Application of small molecule compound Z1149421873 in preparation of medicine for preventing and treating myocardial fibrosis

Abstract

The invention discloses application of a small molecule compound Z1149421873 in preparation of a medicine for preventing and treating myocardial fibrosis. On one hand, the small molecule compound Z1149421873 delays the myocardial fibrosis process through targeted inhibition of a myocardial fibrosis target NAP1L1 protein, and protects the cardiac function; on the other hand, the compound has the effect of inhibiting the myocardial fibrosis process and recovering the cardiac function, and the small molecule compound Z1149421873 in a fibroblast activation model inhibits the transcription and translation levels of I-type collagen, alpha-SMA and fibronectin of cells and shows a remarkable anti-fibrosis effect. The small molecule compound Z1149421873 is used as an active ingredient for preparing the medicine with the myocardial fibrosis resisting effect, and the medicine is used for clinically treating myocardial fibrosis diseases and reversing the cardiac function of fibrosis damage and is applied to treating the myocardial fibrosis diseases.

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine, and specifically relates to the application of a small molecule compound Z1149421873 in the preparation of a drug for preventing and treating myocardial fibrosis. Background Art

[0002] Myocardial fibrosis is a pathological manifestation characterized by abnormal proliferation of fibroblasts, excessive deposition and abnormal distribution of collagen, which can cause cardiac systolic and diastolic dysfunction, abnormal myocardial function and metabolism, and ultimately lead to heart failure. When myocardial cells are damaged by ischemia, hypoxia, inflammation, and toxins, the entire cell undergoes degeneration, necrosis, and apoptosis, or myocardial cells undergo changes in structure, biochemistry, and metabolism, generating and secreting a variety of active growth factors, which ultimately activate and proliferate myocardial fibroblasts and transdifferentiate into myofibroblasts. The expression of α-smooth actin (α-SMA) increases, a large amount of fibrosis-specific extracellular matrix (ECM) is secreted, and the expression of type I and type III collagen increases while degradation decreases, thus forming myocardial fibrosis.

[0003] Transforming growth factor-β1 (TGF-β1) is an important profibrotic growth factor in the body with a wide range of effects. It is involved in regulating the entire process of cardiac fibroblast proliferation, differentiation, migration and extracellular matrix production. TGF-β1 also promotes the production of collagen and matrix proteins and the degradation of collagen, maintains the vitality of cardiac fibroblasts, and is a common signaling pathway involved in myocardial fibrosis caused by many factors, such as the Wnt / Notch / MAPK pathway. A large number of experiments have shown that TGF-β1 is a strong and effective stimulator of collagen production in animal cardiac fibroblasts. Further observation of the animal model of myocardial infarction showed that the expression of TGF-β1 was significantly increased in the animal model of myocardial infarction.

[0004] Small molecule compound Z1149421873, Chinese name is 1-(2-fluoro-4-methylphenyl)-nitrogen'-(2-naphthalene-2-acetyl)-5,6-dihydro-4-hydro-cyclopentyl[carbon]pyrazole-3-carbohydrazide, molecular formula is C 26 H 23 FN4O2, chemical structure formula is: Its role in myocardial fibrosis has not been reported. Summary of the invention

[0005] In order to solve the deficiencies in the prior art, the present invention aims to provide the use of a small molecule compound Z1149421873 in the preparation of a drug for preventing and treating myocardial fibrosis, wherein the small molecule compound Z1149421873, PubChem number: 166180036, relative molecular mass: 442.5 g / mol, chemical structure formula:

[0006] The present invention stimulates the activation of isolated myocardial fibroblasts by TGF-β1, and after administering the small molecule compound Z1149421873, it is observed that the transcription and translation levels of α-smooth muscle actin (α-SMA), type I collagen and fibronectin in myocardial fibroblasts are downregulated, collagen deposition and secretion of extracellular matrix are inhibited, and myocardial fibrosis-related phenotypes are significantly inhibited. It is further found that fibrotic lesions appear in the heart tissue of myocardial infarction model mice, and administration of the small molecule compound Z1149421873 significantly improves the heart function of the mice, inhibits collagen deposition, and reduces the level of myocardial fibrosis, confirming that the small molecule compound Z1149421873 has a significant anti-myocardial fibrosis effect. The present invention confirms that the small molecule compound Z1149421873, as a new drug, can be used in the prevention and treatment of myocardial fibrosis diseases.

[0007] Preferably, the small molecule compound Z1149421873 inhibits TGF-β1-induced cardiac fibroblast proliferation, migration and transformation into myofibroblasts.

[0008] Preferably, the small molecule compound Z1149421873 reduces the expression of collagen I, fibronectin and α-SMA proteins in fibroblasts.

