (messenger ribonucleic acid) as well as a preparation method and application of the brain-targeted liposome. The liposome ingeniously utilizes the similar structure of PMPC and acetylcholine, can efficiently pass through BBB and target brain and hippocampus, and realizes personalized accurate delivery of mRNA to realize safe and effective prevention and treatment of brain diseases. The preparation method of the liposome comprises the following steps: (1) synthesizing PMPC-CPADN; (2) synthesizing DSPE-PMPC (Distearoyl Pyrrolidone- (3) preparation of lipidosome: mixing SM-102, DSPC, cholesterol, DSPE-PMPC and DMG-PEG (Dimethyl Glycol-Polyethylene Glycol) according to a certain molar ratio to prepare a lipidosome solution; the lipidosome can be used for preparing the lipidosome / mRNA compound, and the lipidosome / mRNA compound can be used for preparing medicines for treating brain diseases. The PMPC modified brain-targeted liposome for delivering mRNA is stable in physicochemical property, effectively protects mRNA from being degraded by nuclease, and can load mRNA and deliver the mRNA to the brain.

Description

Technical Field

[0001] The present invention belongs to the field of medical technology, and in particular relates to a brain-targeted liposome for delivering mRNA, and a preparation method and application thereof. Background Art

[0002] There are many types of brain diseases, covering various pathological conditions from acute to chronic, and their complexity and diversity have brought great difficulties to prevention, diagnosis and treatment. It mainly includes brain tumors, neurodegenerative diseases, brain atrophy, cerebrovascular-related diseases, etc. Among them, the more severe tauopathy accounts for more than 20 neurodegenerative diseases, including Alzheimer's disease (AD), frontotemporal dementia (FTD), corticobasal degeneration (CBD), etc., which are pathologically identified as intracellular neurofibrillary tangles of insoluble tau protein. With the continuous advancement of biotechnology and molecular biology, progress has been made in drug development recently, but the success rate of brain disease treatment is still low due to the lack of understanding of the main barriers of brain tissue, which makes it difficult for molecules to reach the brain.

[0003] mRNA (messenger ribonucleic acid) technology was recognized by the 2023 Nobel Prize for its pioneering application in the development of COVID-19 vaccines. The application of this technology in the treatment of neurodegenerative diseases is an emerging and promising research direction. mRNA can encode specific proteins, thereby achieving precise targeting of disease-related targets. In brain diseases, this helps reduce side effects of traditional drugs and improve treatment effects. This is crucial for the treatment of brain diseases, as these diseases are often associated with the absence or dysfunction of specific proteins. At the same time, mRNA technology allows for the rapid design and synthesis of mRNA for different diseases, which gives it a unique advantage in dealing with emerging diseases or viral variants. The most important carrier for mRNA delivery is lipid nanoparticles. For example, the technology of delivering mRNA to achieve COVID-19 vaccines is an important breakthrough in vaccine development in recent years. This technology takes advantage of the characteristics of mRNA as a carrier of genetic information, and stimulates the immune system to produce an immune response against the virus by delivering mRNA encoding viral antigens into human cells.

[0004] Literature reports (Zhang, Zi-Yang, et al. "TRIM11 protects against tauopathiesand is down-regulated in Alzheimer'sdisease." Science 381.6656 (2023):eadd6696.), TRIM11 protein was found to inhibit the deterioration of Tau protein-related diseases similar to Alzheimer's disease (AD) and improve cognitive and motor abilities. They are an important link between Tau protein and proteasome. In the brains of patients with Alzheimer's disease, TRIM11 protein levels are significantly reduced, and restoring its expression may have potential therapeutic benefits. TRIM11 works by promoting the degradation of mutant and wild-type tau proteins, preventing tau protein misfolding and aggregation, and decomposing already formed tau protein aggregates. Therefore, TRIM11 is a potential target for Tau protein-related diseases.

[0005] Although mRNA shows great potential in the treatment of brain diseases, it still faces many challenges. First, the existence of the blood-brain barrier makes it difficult for systemic administration to be delivered to neurons in the brain. To overcome this obstacle, researchers are developing various new delivery systems, such as viral vectors, lipid nanoparticles, and extracellular vesicles. Secondly, the instability and lack of tumor targeting of mRNA are also important factors restricting its application in the treatment of brain diseases. Therefore, the development of a stable, efficient, and targeted mRNA delivery system is the focus of current research. Summary of the invention

[0006] In order to solve the current limitations of poor blood-brain barrier (BBB) ​​penetration, low encapsulation efficiency and poor stability, we constructed a brain-targeted liposome delivery system (PLNP-mRNA) for delivering mRNA, which promotes BBB penetration through acetylcholine (nAchRs) and nicotinic receptors (chTs), while regulating the high expression of mRNA, thereby accurately delivering mRNA to the brain, achieving safe and effective treatment and prevention of brain diseases.

[0007] The present invention specifically adopts the following technical solutions: The present invention first provides a brain-targeted liposome for delivering mRNA, wherein the liposome is prepared by the following method: Step 1: Synthesis of PMPC-CPADN: Azobisisobutyronitrile was used as an initiator, and 4-cyano-4 (phenylthioformylthio) pentanoic acid and 2-(methacryloyloxy) ethyl-2-(trimethylamino) ethyl phosphate were used to react to obtain PMPC-CPADN; the reaction in this step was carried out in ultra-dry methanol, and vacuum freeze-thaw deoxygenation was performed during the reaction. The reaction temperature was 70 °C, the stirring speed was 600 rpm, and the reaction time was 24 h.

