NCgl1588 gene mutant and application thereof in preparation of L-lysine

Abstract

The invention discloses an NCgl1588 gene mutant and an application of the NCgl1588 gene mutant in preparation of L-lysine. The invention provides an NCgl1588 protein mutant. The NCgl1588 protein mutant comprises any one of the following proteins: a protein obtained by replacing V at the 81st site of an NCgl1588 protein as shown in SEQ ID No.2 with other amino acids; or a protein which is derived from bacteria, has more than 95% of identity with the protein and is related to the production of L-amino acid by the bacteria; or a protein which is obtained by substituting and / or deleting and / or adding one or more amino acid residues of the protein and is related to production of L-amino acid by bacteria; or a fusion protein obtained by connecting a label to the N end and / or C end of the protein. The invention proves that the yield of L-lysine can be obviously increased by performing point mutation on the NCgl1588G241A in the coding region of the NCgl1588 gene in corynebacterium glutamicum. The invention has important significance on the yield of L-lysine.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS: This application claims priority to the Chinese patent application (application number 202410254359.5) filed on March 6, 2024, the entire contents of which are incorporated herein by reference. Technical Field

[0002] The present invention relates to the field of biotechnology, and specifically to NCgl1588 Gene mutant and its application in preparing L-lysine. Background Art

[0003] L-lysine is a white or colorless crystalline powder. It is one of the essential amino acids for the human body and the limiting amino acid with the lowest content in plant protein. It plays an important role in the metabolism of biological organisms. Lysine deficiency will cause growth disorders. Existing research results show that lysine can inhibit the replication of herpes simplex virus, has a preventive effect on the treatment of angina pectoris and myocardial infarction, improves the memory function of patients with memory loss, and has a barbiturate-like anticonvulsant effect. In medicine, it can be used to prepare amino acid injections and oral preparations. In addition, L-lysine is also used in feed and other industries. L-lysine is produced by fermentation of Escherichia coli and Corynebacterium microorganisms. Generally, L-lysine is produced by genetically engineered strains that improve its production capacity. In recent years, in order to improve the production efficiency of L-lysine, various recombinant strains or mutants with excellent L-lysine production capacity have been developed by genetic recombination technology with Corynebacterium as the object. Evonik Operations Co., Ltd. Patent CN113166787 A uses L-lysine-secreting bacteria of the species Corynebacterium glutamicum with a complete or partial deletion of the whiB4 gene for fermentation production, and obtains good results; French patent WO2023 / 041425 A1 improves the growth state of the strain by point mutations of the GntR1 and RamA genes, thereby improving production capacity. CJ CheilJedang Co., Ltd. Patent CN 111247250 A The aglA gene with enhanced α-glucosidase activity is overexpressed for the production of L-amino acids to increase L-amino acid production. But currently, there is no NCgl1588 Related reports on increasing the production of L-lysine by mutating the 241st base G of the gene. Summary of the invention

[0004] The object of the present invention is to provide NCgl1588 Gene mutant and its application in preparing L-lysine.

[0005] In the first aspect, the present invention claims protection for NCgl1588 protein mutants.

[0006] The NCgl1588 protein mutant claimed in the present invention comprises (or is) any of the following: (A1) Protein obtained by replacing the 81st amino acid residue of NCgl1588 protein from V to other amino acids; (A2) a protein derived from bacteria and having more than 95% identity with the protein defined in (A1) and related to the production of L-amino acids (such as L-lysine) by bacteria; (A3) a protein derived from (A1) or (A2) that is related to the production of L-amino acids (such as L-lysine) by bacteria, obtained by substituting and / or deleting and / or adding one or more amino acid residues to the protein defined in (A1) or (A2); (A4) A fusion protein obtained by connecting a protein tag to the N-terminus and / or C-terminus of any of the proteins defined in (A1) to (A3).

[0007] Wherein, the amino acid sequence of the NCgl1588 protein comprises (or is) SEQ ID No.2.

[0008] In the present invention, the Chinese and English names, three-letter abbreviations and single-letter symbols of each amino acid are shown in Table 1: Table 1. Chinese and English names, three-letter abbreviations and single-letter symbols of amino acids

[0009] The term "identity" as used herein refers to sequence similarity to a natural amino acid sequence. Identity can be evaluated by the naked eye or by computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0010] The 95% or greater identity may specifically be 96% or greater identity, or 97% or greater identity, or 98% or greater identity, or 99% or greater identity.

[0011] Furthermore, the NCgl1588 protein mutant is a protein obtained by replacing the 81st amino acid residue of the NCgl1588 protein from V to I. That is, the NCgl1588 protein mutant is the protein shown in SEQ ID No.4.