[0009] Preferably, the drug uses the small molecule compound Z1149421873 as an active ingredient, and its concentration is 0.1 to 100 uM.

[0010] Preferably, the drug uses the small molecule compound Z1149421873 as an active ingredient, and its concentration is 5 to 20 uM.

[0011] Preferably, the drug further comprises a pharmaceutically acceptable excipient.

[0012] Preferably, the dosage form of the drug includes tablets, capsules, granules, pills, gels, suppositories, ointments, emulsions, mixtures, suspensions, injections and solutions.

[0013] Preferably, the administration routes of the drug include oral administration, injection, respiratory inhalation, topical administration, sublingual administration and rectal administration.

[0014] Preferably, the myocardial fibrosis includes myocardial fibrosis caused by hypertension, diabetes, viral myocarditis, coronary atherosclerosis, myocardial ischemia, and heart failure.

[0015] The present invention also provides a pharmaceutical composition, which comprises an effective dose of a small molecule compound Z1149421873 as an active ingredient, wherein the structural formula of the small molecule compound Z1149421873 is The effective dose is 0.1~100uM.

[0016] Compared with the prior art, the present invention has the following beneficial effects:

[0017] The present invention provides a new small molecule compound Z1149421873 for preventing and treating the occurrence and development of myocardial fibrosis. Experiments have confirmed that the small molecule compound Z1149421873 has a significant therapeutic effect on myocardial fibrosis, has a strong inhibitory effect on myocardial fibrosis, blocks the fibrosis process, and restores myocardial function. A cardiac fibrosis mouse model was constructed by ligating the left anterior descending branch of the coronary artery for 4 weeks, and the small molecule compound Z1149421873 was injected into the mouse tail vein. It was found that Z1149421873 has the effect of inhibiting the myocardial fibrosis process and restoring cardiac function. In the fibroblast activation model, the small molecule compound Z1149421873 inhibits the transcription and translation levels of type I collagen, α-smooth muscle actin (α-SMA) and fibronectin in the cells, showing a significant anti-fibrosis effect. The small molecule compound Z1149421873 is used as an active ingredient to prepare a drug with an anti-myocardial fibrosis effect, which is clinically used to treat cardiac fibrosis diseases and reverse the heart function damaged by fibrosis. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 : The left figure is the 2D chemical structure of the small molecule compound Z1149421873, and the right figure is the molecular docking result of the small molecule compound Z1149421873 and the NAP1L1 protein binding site in Example 1.

[0019] Figure 2 These are the results of a thermal shift experiment on the binding of the small molecule compound Z1149421873 in Example 1 to the NAP1L1 protein in primary myocardial fibroblasts of neonatal rats.

[0020] Figure 3 The effect of the small molecule compound Z1149421873 in Example 1 on the expression level of NAP1L1 protein in primary myocardial fibroblasts of neonatal rats was statistically analyzed using one-way ANOVA. # indicates P < 0.05 between the TGFβ1 group and the control group, and ** indicates P < 0.01 between the compound group and the TGFβ1 group.

[0021] Figure 4The figures show the effects of the small molecule compound Z1149421873 in Example 1 on the transcription and translation levels of fibrosis-related markers in primary cardiac fibroblasts of neonatal rats, A is the mRNA expression level of α-smooth muscle actin α-SMA in the control group and the experimental group; B is the mRNA expression level of type I collagen COL-1; C is the mRNA expression level of fibronectin FN1; D is the protein expression level of α-SMA; E is the protein expression level of COL-1; F is the protein expression level of FN1; one-way ANOVA was used to perform statistical analysis on the data, * indicates P < 0.05, ** indicates P < 0.01, and *** indicates P < 0.001.

[0022] Figure 5 The effect of the small molecule compound Z1149421873 in Example 1 on the fluorescence intensity of α-SMA protein in primary myocardial fibroblasts of neonatal rats was shown. One-way ANOVA was used to perform statistical analysis on the data. *** indicates P<0.001.

[0023] Figure 6 The effect of the small molecule compound Z1149421873 in Example 1 on the cardiac function of mice with myocardial fibrosis induced by myocardial infarction; wherein A is the animal model of myocardial fibrosis in mice induced by myocardial infarction surgery and the experimental process of the dosing regimen; B is the result of cardiac ultrasound of mice in the sham operation group, the myocardial infarction model group and the group treated with small molecule compounds after myocardial infarction surgery; C is the result of the short-axis shortening rate of the hearts of the three groups of mice; D is the result of the ejection fraction of the hearts of the three groups of mice; E is a statistical graph of the heart weight to body weight ratio of the three groups of mice; the data were statistically analyzed using one-way ANOVA, and * indicates P < 0.05.