[0008] Step 2: Synthesis of DSPE-PMPC: Activate the carboxylic acid functional group of PMPC-CPADN with N-hydroxysuccinimide and N,Nʹ-dicyclohexylcarbodiimide, and then add 1,2-distearoyl-sn-glycerol-3-phosphatidylethanolamine and triethylamine to react and obtain DSPE-PMPC. The activation in this step is carried out in ultra-dry methanol and reacted at room temperature for 24 h. After activation, 1,2-distearoyl-sn-glycerol-3-phosphatidylethanolamine is dissolved in ultra-dry DMF and then added to the activated reaction solution to continue the reaction. At the same time, triethylamine is added and reacted at 40°C for 24 h.

[0009] Step 3: Preparation of PLNP: Take the mother liquors of raw materials SM-102, DSPC, cholesterol, DMG-PEG, and DSPE-PMPC and mix them to obtain a liposome solution, wherein the molar ratio of SM-102, DSPC, cholesterol, DSPE-PMPC, and DMG-PEG is 50:5:38.5:5~7.5:1.5~3, preferably 50:5:38.5:5:1.5.

[0010] The above-mentioned liposomes can be used to prepare liposome / mRNA (target gene is TRIM11) complexes, and the liposome / mRNA complexes can be used to prepare drugs for treating brain diseases. Specifically, the liposome solution prepared above and the mRNA solution are mixed to finally prepare liposome / mRNA, named PLNP / mRNA. The brain disease is a Tau protein-related brain disease, specifically Alzheimer's disease. When used to treat Alzheimer's disease, the mRNA is HumanTRIM11 mRNA, and its base sequence is shown in SEQ ID NO:1. When preparing liposome / mRNA, the concentration of the liposome solution is 8mM, and the mRNA solution is obtained by dissolving mRNA in a prepared pH=4 citric acid buffer, and its final concentration is 0.054μg / μL. The volume ratio of the liposome solution and the mRNA solution during mixing is 1:3.

[0011] Therefore, the present invention also provides the use of the above-mentioned brain-targeted liposome or PLNP-mRNA for delivering mRNA in the preparation of drugs for treating brain diseases.

[0012] The beneficial effects of the present invention are: The brain-targeted liposome for delivering mRNA of the present invention has stable physicochemical properties, effectively protects mRNA from nuclease degradation, and can be loaded with mRNA for delivery to the brain. The PLNP-mRNA has the following advantages: (1) PMPC-DSPE facilitates the efficient crossing of the blood-brain barrier (BBB) ​​by lipid nanoparticle mRNA vaccines, and has excellent brain targeting and transfection capabilities; (2) PLNP-mRNA is biodegradable, has good biocompatibility, is safe and non-toxic, combines therapeutic and preventive effects, and has strong activity against brain diseases. These advantages provide important reference significance and value for the clinical transformation of mRNA vaccines.

[0013] (3) In a specific embodiment, injection of PLNP-mTRIM11 into mice through the tail vein can upregulate the expression of TRIM11 mRNA, quickly translate it into protein, and avoid off-target effects as much as possible, thereby dissolving pre-existing Tau protein tangles and abnormally phosphorylated Tau proteins, while reducing the occurrence of neuroinflammation, protecting and repairing neurons, thereby improving the learning and cognitive abilities of mice; TRIM11 mRNA promotes the degradation of phosphorylated Tau and the clearance of excess Tau protein aggregates, and is an important connection between Tau protein and proteasome. TRIM11 can also improve neuroinflammation and the invasion of inflammatory factors, protect neurons from damage, and prevent and protect the learning and cognitive abilities of Alzheimer's disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 Schematic diagram of the preparation of PLNP-mRNA.

[0015] Figure 2 For DSPE-PMPC 5k Schematic diagram of the synthesis.

[0016] Figure 3 This is the H-NMR spectrum of PMPC-CPADN.

[0017] Figure 4 For DSPE-PMPC 5K H NMR spectrum.

[0018] Figure 5 Particle size distribution of lipid nanoparticles. (a) Particle size distribution of PLNP-mRNA. (b) Particle size distribution of LNP-mRNA.

[0019] Figure 6 This is the potential of PLNP-mRNA and LNP-mRNA of lipid nanoparticles.

[0020] Figure 7 This is the morphology and structure of PLNP-mRNA.

[0021] Figure 8 The encapsulation of lipid nanoparticles. (a) Agarose gel electrophoresis was used to detect the encapsulation effect of PLNP-mRNA and LNP-mRNA. (b) The encapsulation rate of PLNP-mRNA and LNP-mRNA was monitored at different time periods.

[0022] Fig. 9 (a) and (e) show the PLNP-mRNA internalization in cells. (b) shows the PLNP-mRNA uptake by BV2 cells. (c) and (d) show the PLNP-mRNA uptake by N2A cells.

[0023] Fig.10 The transfection of PLNP-mRNA in cells. (a) and (c) show the transfection of PLNP-mRNA into SH-SY5Y cells. (b) and (d) show the transfection of PLNP-mRNA into N2A cells.

[0024] Fig.11 The expression of PLNP-mTRIM11 in cells. (a) Real-time fluorescence quantitative PCR was used to evaluate the expression of TRIM11 mRNA in SH-SY5Y cells. (b) Western blotting was used to evaluate the expression of TRIM11 and Flag tag proteins in SH-SY5Y cells. (c) Real-time fluorescence quantitative PCR was used to evaluate the expression of TRIM11 mRNA in N2A cells. (d) Western blotting was used to detect the expression of TRIM11 and Flag proteins in N2A cells.