[0012] In a second aspect, the present invention claims biological material.

[0013] The biological material claimed in the present invention includes (or is) any of the following: (I) a nucleic acid molecule encoding the NCgl1588 protein mutant described in the first aspect above; (II) an expression cassette containing the nucleic acid molecule described in (I); (III) a recombinant vector containing the nucleic acid molecule described in (I) or a recombinant vector containing the expression cassette described in (II); (IV) a recombinant microorganism containing the nucleic acid molecule described in (I), a recombinant microorganism containing the expression cassette described in (II), or a recombinant microorganism containing the recombinant vector described in (III); (V) a recombinant host cell containing the nucleic acid molecule of (I) or a recombinant host cell containing the expression cassette of (II) or a recombinant host cell containing the recombinant vector of (III).

[0014] Furthermore, the nucleic acid molecule comprises (or is) any one of the following: (B1) DNA molecule shown in SEQ ID No. 3; (B2) a DNA molecule that hybridizes with the DNA molecule defined in (B1) under stringent conditions and encodes the NCgl1588 protein mutant; (B3) A DNA molecule having more than 80% identity with any of the DNA sequences defined in (B1) to (B2) and encoding the NCgl1588 protein mutant.

[0015] The 80% or more identity may specifically be 81% or more, 82% or more, 83% or more, 84% or more, 85% or more, 86% or more, 87% or more, 88% or more, 89% or more, 90% or more, 91% or more, 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more identity.

[0016] The term "identity" as used herein refers to sequence similarity to a natural nucleic acid sequence. Identity can be evaluated by the naked eye or by computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0017] The 95% or greater identity may specifically be 96% or greater identity, or 97% or greater identity, or 98% or greater identity, or 99% or greater identity.

[0018] The stringent conditions may be hybridization and membrane washing in a solution of 0.1×SSPE (or 0.1×SSC), 0.1% SDS at 65°C.

[0019] Furthermore, the vector may be a plasmid, a cosmid, a phage or a viral vector.

[0020] Further, the expression cassette is composed of a promoter, the nucleic acid molecule whose expression is driven by the promoter, and a transcription termination sequence; the promoter is functionally connected to the nucleic acid molecule, and the nucleic acid molecule is connected to the transcription termination sequence. Further, the expression cassette may also include an enhancer.

[0021] Furthermore, the recombinant microorganism is a recombinant microorganism containing the expression cassette or the recombinant vector.

[0022] The microorganism may be yeast, bacteria, algae or fungi. Among them, the bacteria may be Corynebacterium glutamicum ( Corynebacterium glutamicum )、Brevibacterium lactofermentum、Brevibacterium flavum( brevibacterium flavum )、Corynebacterium pekinensis( Corynebacterium pekinense ), Brevibacterium ammoniaphagen, Corynebacterium scutellariae, or Pantoea ammoniaca ( Pantoea ). Further, the bacterium is Corynebacterium glutamicum. Further, the Corynebacterium glutamicum is Corynebacterium glutamicum ( Corynebacterium glutamicum ) ATCC13032 or Corynebacterium glutamicum ( Corynebacterium glutamicum )YP097158.

[0023] In the present invention, the recombinant microorganism is a recombinant bacterium.

[0024] Furthermore, the recombinant bacteria are recombinant bacteria.

[0025] Furthermore, the recombinant bacteria may be a gene in the genome of the recipient bacteria that has the highest identity with the gene encoding the NCgl1588 protein described in the first aspect above (e.g. NCgl1588 The gene) is replaced by the nucleic acid molecule described in the second aspect above. NCgl1588 The nucleotide sequence of the gene is shown in SEQ ID No.1.

[0026] Specifically, the gene in the genome of the recipient bacteria that has the highest identity with the gene encoding the NCgl1588 protein described in the first aspect above (e.g. NCgl1588 The gene) can be replaced with the nucleic acid molecule described in the second aspect above by mutating position 241 of SEQ ID No. 1 in the genome of the recipient bacteria from G to A (other nucleotide sequences remain unchanged).