[0024] Figure 7 The results of hematoxylin-eosin (HE), Sirius red and Masson staining of the small molecule compound Z1149421873 on myocardial fibrosis in mice in Example 1; one-way ANOVA was used to perform statistical analysis on the data, # indicates that P<0.05 was compared between the model group and the normal group, ## indicates that P<0.01, and ### indicates that P<0.001; * indicates that P<0.05 was compared between the compound group and the model group, ** indicates that P<0.01, and *** indicates that P<0.001 DETAILED DESCRIPTION

[0025] The present invention is described in detail below with reference to the accompanying drawings and specific embodiments.

[0026] Unless otherwise specified, the reagents used in the following examples are all commercially available reagents, and the detection means and methods used are all conventional technical means and methods in the art unless otherwise specified.

[0027] Example 1: Binding of small molecule compound Z1149421873 to NAP1L1

[0028] Previous studies have found that NAP1L1 is an important target for promoting myocardial fibrosis during myocardial infarction. Computer-assisted discovery of the NAP1L1 small molecule inhibitor Z1149421873 was used. The small molecule compound Z1149421873 used in this example was synthesized and provided by Shanghai Taoshu Biotechnology Co., Ltd. ( Figure 1 The thermal shift experiment was used to detect the binding effect between the small molecule compound Z1149421873 and NAP1L1 protein ( Figure 2 ), Western Blot assay was used to detect the expression level of NAP1L1 protein ( Figure 3 ), respectively verified from the theoretical and experimental levels that the small molecule compound Z1149421873 can bind to the NAP1L1 protein and inhibit the expression and activity of the NAP1L1 protein.

[0029] The specific method is as follows:

[0030] (1) Molecular docking

[0031] Homology modeling technology was used to construct a three-dimensional spatial structural model of the NAP1L1 protein dimer, and the spatial conformation of the NAP1L1 protein was optimized and sampled in a simulated solution environment by molecular dynamics simulation. Several representative conformations were screened from the dynamic trajectory of NAP1L1 through cluster analysis, and their ligand binding pockets were predicted. After comprehensively considering the physicochemical properties of each pocket, the ligand binding potential and the spatial position in the protein dimer, a binding site was selected to provide a basis for subsequent computer-assisted high-throughput screening.

[0032] Furthermore, the self-built compound library containing about 12,400,000 small molecules provided by Shanghai Taoshu Biotechnology Co., Ltd. was used to screen the compound library through semi-flexible molecular docking and flexible molecular docking technology, combined with a scoring function based on a convolutional neural network. After evaluating the drugability and synthesizability of the compounds, the top 200 compounds with potential inhibitory activity were finally screened out. Subsequently, molecular dynamics simulations were performed on the complexes of these compounds with NAP1L1 protein to further optimize and evaluate their binding modes in a simulated solution environment.

[0033] Finally, the MM-GBSA method was used to calculate the binding free energy of each ligand with the NAP1L1 protein. Among them, compound Z1149421873 exhibited the lowest binding free energy, which was -57.0 (±3) kcal / mol (without considering the contribution of conformational entropy). Binding mode analysis revealed that the Pro304, Ile319 and Leu320 amino acid side chain groups in the NAP1L1 protein formed van der Waals contacts with Z1149421873, the Lys231 amino group and the Ala302 carbonyl oxygen formed hydrogen bond interactions with Z1149421873, and the Phe297 carbonyl oxygen formed halogen bond interactions with Z1149421873, thereby stabilizing the position of Z1149421873 in the NAP1L1 binding pocket. Based on this, it is speculated that Z1149421873 may exert an inhibitory effect by interfering with the binding of NAP1L1 to its downstream target proteins, such as Figure 1 As shown in the right figure.

[0034] (2) Cell thermal shift experiment

[0035] After culturing cardiac fibroblasts in a culture dish to an appropriate density, remove them, discard the culture medium, add 2 mL of PBS to each well and wash twice, discard the PBS, add an appropriate amount of RIPA lysis buffer, use a cell scraper to scrape the cell suspension and collect it in a 1.5 mL EP tube, ultrasonically fragment, ultrasonically for 10 seconds each time, ultrasonically for a total of 3 times, with an interval of 5 minutes, and ultrasonically on ice throughout the process. The protein sample was placed on ice for full lysis, placed in a 4 ° C centrifuge at 13500r / min for 15 minutes, and the supernatant was transferred to a new 1.5 mL EP tube, and the same volume of DMSO and small molecule compound Z1149421873 of the corresponding concentration were added respectively. After standing at room temperature for 3 hours, the protein concentration was determined. The protein solution in the EP tube was equally divided into 8 new 0.2mL EP tubes, and the temperature of the program heating was set in the PCR instrument. The EP tube was placed in the tube for heat shock for 3 minutes, and then immediately inserted into ice after cooling at room temperature for 3 minutes. The liquid was transferred to a new 1.5mL EP tube, and centrifuged at 13500r / min at 4℃ for 35 minutes. The corresponding volume of Loading Buffer was added, and the tube was placed in a metal bath and boiled at 100℃ for 10 minutes and then centrifuged instantly. Subsequently, the Western Blot experiment was performed to detect the expression level of NAP1L1 protein.