[0025] Fig.12 The co-localization of PLNP-mTRIM11 and Tau. (a) Confocal analysis of the co-localization of TRIM11 mRNA and Tau in SH-SY5Y cells. (b) Confocal analysis of the co-localization of TRIM11 mRNA and Tau in N2A cells.

[0026] Fig.13 This is the principle by which OA (okadaic acid) and PFFs (Tau protein tangled fibers) induce intracellular Tau phosphorylation and Tau protein tangles.

[0027] Fig.14The ability of PLNP-mTRIM11 to degrade abnormal Tau protein. (a) Confocal microscopy results showed that OA induced phosphorylation of Tau protein in SH-SY5Y cells, and TRIM11 was used to analyze its degradation. (b) Confocal microscopy results showed that PFFs induced Tau protein tangles in SH-SY5Y cells, and TRIM11 was used to analyze its degradation. (c) and (d) Western blotting was used to analyze the degradation of phosphorylated Tau (P-ser396) and Tau protein tangles (AT8) by TRIM11. (e) and (f) Real-time fluorescence quantitative PCR was used to analyze the degradation ability of TRIM11 on phosphorylated Tau (P-ser396) and Tau protein tangles (AT8) at the mRNA level.

[0028] Fig.15 Figure 2 shows the accumulation of PLNP-mRNA in the brain of C57 mice. (a) Distribution of PLNP-mRNA in the brain of mice at different time points. (b) Quantification and statistics of the fluorescence intensity of the brain of mice in (a). (c) Imaging of the main organs of mice (heart, liver, spleen, lung, and kidney). (d) Imaging of the brain of mice alone and comparison of the in vivo tumor penetration effect of PLNP-mRNA and free mRNA. (e) Quantification of the percentage distribution of Cy5 mRNA in the brain and main organs of mice.

[0029] Fig.16 The brain targeting and transfection ability of PLNP-mRNA in the hippocampus in vivo. (a) Fluorescence distribution of PLNP-mRNA in the hippocampus. (b) Fluorescence distribution of PLNP-mRNA in different nerve cells. (c) GFP transfection expression of TRIM11 mRNA in the hippocampus. (d) Quantification and statistics of fluorescence intensity in the mouse hippocampus in (a). (e) Quantification and statistics of GFP protein in the mouse hippocampus in (c). (f) Multiple analysis of the percentage of Cy5 fluorescent cells in different nerve cells to the total number of cells. (g) Quantification results of fluorescence of PLNP-mRNA in different nerve cells in (b).

[0030] Fig.17 Behavioral tests of mice after drug administration and 82 days after drug administration. (a, e) The distance of movement in the open field test. (b, f) The number of times the mouse crossed the platform in the water maze test. (c, g) The new object recognition preference index of the mouse in the new object recognition test. (d, h) The score statistics of the mouse in the nesting test.

[0031] Fig.18 H&E staining analysis of major organs of mice.

[0032] Fig.19Behavioral tests after drug administration in the prevention model of mice. (a) The distance of movement of the body in the open field test. (b) The new and old object recognition preference index of mice in the new object recognition test. (c) The number of times the mouse crossed the platform in the water maze test. (d) Score statistics in the mouse nesting test. DETAILED DESCRIPTION

[0033] In order to make the purpose, technical solution and advantages of the present invention clearer, the technical solution in the embodiment of the present invention will be clearly described below in conjunction with the drawings in the embodiment of the present invention. Obviously, the described embodiment is a part of the embodiment of the present invention, not all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0034] Abbreviations in the examples: PMPC: 1-palmitoyl-2-myristoylphosphatidylcholine; DSPC: 1,2-dioctadecanoyl-sn-glycero-3-phosphocholine; SM-102: (1-octylnonyl 8-[(2-hydroxyethyl) [6-O-6-(undecyloxy)hexyl]amino]-octanoate); DSPE: distearoylphosphatidylethanolamine; DMG-PEG: dimyristoylglycerol-polyethylene glycol 2000.

[0035] Preparation and characterization of (1) PMPC 5k Synthesis of -CPADN In N 2 Under the environment, azobisisobutyronitrile (AIBN, 1.69 mg, 0.01 mmol) was used as an initiator, 4-cyano-4 (phenylthiocarboxymethylthio) pentanoic acid (CPADN, 10 mg, 0.036 mmol) and 2-(methacryloyloxy)ethyl-2-(trimethylamino)ethyl phosphate (MPC, 225 mg, 0.762 mmol) were added to ultra-dry methanol for reaction, vacuum freeze-thaw deoxygenation was required, the reaction temperature was set at 70 °C, and the stirring was performed at 600 rpm for 24 h. PMPC-CPADN with a target molecular weight of 5 kDa was synthesized by RAFT polymerization. After 24 h of reaction, the reaction solution was transferred into a dialysis bag with a molecular weight cutoff of 3.5 kDa and dialyzed with anhydrous ethanol for 24 h, and then dialyzed with high-purity water for 24 h to remove MPC monomer, CPADN, AIBN and solvent, etc. After purification by dialysis, the product was freeze-dried to obtain a pink solid powder. Take 10 mg of the product, dissolve it in 600 µL of deuterated heavy water, put it into a NMR tube, and send the sample for NMR hydrogen spectrum detection.

[0036] (2) DSPE-PMPC 5K Preparation: PMPC was activated with N-hydroxysuccinimide (NHS, 0.92 mg, 0.008 mmol) and N,Nʹ-dicyclohexylcarbodiimide (DCC, 1.65 mg, 0.008 mmol) in ultra-dry methanol. 5k -CPADN (20 mg, 0.004 mmol) was reacted at room temperature for 24 h. After 24 h, DSPE-NH 2 (3.6 mg, 0.0048 mmol) was dissolved in 1 mL of ultra-dry DMF, then added to the previous reaction solution to continue the reaction, and 200 µL of triethylamine was added at 40 °C for 24 h. After the reaction, the reaction solution was filtered with a 0.22 µm filter to remove the precipitate, then dialyzed with 75% ethanol for 24 h, and then dialyzed with high-purity water for 24 h. After dialysis, the sample was freeze-dried. After freeze-drying, 10 mg of the sample was dissolved in a deuterated reagent (a mixture of deuterated chloroform and deuterated methanol in a volume ratio of 1:3) for nuclear magnetic hydrogen spectrum detection. DSPE-PMPC 5k The synthetic route is as follows Figure 2 The H NMR spectrum of PMPC-CPADN is shown in Figure 3 As shown, DSPE-PMPC 5K The H NMR spectrum of Figure 4 shown.

[0037] (3) Preparation of PLNPs: Take 15 mg SM-102 (Mr=710.2), 15 mg DSPC (Mr=790.1), 15 mg cholesterol (Mr=386.7), and 15 mg DMG-PEG (Mr=2509.2) and dissolve them in 1 mL of anhydrous ethanol respectively. Take 15 mg DSPE-PMPC (Mr=5000) and dissolve it in 1 mL of dichloromethane / methanol (volume ratio of 1:2) to prepare the raw material mother solution. Then, according to the molar ratio of SM-102, DSPC, cholesterol, DMG-PEG, and DSPE-PMPC of 50:5:38.5:1.5:5, the raw material mother solution was mixed to obtain 8 mM liposome solution. Anhydrous ethanol was used for constant volume. Among them, the amounts of each raw material in each 1 ml of liposome solution are SM-102 (355.09*8μg), DSPC (39.507*8μg), cholesterol (148.86*8μg), DMG-PEG (37.64*8μg), and DSPE-PMPC (250*8μg).

[0038] (4) Preparation of mRNA solution: Preparation of citric acid buffer: Use ultrapure water to prepare 100mM citric acid monohydrate (molecular weight: 210.14, weigh 1.05g) and sodium citrate dihydrate (molecular weight: 294.10, weigh 1.47g) solutions, 50mL each. Take 33.0ml citric acid solution and 17.0ml sodium citrate solution, add DEPC after mixing, let stand for 30 minutes, then sterilize by high pressure to remove DEPC, and after sterilization, use DEPC to make up to 100mL to obtain 50mM pH=4 citric acid buffer.

[0039] Dissolve mRNA (TRIM11 mRNA (HumanmTRIM11, Mouse mTRIM11) or GFP mRNA (mGFP)) in a prepared pH=4 citrate buffer to a final concentration of 0.054 μg / μL. The base sequences of Human mTRIM11, MousemTRIM11, and GFP mRNA are shown in SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, respectively.

[0040] (5) Preparation of PLNP-mRNA: The liposome solution and the mRNA solution were mixed at a volume ratio of 1:3. After the sample was collected, one volume of citric acid buffer / acetic acid buffer was added for dilution, and then the sample was ultrafiltered at 3000 g using a Milipore 100 KD ultrafiltration tube to 1 / 4 of the original volume, PBS buffer was added to the original volume, and ultrafiltered again to 1 / 4 of the original volume (repeat the steps twice) to reduce the ethanol content to below 0.5%. Finally, the buffer containing sucrose protective solution was used for ultrafiltration and concentration to synthesize PLNP-mRNA.

[0041] Commercial liposome Moderna lipid nanoparticles (LNP-mRNA) were used as controls in subsequent experiments.

[0042] We measured the particle size distribution and average particle size by DLS and observed the morphology of PLNP-mRNA (GFPmRNA) by transmission electron microscopy. Figure 5 As shown in the figure, the PMPC-targeted modified liposome nanoparticles PLNP-mRNA have a particle size of 81 nm as measured by dynamic light scattering particle size analyzer (DLS). Figure 6 As shown in Figure 2, the potential zeta is between -2 mV and -4 mV, which is comparable to that of LNP-mRNA. Figure 7 As shown, TEM images also revealed a unique bilayer vesicle structure.

[0043] Gel electrophoresis experiment of liposome mRNA PLNP-mRNA and LNP-mRNA were electrophoresed in 2% agarose gel in TAE solution [40 mM tris-HCl, 1% acetic acid v / v) and 1 mM EDTA at 110 V for 15 min. Nucleic acid gel electrophoresis experiments can detect whether lipid nanoparticles can successfully encapsulate mRNA and protect it from degradation.

[0044] like Figure 8 As shown in a, the new liposome PLNP-mRNA (GFP mRNA) modified by PMPC can not only well protect mRNA from degradation, but also Figure 8 b Compared with LNP-mRNA, the mRNA encapsulation efficiency is higher.

[0045] Brain targeting capabilities within cells We selected human neuroblastoma cells SH-SY5Y, mouse neuroblastoma cells N2A, and mouse microglial cells BV2, which are highly correlated with Alzheimer's disease, to test the brain targeting ability of PLNP-mRNA in cells. All mRNAs used were Cy5-labeled GFP mRNAs.