[0036] (3) Western blot detection of NAP1L1 protein expression in cardiac fibroblasts

[0037] (3.1) Cell protein extraction

[0038] In the 6-well plate, discard the culture medium, add 1 mL of PBS to each well and wash twice, discard the PBS, add strong RIPA lysis buffer, collect into 1.5 mL EP tubes, and perform ultrasonic lysis, ultrasonic lysis for 10 seconds each time, a total of 3 times, each time with an interval of 5 minutes, and the whole ultrasonic process is operated on ice. Centrifuge at 13500r / min for 15 minutes in a 4℃ centrifuge, aspirate the supernatant into a new 1.5 mL EP tube, and freeze in a -80℃ refrigerator for long-term storage.

[0039] (3.2) Determination of protein concentration

[0040] The protein concentration of the sample was detected by BCA method: fresh BCA working solution (A solution: B solution = 50:1) was prepared and added to the 96-well plate at a ratio of BCA working solution: ultrapure water: protein sample solution = 200:19:1. After the liquid was fully mixed, the 96-well plate was placed in a 37°C incubator for 30 minutes. After the incubation, the 96-well plate was placed in an ELISA reader, and the absorbance value was read at a wavelength of 562nm. The absorbance value of each group of samples was substituted into the protein concentration standard curve equation to calculate the protein concentration of the sample. The processed protein sample EP tube was placed in a heater and boiled at 100°C for 7 minutes, then placed in a small centrifuge for instant centrifugation and frozen in a -80°C refrigerator for use.

[0041] (3.3) Protein electrophoresis

[0042] The preparation of 8% separation gel and 5% stacking gel is shown in Table 3.

[0043] Table 3

[0044]

[0045]

[0046] Add the sample to the pre-prepared SDS-PAGE gel with a pipette, and place a marker on each side to indicate the electrophoresis position of the protein. Perform electrophoresis at a constant voltage of 80V for 30-40 minutes. After the sample runs through the concentrated gel and forms a straight line, adjust the voltage to 120V to separate proteins of different molecular weights. Stop the electrophoresis when the bromophenol blue indicator is observed to be at the appropriate position.

[0047] (3.4) Transfer

[0048] Equilibrate the prepared PVDF membrane and filter paper of appropriate size in the pre-cooled transfer solution for 5 minutes. After opening the transfer clip, place the sponge, filter paper, SDS-PAGE gel, PVDF membrane, filter paper and sponge on the black side of the clip in sequence. To prevent affecting the transfer, no bubbles should be generated between the PVDF membrane and the gel. Place the assembled transfer clip into the transfer tank, place the transfer tank in an ice bath, add ice-cold transfer solution, and transfer at a constant current of 300mA for 1-1.5h according to the different protein molecular weights.

[0049] (3.5) Blocking and incubation with primary antibody

[0050] After the transfer process, the PVDF membrane was transferred to the PBST solution and washed three times for 3 minutes each time to remove the residual transfer solution. The PVDF membrane was then placed in 5% skim milk prepared in PBS and blocked on a horizontal shaker at room temperature for 2 hours. After blocking, the skim milk was discarded and the NAP1L1 primary antibody solution (1:2000, Proteintech, PBS dilution) was added and incubated overnight on a shaker at 4°C.

[0051] (3.6) Incubation with secondary antibody

[0052] After the primary antibody incubation, the PVDF membrane was washed three times in PBST for 5 minutes each time to remove the residual primary antibody liquid. The PVDF membrane was then placed in the secondary antibody solution and incubated at room temperature for 2 hours. After the incubation, the PVDF membrane was washed three times with PBST to remove the residual secondary antibody solution, each time for 5 minutes.

[0053] (3.7) Chemiluminescence imaging

[0054] Take ECL supersensitive chemiluminescent reagent A solution and B solution, mix them in a ratio of 1:1, add them on the PVDF membrane in a dark place, and wait for 5 minutes for ECL to fully react. Place the PVDF membrane with the front side facing up on the chemiluminescent scanning imager, add 2-3 drops of ECL supersensitive luminescent liquid on the membrane, use the instrument to scan the PVDF membrane for development, and use Image-J software to analyze the relative gray value of the protein band after development.

[0055] Example 2: Small molecule compound Z1149421873 inhibits TGF-β1-induced fibrosis of cardiac fibroblasts

[0056] Heart tissue was extracted from primary C57BL / 6 neonatal mice for the extraction, separation and culture of cardiac fibroblasts. Cardiac fibroblasts were divided into control group, TGF-β1 stimulation group, and TGF-β1+compound Z1149421873 low / medium / high dose group. The mRNA and protein expression levels of cardiac fibroblast fibrosis markers α-SMA, COL-1, and FN1 were detected by fluorescence quantitative PCR and Western Blot experiments, respectively. The results showed that the mRNA and protein expression levels of α-SMA, COL-1, and FN1 increased after TGF-β1 stimulation, and the administration of compound Z1149421873 could alleviate the increase in mRNA and protein expression levels of α-SMA, COL-1, and FN1 mediated by TGF-β1. From the gene level to the protein level, it was verified that the small molecule compound Z1149421873 can inhibit the fibrosis of cardiac fibroblasts induced by TGF-β1 ( Figure 4 ). The fluorescence intensity of α-SMA, a marker of cardiac fibroblast transformation into myofibroblast, was detected by immunofluorescence staining. The results showed that the fluorescence intensity of α-SMA increased after TGF-β1 stimulation, and the administration of compound Z1149421873 could alleviate the increase in α-SMA fluorescence intensity mediated by TGF-β1 ( Figure 5 ). It was proved that compound Z1149421873 can inhibit the transformation of cardiac fibroblasts into myofibroblasts.

[0057] The specific method is as follows:

[0058] (1) Extraction and culture of primary neonatal rat cardiac fibroblasts.

[0059] Take a 1-3 day old C57BL / 6 suckling mouse, soak it in 75% alcohol in a clean bench to disinfect its body surface, take out the suckling mouse heart, place it in pre-cooled sterile PBS solution, and allow the heart to pump out the residual blood. After trimming the auricle and aorta of the heart tissue in PBS solution, transfer it to a 15mL centrifuge tube, add D-Hanks solution to rinse twice to remove the residual blood in the heart, add fresh 0.25% trypsin solution and D-Hanks solution, place it in a 4℃ shaker overnight to digest the heart tissue, and the next day, take the upper digestion solution and place it in DMEM culture medium containing 10% fetal bovine serum and type II collagenase, and digest it on a 37℃ shaker at 160r / min. Repeat the above digestion steps until the heart tissue block disappears, and the collected cells are filtered through a 200-mesh filter and centrifuged in a centrifuge at 1500r / min for 5min. After centrifugation, discard the supernatant, add DMEM culture medium containing 10% fetal bovine serum, and make the cells evenly distributed in the DMEM culture medium. After culturing in a 37°C cell incubator for 2 hours, differentially adherent cardiomyocytes and cardiac fibroblasts were cultured, the cardiomyocyte suspension was transferred, DMEM culture medium was added to the original culture bottle, and cultured in a cell culture incubator. After 48 hours, the state of cardiac fibroblasts was observed, and subsequent experiments were performed after the cells were found to be well adhered and growing.

[0060] (2) Detection of mRNA levels of fibrosis markers α-SMA, COL-1, and FN1 in cardiac fibroblasts by fluorescence quantitative PCR

[0061] (2.1) Extraction of cellular RNA

[0062] Add 1mL of TRIzol to the 12-well plate and collect the cell suspension into an EP tube. After adding 200μL of chloroform to the EP tube, shake vigorously for 20s and let it stand at room temperature for 10min. After standing, place the EP tube in a centrifuge at 4℃ and centrifuge at 13500r / min for 15min. After centrifugation, take out the EP tube, and you can see that the liquid in the tube is divided into three phases: the top water phase (RNA phase), the middle milky white ribbon-like protein phase, and the bottom TRIzol phase (DNA phase). Use a pipette to aspirate about 400μL of the supernatant of the top layer (water layer) and transfer it to a new 1.5mL EP tube. Add an equal volume of isopropanol to the EP tube, slowly invert the EP tube 8-10 times, let it stand at room temperature for 30 minutes, centrifuge at 4°C, 13500r / min for 10 minutes, and a white RNA precipitate will form on the side of the bottom of the EP tube. Discard the liquid, add 1mL of 75% ethanol and gently shake to clean the RNA, centrifuge at 8500r / min for 5 minutes in a 4°C centrifuge, remove the 75% ethanol, invert the EP tube on a clean filter paper, dry it at room temperature for 15 minutes, dissolve the RNA with 10μL DEPC water, and measure the RNA concentration and purity.