[0046] (1) In the flow cytometer test, N2A and SH-SY5Y cells were seeded in 12-well cell culture plates (1×10 5 cells / well), and after culturing at 37 °C for 12 hours, free Cy5 mRNA, PLNP-mRNA, and LNP-mRNA (2 μg / mL) were added and incubated for 4 hours, the samples were aspirated, and the cells were digested with 200 μL of trypsin. The obtained cell suspension was centrifuged at 1000 g for 3 min, washed twice with PBS, and dispersed in 500 μL PBS again. Flow cytometry (BD FACS Calibur, BectonDickinson, USA) was performed within 1 hour, and 10,000 cells were circled using Cell Quest software.

[0047] (2) N2A and SH-SY5Y cells were seeded in 12-well cell culture plates (1×10 5 cells / well), cultured at 37 °C for 12 hours, free Cy5 mRNA, PLNP-mRNA, and LNP-mRNA (2 μg / mL) were added and incubated for 4 hours, and then washed three times with PBST. The cell nucleus was stained with DAPI for 15 minutes and then washed twice. Fluorescence images were obtained by CLSM (TCS SP5).

[0048] (3) In order to detect the internalization of PLNP-mRNA in normal microglia, we seeded BV2 cells in 12-well cell culture plates (1×105 cells / well), and after culturing at 37 °C for 12 hours, free Cy5 mRNA, PLNP-mRNA, and LNP-mRNA were added and incubated for 4 hours. The samples were aspirated and the cells were digested with 200 μL of trypsin. The obtained cell suspension was centrifuged at 1000 g for 3 minutes, washed twice with PBS, and dispersed in 500 μL PBS again. The flow cytometer (BD FACS Calibur, Becton Dickinson, USA) was used for 1 hour, and 10,000 cells were circled using Cell Quest software.

[0049] like Fig. 9 As shown in Figure 2, both flow cytometry and confocal microscopy results indicated that PLNP-mRNA had superior targeting ability. Surprisingly, the same effect was observed on normal mouse microglia BV2 cells.

[0050] Transfection ability in cells The mRNA used in this 1.4 is GFP mRNA.

[0051] SH-SY5Y and N2A cells were plated in 12-well plates at a rate of 1×10 5 The cells were cultured at a density of 10 cells / well until the cells grew to a density of about 80%. Then PLNP-mRNA, LNP-mRNA and free GFP mRNA (2 μg / mL) were added and cultured for another 24 hours, after which the cells were collected and suspended in 200 μL of PBS. Flow cytometry (BD FACS Calibur, Becton Dickinson, USA) was performed within 1 hour, and 10,000 cells were obtained using Cell Quest software.

[0052] The transfection effect was also investigated by confocal microscopy. Similarly, the cell culture medium was removed after 24 h of incubation with different samples, and the cells on microscope slides were washed, fixed with 4% paraformaldehyde, and stained with DAPI, respectively. Fluorescence images were acquired using confocal microscopy.

[0053] like Fig.10 As shown, the results of flow cytometry and confocal microscopy showed that the transfection ability of PMPC-modified brain-targeted lipid nanoparticles was not inferior to that of LNP-mRNA, reaching about 90% and was superior to LNP-mRNA.

[0054] Overexpression in cells SH-SY5Y and N2A cells were plated in 12-well plates at a rate of 1×10 5The cells were cultured at a density of 10 cells / well until the cells grew to a density of about 80%. Then, in order to exclude false positives, the following groups were set up and PLNP-mGFP, PLNP-mTRIM11, LNP-mTRIM11 and free TRIM11 mRNA (2 μg / mL) were added and cultured for 24 hours, and then the cells were collected and lysed to obtain total protein. The expression of Flag and TRIM11 was evaluated by Western blotting. The mTRIM11 involved in SH-SY5Y is HumanTRIM11, and the mTRIM11 involved in N2A cells is Mouse TRIM11.

[0055] Alternatively, total RNA was extracted using the RNAprep Pure Cell / Tissue Kit after cell collection and reverse transcribed into cDNA using the PrimeScript RT Kit (Takara, Kyoto, Japan). TRIM11 mRNA expression was evaluated by real-time quantitative PCR. The primers used for real-time quantitative PCR were as follows: Mouse TRIM11 mRNA: F: CCGGAATTCGATTACAAGGATGACGACGATAAGCTGTCCACCAACCTCCAGG; R: CTAGTCTAGAGAGTCACTGGGGAGCCAG.

[0056] Human TRIM11 mRNA: F: CCGGAATTCATGGATTACAAGGATGACGACGATAAGACGAAAAGCTCGATCCAGGC; R: CCGCTCGAGGGTGAAGGGACTTTCTTAGAAGG.

[0057] like Fig.11 As shown, Western blotting and real-time fluorescence quantitative PCR showed the successful expression of TRIM11 mRNA at the protein and mRNA levels, respectively, and the expression levels were higher than those of LNP-mRNA. This result shows that PLNP-mRNA can successfully express functional mRNA in cells.

[0058] Co-localization with Tau TRIM11 is an important link between Tau protein and proteasome. As a molecular chaperone of Tau, TRIM11 can prevent Tau from misfolding and aggregation, and its function requires close co-localization with Tau protein.