[0063] (2.2) Preparation of cDNA

[0064] In this example, RNA was reverse transcribed using the All-in-One First-Strand cDNA Synthesis SuperMix for qPCR (One-Step gDNA Removal) kit was used, and reverse transcription was performed according to the instruction manual. GAPDH was used as an internal reference for relative standardization. The primers used in the embodiment for detecting myocardial fibroblast fibrosis were designed using the website https: / / www.ncbi.nlm.nih.gov / . The specific primer sequences of GAPDH, α-SMA, COL-1, and FN1 are shown in Table 1.

[0065] Table 1

[0066] RNAPrime name Primers from 5' to 3' GAPDH-F GCAAATTCAACGGCACAGTCAAG GAPDH-R TCGCTCCTGGAAGATGGTGATG α-SMA-F CATCAGGGAGTAATGGTTGGAATGG α-SMA-R GTTCTATCGGATACTTCAGCGTCAG COL-1-F AAGAAGACATCCCTGAAGTCA COL-1-R TTGTGGCAGATACAGATCAAG FN1-F CGAAGTCAGTGTCTATGCTCTCAAG FN1-R GGTCTCTGTAGCGTCCGTCAC

[0067] (2.3) Real-time qPCR

[0068] In this experiment, the SYBR Green DyeⅡ dye method was used, and the Trans SYBR Green PCR SuperMix kit was used to quantify the mRNA level in the sample. The detection targets (α-SMA, COL-1, FN1) and internal reference (GAPDH) of each sample were subjected to SYBR Green Real-time PCR reaction respectively. The reaction system was prepared in a 96-well plate and centrifuged at 1000r / min for 1min to allow the added reactants to evenly aggregate at the bottom of the tube. The 96-well plate was placed in a PCR instrument and the program was edited. The melting curve of the PCR product should be established for the first detection.

[0069] Table 2

[0070]

[0071]

[0072] (2.4) Data analysis

[0073] The relative amount of target gene was calculated by using the cycle value (Ct value) method. -ΔΔCT .

[0074] ΔΔCt=(Ct target gene-Ct housekeeping gene) experimental group-(Ct target gene-Ct housekeeping gene) control group.

[0075] (3) Western blot detection of protein expression of α-SMA, COL-1, and FN1 in cardiac fibroblasts

[0076] The experimental process was the same as that in Example 2 (3), with α-SMA primary antibody (1:2000, Proteintech, diluted in PBS), COL-1 primary antibody (1:2000, Proteintech, diluted in PBS), and FN1 primary antibody (1:2000, Proteintech, diluted in PBS).

[0077] (4) Immunofluorescence detection of α-SMA expression in cardiac fibroblasts

[0078] Primary neonatal rat cardiomyocytes were inoculated in 24-well plates for culture. After the cells were cultured for 48 hours and adhered to the wall, they were treated with drugs and subjected to cell fluorescence staining. 500 μL of 4% paraformaldehyde was added to each well, and the cells were fixed on a shaker at room temperature for 30 minutes, then washed 3 times with PBS for 5 minutes each time, penetrated with PBS buffer containing 0.4% Triton at room temperature for 45 minutes, washed 3 times with PBS for 5 minutes each time, and 500 μL of 1% goat serum was added to each well and blocked in a 37°C constant temperature shaker for 2 hours, the goat serum was discarded, and the cells were washed 3 times with PBS for 5 minutes each time. After absorbing the PBS, α-SMA primary antibody (1:500, Proteintech, diluted in PBS) was added to the cells and incubated overnight on a shaker at 4°C. The next day, the primary antibody was recovered, washed with PBS three times, 5 minutes each time, and the fluorescent secondary antibody (Dylight 488, 1:2000, Proteintech, diluted in PBS) was added. After incubation on a shaker at room temperature in the dark for 1 hour, the fluorescent secondary antibody was recovered, washed with PBS three times, 5 minutes each time, and then 300 μL of DAPI (1:2000, Proteintech, diluted in PBS) dye was added to each well, incubated at room temperature for 10 minutes, and finally washed with PBS three times, 5 minutes each time. Pictures were taken under a fluorescence microscope and saved, and the area of ​​α-SMA fluorescent dye in cardiac fibroblasts was calculated using Image-J software.

[0079] Example 3: Small molecule compound Z1149421873 reduces myocardial fibrosis induced by myocardial infarction in mice.

[0080] In this example, the left anterior descending coronary artery (LAD) ligation method was used to construct a pathological myocardial infarction (MI) mouse model. 6-8 weeks old healthy adult C57BL / 6 mice were selected for myocardial infarction modeling, and a mouse pathological myocardial fibrosis model was formed 4 weeks after surgery. Ultrasound detection of mouse cardiac function showed that the short-axis contraction rate and ejection fraction of the model group mice were significantly lower than those of the sham operation group mice, and the heart weight to body weight ratio was significantly increased, indicating that the pathological myocardial infarction model mouse model was successfully constructed ( Figure 6). The results of cardiac ultrasound in the myocardial infarction group + compound Z1149421873 group showed that the short-axis contraction rate and ejection fraction of myocardial infarction mice were significantly improved after 28 days of Z1149421873 intervention compared with the myocardial infarction group. HE staining, Masson staining, and Sirius red staining results showed that the blue-stained area of ​​collagen fibers in the local heart tissue of the mice in the drug-treated group was smaller than that in the modeling group, and the progression of myocardial fibrosis was significantly alleviated ( Figure 7 ).

[0081] The specific method is as follows:

[0082] (1) Ligation of the left anterior descending coronary artery (LAD) in mice

[0083] Select 6-8 weeks of adult healthy male C57BL / 6 mice (weight 20-25g), 2% aflotin intraperitoneal injection anesthesia. Turn on the external light source, ventilator, set the parameters (respiratory rate 110bpm), insert the endotracheal tube along the glottis into the trachea, remove the mouse and connect the ventilator, observe the mouse's respiratory condition, the chest rise and fall is consistent with the ventilator frequency, indicating that the intubation is successful, and the LAD operation can be performed. After the chest is depilated, the supine position is fixed on the mouse platform and the skin is disinfected with iodine. The mouse adopts the right side lying position, and the ophthalmic scissors are used under the armpit of the left forelimb. The chest cavity is opened between the third and fourth ribs with microscissors to fully expose the heart. The microscopic straight forceps tear the pericardium to fully expose the area where the left anterior descending branch of the coronary artery is located. The needle holder holds the 7-0 needle suture, and the needle is inserted at 2mm below the left atrial appendage. The suture passes through the LAD to completely block the LAD blood flow. After the ligation is completed, the chest opening is completely sutured with 6-0 sutures, the chest cavity is closed, and each layer of muscle and skin is sutured layer by layer from the inside to the outside. Pay attention to the state of the mice after the operation to see if there are any abnormal breathing, etc. After the mice wake up naturally, remove the mice from the ventilator and remove the endotracheal tube, and feed them normally. The control group (Sham) only has a thoracotomy without ligation. After the operation, the mice in the model group and the control group were cared for for 4 weeks under the same conditions, and the cardiac function was tested by cardiac ultrasound to verify whether the mouse myocardial infarction model was successfully established.

[0084] (2) Cardiac ultrasound

[0085] After the mice were anesthetized, the chest hair was removed and a coupling agent was applied, and the ultrasound probe was placed on the heart of the animal. The sensor of the digital color ultrasound diagnostic instrument system was used to obtain the two-dimensional cardiac ultrasound image of the small animal, and the direction of the probe was adjusted to obtain the corresponding M-type detection curve for measurement. The cardiac index detected myocardial infarction indicators: the short-axis contraction rate and ejection fraction of the model group mice were significantly lower than those of the sham operation group mice, while the heart weight to body weight ratio of the model group mice was significantly higher than that of the sham operation group mice.

[0086] (3) HE staining

[0087] The mouse heart tissue was washed with saline, wiped clean with paper, and placed in 4% paraformaldehyde for 24 hours for fixation. Then, the heart tissue was washed with distilled water for 30 minutes to completely remove the residual paraformaldehyde. The tissue samples were placed in 70% ethanol for 2 hours, 80% ethanol for 2 hours, 90% ethanol for 2 hours, 95% ethanol for 2 hours, anhydrous ethanol (Ⅰ) for 2 hours, and anhydrous ethanol (Ⅱ) for gradient dehydration. Then, the tissue samples were immersed in xylene for 30 minutes to make the tissue transparent. The transparent tissue samples were placed in melted paraffin and kept warm in a constant temperature box for 2-3 hours. After the paraffin completely entered the tissue samples, the xylene was replaced for embedding. The tissue samples were placed in an embedding box containing melted paraffin, the temperature was lowered to completely solidify the paraffin, and the paraffin tissue samples were cut into 3μm slices using a tissue slicer. After being completely spread out in heated water, they were attached to a slide and placed in a constant temperature box to completely dry for staining. The sample sections were sequentially placed in xylene (I) and soaked for 15 minutes, transferred to xylene (II) and soaked for 15 minutes, transferred to a 1:1 mixture of xylene and anhydrous ethanol and soaked for 3 minutes, then transferred to anhydrous ethanol (I) and soaked for 5 minutes, anhydrous ethanol (II) for 5 minutes, 80% ethanol for 5 minutes, and then washed with distilled water for 5 minutes to wash away the residual liquid. The tissue sections were stained with hematoxylin dye for 2 minutes, washed with distilled water for 5 minutes to wash away the residual night, and differentiated with 1% hydrochloric acid ethanol for 30 seconds. Then wash with distilled water for 30 seconds, place the tissue sections in 0.5% eosin dye solution for 1 minute, transfer to 80% ethanol for immersion for 30 seconds, 95 ethanol (Ⅰ) for 1 minute, 95% ethanol (Ⅱ) for 45 seconds, transfer to anhydrous ethanol (Ⅰ) for immersion for 5 minutes, anhydrous ethanol (Ⅱ) for 5 minutes, then transfer to xylene (Ⅰ) for immersion for 5 minutes, xylene (Ⅱ) for 5 minutes, finally use neutral resin glue to seal the tissue sections, observe the tissue morphology under a microscope, and use instruments for imaging and image analysis.