[0059] To determine the colocalization of endogenous GFP-TRIM11 (GFP-TRIM11 was obtained by in vitro transcription kit after adding GFP to pcDNA3.0 plasmid expressing TRIM11) and Tau protein, SH-SY5Y cells were plated in 12-well plates at 1×10 5 The cells were cultured at a density of 10 cells / well until the cells grew to a density of approximately 80%. PLNP-mTRIM11, LNP-mTRIM11, and free TRIM11 mRNA (2 μg / mL) were then added and cultured for another 24 hours, fixed in 4% paraformaldehyde for 10 minutes at room temperature, permeabilized with 0.5% Triton X-100 for 5 min, and then blocked with 5% BSA for 30 minutes. The cells were incubated with rabbit anti-Tau antibody (for all cells) at 4°C overnight. After washing three times with PBS, the cells were incubated with Cy5 fluorescent anti-rabbit secondary antibody for 1 hour at room temperature. After washing three times with PBS, the nuclei were stained with DAPI (5 μg / mL) for 10 minutes, the coverslips were mounted on slides, and the fluorescence images were captured with a confocal microscope. The mTRIM11 involved in SH-SY5Y is HumanTRIM11.

[0060] like Fig.12 As shown, the fluorescence of GFP-TRIM11 and Tau (Cy5) highly overlap, indicating that TRIM11 can locate Tau and degrade it after entering the cell.

[0061] Ability to degrade phosphorylated Tau and Tau protein tangles in cells like Fig.13 SH-SY5Y cells were plated in 12-well plates at 1 × 10 5 The cells were cultured at a density of 10 cells / well until the cells grew to a density of about 80%. Then PLNP-mTRIM11, LNP-mTRIM11 and free TRIM11 mRNA (2 μg / mL) were added and culture continued. The mTRIM11 involved in SH-SY5Y is HumanTRIM11.

[0062] After 24 hours, cells were treated with Tau PFFs (Tau PFFs were first incubated with Lipo2000 in Opti-MEM for 20 minutes and then added to the cells at a final concentration of 400 nM). After 18 hours, cells were fixed in 4% paraformaldehyde for 10 minutes at room temperature, permeabilized with 0.5% Triton X-100 for 5 minutes, and then blocked with 5% BSA for 30 minutes. Cells were incubated with mouse AT8 antibody and incubated overnight at 4°C. After washing three times with PBS, cells were incubated with Cy5 fluorescent anti-mouse secondary antibody for 1 hour at room temperature. After washing three times with PBS, cells were stained with DAPI (5μg / mL) for 10 minutes, washed three times with PBS, and then fluorescent images were captured using a confocal microscope.

[0063] Alternatively, 24 hours later, okadaic acid (OA) was mixed with the culture medium (added to cells at a final concentration of 100 nM). After 18 hours, cells were fixed in 4% paraformaldehyde for 10 minutes at room temperature, permeabilized with 0.5% Triton X-100 for 5 minutes, and then blocked with 5% BSA for 30 minutes. Cells were incubated with Rabbit-P-ser396 antibody and incubated overnight at 4°C. The same treatments as above were then performed.

[0064] like Fig.14 As shown, both protein immunoblotting and confocal images indicate that after TRIM11 localizes to Tau in SH-SY5Y cells, it can degrade abnormally folded Tau protein. At the same time, the degradation ability of PLNP-mTRIM11 is significantly stronger than that of LNP-mTRIM11. For phosphorylated Tau, it is about 8.5 times that of LNP-mTRIM11; for Tau protein tangles, it is about 3 times that of LNP-mTRIM11, which also lays a good foundation for subsequent in vivo treatment.

[0065] Brain targeting ability in animals To observe the accumulation of biomimetic nanomedicines in the brain, we injected 200 μL of free mRNA, PLNP-mRNA, and LNP-mRNA (1 mg / kg) loaded with Cy5 mRNA into normal C57BL / 6J mice through the tail vein using Cy5 mRNA (GFP mRNA labeled with Cy5 fluorescence). At different time points after injection (0.5, 1, 2, 4, 8, 12, 24 h), the distribution of Cy5 fluorescence in mice was measured using the near-infrared fluorescence imaging system IVIS III with a wavelength set to an excitation wavelength of 635 nm and an emission wavelength of 675 nm.

[0066] like Fig.15As shown in a, all mRNAs were labeled with Cy5 and the distribution of PLNP-mRNA in C57BL / 6J normal mice was monitored using real-time fluorescence imaging IVIS III. The accumulation of Cy5 mRNA could be observed in the brain 30 minutes after injection, and the Cy5 fluorescence intensity calculated by the software ROI reached a peak at 30 minutes after injection, and the fluorescence intensity was still obvious at 8 hours. In sharp contrast, the fluorescence of the LNP-mRNA group and free mRNA mice was significantly weaker at each time point. In addition, mice treated with free mRNA showed weak Cy5 fluorescence and it gradually disappeared, which is consistent with our previous results, which was attributed to the limited circulation half-life and low blood-brain barrier penetration. As Fig.15 As shown in Figure c, the main organs were dissected 30 minutes after injection. The in vitro fluorescence images of various organs showed that PLNP-mRNA could efficiently penetrate the BBB, and the brain fluorescence was significantly stronger than that of the LNP-mRNA group and the free mRNA control group. From the results, it can be seen that PLNP-mRNA distribution can accumulate more in the brain, proving that PLNP-mRNA has efficient and specific targeting capabilities. Then we studied the in vivo biodistribution of PLNP-mRNA. Fig.15 As shown in Figure e, the quantitative results showed that the accumulation of Cy5 in the brain reached 8%ID / g, which was 2.6 times higher than that of free mRNA and 2 times higher than that of LNP-mRNA, demonstrating its superiority in PMPC targeting.

[0067] Targeting and transfection ability in the hippocampus The hippocampus is one of the earliest regions affected in Alzheimer's disease, with neuronal loss and neurofibrillary tangles. We used Cy5 mRNA to further explore its targeting effect in the hippocampus.

[0068] According to the in vivo imaging results in experiment 1.8, the fluorescence accumulation was highest 0.5 h after the injection of Cy5 mRNA. At this time, the mice were euthanized and the brains were dissected. The brains were then fixed, precipitated with sugar, and embedded to obtain frozen sections of the hippocampus. After staining with DAPI, the distribution of Cy5 mRNA in the hippocampus was detected by confocal CLSM.

[0069] Normal C57BL / 6J mice were randomly divided into 3 groups, 3 mice in each group, and then freemTRIM11, PLNP-mTRIM11, and LNP-mTRIM11 (1 mg / kg) were injected into the tail vein of the 3 groups of mice. After 24 hours, the mice were euthanized and the brains were dissected, fixed, precipitated with sugar, and embedded to obtain frozen sections of the hippocampus of the brain. After staining with DAPI, the distribution of GFP-mTRIM11 in the hippocampus was detected by confocal CLSM. The mTRIM11 used was HumanTRIM11.

[0070] like Fig.16 a and Fig.16 As shown in Figure b, PLNP-mRNA showed excellent targeting effect. We also found that PLNP-mRNA accumulated in astrocytes, microglia and neurons, among which the accumulation in neurons was the most significant. Fig.16 As shown in Figure g, the quantitative results also showed that there was a 2.5-fold difference between PLNP-mRNA and LNP-mRNA. This indicates that PLNP-mRNA can target the neuroinflammatory lesions and alleviate the occurrence of neuroinflammation.

[0071] At the same time, we used GFP-TRIM11 mRNA to further explore its transfection effect in the hippocampus, e.g. Fig.16 c and 16e, PLNP-mRNA had a stronger transfection effect.

[0072] In summary, compared with LNP-mRNA, PLNP-mRNA not only has superior targeting and transfection capabilities, but also shows better enrichment in the hippocampus and inflammation-related areas, laying the foundation for subsequent treatment.

[0073] Improvement of learning and cognitive abilities and safety analysis of 3×Tg-AD mice To evaluate the degradation effect of TRIM11 on Tau pathology, we utilized a triple transgenic Alzheimer's disease (AD) model expressing Tau P301L (3×Tg-AD). 3×Tg-AD mice exhibit Aβ plaques and Tau tangles, similar to human AD.

[0074] 7.5-month-old 3×Tg-AD mice were randomly divided into 4 groups, each with 10 mice, and injected with PLNP-mTRIM11, PLNP-mGFP, PBS and WT groups (2 mg / kg) once every 7 days for a total of 3 injections, at which time they already showed a large amount of Tau pathology in the brain area. When the treatment was completed, the mice were subjected to behavioral tests to analyze the therapeutic effect. Four behavioral tests, Morris water maze (MWM), novel object recognition (NOR), open field test (OFT), and nest building test, were performed to evaluate whether PLNP-mTRIM11 can improve the cognitive function of transgenic Alzheimer's disease (AD) mice. After the behavioral test, 2 mice were randomly selected from each group, of which 1 was used for heart, liver, spleen, lung, kidney and brain for H&E histological analysis, and 1 was used to separate the hippocampus region from the brain tissue for western blot protein analysis and ELISA analysis. To evaluate the durability of the mRNA vaccine effect, we conducted four behavioral tests again 82 days after the end of administration. The mTRIM11 used was HumanTRIM11.

[0075] like Fig.17 As shown in a, we evaluated the exploratory behavior of mice toward objects through the mine field test. Compared with PBS, the PLNP-mTRIM11 group explored more in the central area, and there was no significant difference with the WT (wild type) group. Fig.17 As shown in c, novel object recognition reveals cognitive processes such as the ability to discriminate novel objects, memory retention, and the ability to recognize changes. Analysis of the preference index, discrimination index, and trajectory map showed that the PLNP-mTRIM11 group of mice had stronger learning and memory abilities because they tended to interact more with novel objects when they were re-exposed to the environment. Subsequently, AD mice were trained for 4 days, and their spatial learning and memory abilities were assessed using the MWM test on the 5th day. Fig.17 As shown in b, compared with the WT type, PBS-treated mice had the longest escape latency after 4 days, indicating impaired spatial cognition. In contrast, the escape latency of PLNP-mTRIM11 was significantly shortened, indicating that PLNP-mTRIM11 can effectively improve the spatial cognition of AD mice. In addition, when the platform was removed, PLNP-mTRIM11 spent less time and distance in the target quadrant and increased the number of platform crossings compared with the aimless search of AD mice in the PBS group. Finally, the improvement of cognitive deficits was evaluated by a nesting experiment. Fig.17As shown in d, compared with the typical undamaged paper and the lowest behavioral score of the PBS group, the PLNP-mTRIM11 group showed better performance and higher behavioral scores than the PBS group. After 82 days of administration, we again conducted a series of behavioral tests to further explore the learning and cognitive abilities of mice, including Morris water maze (MWM), open field test (OFT), novel object recognition (NOR) and nesting behavior. Fig.17 As shown in Figure 3, surprisingly, PLNP-mTRIM1 mice still showed significant improvements, with no significant differences compared to wild-type (WT) mice. Together, these results suggest that PLNP-mTRIM11 treatment can significantly improve daily living activities, spatial learning and memory, and recognition abilities in AD mice, and exert a more lasting therapeutic effect.

[0076] In order to evaluate the biosafety of PLNP-mRNA, H&E staining analysis was performed on important tissue and organ sections of mice. Fig.18 As shown, after treatment with PLNP-mTRIM11 and PLNP-mGFP, there was no significant difference in the results of tissue organ sections stained with H&E compared with the PBS control group, indicating that PLNP-mTRIM11 did not produce toxic side effects in mice and had good biosafety.