[0088] (4) Masson staining

[0089] The preparation of paraffin tissue sample sections required for Masson staining is the same as that in Example 3 (3), and the staining process is as follows:

[0090] After the paraffin sections of the tissues were dewaxed to water, they were rinsed with distilled water for 5 minutes, and the tissue sections were stained with Weigert iron hematoxylin staining solution for 10 minutes. The sections were rinsed with distilled water for 5 minutes, and the tissue sections were immersed in hydrochloric acid ethanol differentiation solution for 10-15 seconds, and then washed with distilled water for 5 minutes to wash away the residual liquid; after adding anti-blue solution for 10 seconds, they were rinsed with distilled water for 5 minutes; after adding Ponceau red staining solution for 5 minutes, they were washed with distilled water for 5 minutes; after adding weak acid solution to wash the sections for 1 minute, they were rinsed with phosphoplatinic acid solution, differentiated for 3 minutes, and washed with weak acid solution again for 1 minute; then the tissue sections were placed in aniline blue staining solution for 2 minutes, and then washed with weak acid solution for 2 minutes; the tissue sections were immersed in 95% ethanol for 3 seconds for rapid dehydration, and then dehydrated with anhydrous ethanol, immersing for 10 seconds each time, and dehydration was repeated 3 times; the tissue sections were immersed in xylene 3 times, immersing for 1 minute each time, so that the tissue sections were completely transparent, and finally they were sealed with neutral gum, placed under a microscope for observation, and imaging and image analysis were performed using instruments.

[0091] (5) Sirius red staining

[0092] The preparation of Sirius red heart tissue paraffin sections and the dewaxing to water steps are the same as those described in Example 3 (3). The specific staining steps are as follows: the heart tissue paraffin sections are immersed in Sirius red stain for 1 hour, and then the sections are rinsed with distilled water to wash away the residual stain, and the tissue sections are dehydrated and transparentized as described in Example (3), sealed with neutral gum, and observed under a microscope, and imaging and image analysis are performed using instruments.

[0093] The above are only preferred embodiments of the present invention and are not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. Use of small molecule compound Z1149421873 in the preparation of drugs for preventing and treating myocardial fibrosis, wherein the chemical structural formula of small molecule compound Z1149421873 is:

2. The use according to claim 1, characterized in that: The small molecule compound Z1149421873 inhibits the proliferation and migration of cardiac fibroblasts and their transformation into myofibroblasts induced by TGF-β1.

3. The use according to claim 1, characterized in that: The small molecule compound Z1149421873 reduces the expression of collagen I, fibronectin and α-SMA proteins in fibroblasts.

4. The use according to claim 1, characterized in that: The drug uses the small molecule compound Z1149421873 as an active ingredient, and its concentration is 0.1 to 100 uM.

5. The use according to claim 4, characterized in that: The concentration of the small molecule compound Z1149421873 is 5 to 20 uM.

6. The use according to claim 1, characterized in that: The medicine also contains pharmaceutically acceptable excipients, and the dosage forms include tablets, capsules, granules, pills, gels, suppositories, ointments, emulsions, mixtures, suspensions, injections and solutions.

7. The use according to claim 1, characterized in that: The administration routes of the drug include oral administration, injection, respiratory inhalation, topical administration, sublingual administration and rectal administration.

8. The use according to claim 1, characterized in that: The myocardial fibrosis includes myocardial fibrosis caused by hypertension, diabetes, viral myocarditis, coronary atherosclerosis, myocardial ischemia, and heart failure.

9. A pharmaceutical composition, characterized in that It contains an effective dose of small molecule compound Z1149421873 as an active ingredient, wherein the structural formula of the small molecule compound Z1149421873 is The effective dose is 0.1~100uM.

Images