[0077] Prevention of Tau pathology and neuronal damage in 3×Tg-AD mice 3×Tg-AD mice at 5.5 months of age that had not yet developed obvious Tau pathology were randomly divided into 4 groups, with 10 mice in each group, and injected with PLNP-mTRIM11, PLNP-mGFP, PBS and WT groups (2mg / kg) once every 7 days for a total of 3 injections. At this time, they showed only the mildest Tau pathology in the brain area. After an interval of one month, the mice were subjected to behavioral tests to analyze the treatment effect. Four behavioral tests were performed, namely Morris watermaze test (MWM), novel object recognition (NOR), open field test (OFT), and nestbuilding test. The mTRIM11 used was HumanTRIM11.

[0078] like Fig.19 As shown in a, compared with the GFP group, the TRIM11 group mice moved longer distances, which were similar to those of wild-type (WT) mice. Fig.19 As shown in b, the results of the NOR test showed that the interest of PBS- and GFP-treated control mice in exploring novel objects was suppressed compared with that of WT mice. Fig.19 As shown in c, in the MWM test, all groups achieved comparable escape latencies during the 4-day training period. On the test day, long-term spatial memory was investigated when the escape platform was removed. Mice treated with PBS and GFP showed an aimless search strategy with no or only slight improvements in spatial learning and memory, resulting in decreased time and paths to the target quadrant compared to the TRIM11 and WT groups. Fig.19 As shown in Figure d, the nesting experiment showed that the scores of 3×Tg-AD mice treated with PLNP-mTRIM11 were similar to those of WT mice and significantly better than all other control groups. The results showed that TRIM11 can inhibit the propagation and intercellular transmission of Tau aggregates in mice, thereby preventing glial cell activation and the decline of cognitive and motor abilities.

[0079] The above experimental results can lead to the following viewpoints and conclusions: First, the PMPC-modified lipid nanoparticles we designed and developed can effectively cross the BBB, deliver drugs to the hippocampus and neurons, and be efficiently utilized. Both the imaging results and the therapeutic effects of the disease can show that the liposome delivery system is significantly better than the efficacy of free mRNA and improves bioavailability. Second, mRNA can be efficiently delivered to the brain without causing obvious toxic side effects or functional damage to its major organs, and can simply and efficiently improve the symptoms of Alzheimer's disease, a brain disease. Third, the lipid nanoparticle mRNA combines therapeutic and preventive effects and has strong anti-Alzheimer's disease activity, which may be a promising treatment strategy for Alzheimer's disease.

[0080] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A brain-targeted liposome for delivering mRNA, characterized in that Prepared by the following method: (1) Synthesis of PMPC-CPADN: Using azobisisobutyronitrile as an initiator, 4-cyano-4-(phenylthioformylthio)pentanoic acid and 2-(methacryloyloxy)ethyl-2-(trimethylamino)ethyl phosphate were reacted to obtain PMPC-CPADN; (2) Synthesis of DSPE-PMPC: Activate the carboxylic acid functional group of PMPC-CPADN with N-hydroxysuccinimide and N,Nʹ-dicyclohexylcarbodiimide, and then add 1,2-distearoyl-sn-glyceryl-3-phosphatidylethanolamine and triethylamine to react and obtain DSPE-PMPC; (3) Preparation of liposomes: Mix the mother solutions of raw materials SM-102, DSPC, cholesterol, DMG-PEG, and DSPE-PMPC to prepare liposome solution.

2. The brain-targeted liposome for delivering mRNA according to claim 1, characterized in that The reaction in step (1) is carried out in ultra-dry methanol, and the reaction is performed under vacuum freeze-thaw to remove oxygen. The reaction temperature is 70°C, and the reaction is stirred for 24 hours.

3. The brain-targeted liposome for delivering mRNA according to claim 1, characterized in that The activation in step (2) was carried out in ultra-dry methanol at room temperature for 24 h.

4. The brain-targeted liposome for delivering mRNA according to claim 1, characterized in that In step (2), after activation, 1,2-distearoyl-sn-glyceryl-3-phosphatidylethanolamine is dissolved in ultra-dry DMF, and then added to the activated reaction solution to continue the reaction. At the same time, triethylamine is added and the reaction is carried out at 40° C. for 24 h.

5. The brain-targeted liposome for delivering mRNA according to claim 1, characterized in that In step (3), the molar ratio of SM-102, DSPC, cholesterol, DSPE-PMPC and DMG-PEG is 50:5:38.5:5~7.5:1.5~3.

6. Use of the brain-targeted liposome for delivering mRNA according to any one of claims 1 to 5 in the preparation of liposome / mRNA complexes.

7. The use according to claim 6, characterized in that: The preparation method of the liposome / mRNA complex is as follows: the liposome solution and the mRNA solution are mixed to finally prepare the liposome / mRNA.

8. The use according to claim 7, characterized in that: The concentration of the liposome solution is 8 mM, the mRNA solution is obtained by dissolving mRNA in a prepared citric acid buffer solution with a pH of 4, and the final concentration is 0.054 μg / μL. When the liposome solution and the mRNA solution are mixed, the volume ratio of the liposome solution to the mRNA solution is 1:

3.

9. Use of the brain-targeted liposome for delivering mRNA according to any one of claims 1 to 5 or the liposome / mRNA according to claim 6 in the preparation and treatment of brain diseases.

10. The use according to claim 9, characterized in that: The brain disease is a Tau protein-related brain disease.

Images