[0027] In a specific embodiment of the present invention, the gene in the genome of the recipient bacterium that has the highest identity with the gene encoding the NCgl1588 protein described in the first aspect above (e.g. NCgl1588The gene) is replaced with the nucleic acid molecule described in the second aspect above by introducing the recombinant vector pK18-NCgl1588 into the recipient bacterium G241A The recombinant vector pK18-NCgl1588 G241A To transfer the pK18mobsacB vector Xba I and / BamH The small fragment between the I recognition sites was replaced with the DNA fragment shown in positions 37-1335 of SEQ ID No. 5, and the other sequences of the pK18mobsacB vector were kept unchanged to obtain a recombinant vector. Recombinant vector pK18-NCgl1588 G241A Containing the mutant gene shown in SEQ ID No.3 (the 474th to 1031st positions of SEQ ID No.5 are SEQ ID No.3) NCgl1588 G241A .

[0028] Furthermore, the recombinant bacterium may also be obtained by introducing the nucleic acid molecule described in the second aspect above or the expression cassette or recombinant vector described in the third aspect above into a recipient bacterium.

[0029] In a third aspect, the present invention claims a recombinant Corynebacterium glutamicum.

[0030] The recombinant Corynebacterium glutamicum claimed in the present invention includes a recombinant Corynebacterium glutamicum obtained by enhancing the activity of a protein having an amino acid sequence including SEQ ID No. 2 in Corynebacterium glutamicum.

[0031] In a fourth aspect, the present invention claims protection for any of the following applications: (C1) Use of the NCgl1588 protein mutant described in the first aspect above, the biological material described in the second aspect above, or the recombinant Corynebacterium glutamicum described in the third aspect above in the production of L-amino acids; (C2) Use of the NCgl1588 protein mutant described in the first aspect above, or the biological material described in the second aspect above, or the recombinant Corynebacterium glutamicum described in the third aspect above in increasing bacterial L-amino acid production; (C3) Use of the NCgl1588 protein mutant described in the first aspect above, or the biological material described in the second aspect above, or the recombinant Corynebacterium glutamicum described in the third aspect above in constructing an engineered strain producing L-amino acids.

[0032] In a fifth aspect, the present invention claims protection for any of the following methods: Method I: A method for increasing bacterial L-amino acid production, comprising the following steps: increasing the expression and / or activity of the NCgl1588 protein mutant described in the first aspect above in a recipient bacterium to achieve an increase in the bacterial L-amino acid production.

[0033] Method II: A method for constructing an L-amino acid producing engineered strain, comprising the following steps: increasing the expression and / or activity of the NCgl1588 protein mutant described in the first aspect above in a recipient bacterium to obtain the L-amino acid producing engineered strain.

[0034] Furthermore, increasing the expression and / or activity of the NCgl1588 protein mutant in the recipient bacteria can be achieved by any of the following methods: (D1) the gene in the genome of the recipient bacterium that has the highest identity with the gene encoding the NCgl1588 protein described in the first aspect above (the wild-type gene, such as NCgl1588 gene)) is replaced with the nucleic acid molecule described in the second aspect above (mutated gene NCgl1588 G241A ); (D2) Introducing the nucleic acid molecule described in the second aspect above or the expression cassette or recombinant vector described in the third aspect above into the recipient bacterium.

[0035] Furthermore, in (D1), the gene encoding the NCgl1588 protein (i.e. NCgl1588 The nucleotide sequence of the gene is shown in SEQ ID No.1.

[0036] Specifically, in (D1), the gene in the genome of the recipient bacterium that has the highest identity with the gene encoding the NCgl1588 protein described in the first aspect above (e.g. NCgl1588 gene ) can be replaced with the nucleic acid molecule described in the second aspect above by mutating position 241 of SEQ ID No.1 in the genome of the recipient bacteria from G to A (other nucleotide sequences remain unchanged).

[0037] In a specific embodiment of the present invention, the gene in the genome of the recipient bacterium that has the highest identity with the gene encoding the NCgl1588 protein described in the first aspect above (e.g. NCgl1588 The gene) is replaced with the nucleic acid molecule described in the second aspect above by introducing the recombinant vector pK18-NCgl1588 described above into the recipient bacterium. G241A achieved.

[0038] Furthermore, in the method, the gene in the genome of the recipient bacterium that has the highest identity with the gene encoding the NCgl1588 protein described in the first aspect above (such as NCgl1588After the gene) is replaced with the nucleic acid molecule described in the second aspect above, the method further comprises the step of fermenting the obtained recombinant bacteria. The L-amino acid (such as L-lysine) can be obtained from the fermentation product.

[0039] The fermentation culture can be carried out by a person skilled in the art using methods in the prior art, or by optimizing and improving the fermentation method through routine experiments. The fermentation culture can be carried out in a suitable culture medium under fermentation conditions known in the art. The culture medium may contain: a carbon source, a nitrogen source, trace elements and combinations thereof. During the culture, the pH of the culture can be adjusted (e.g., the pH is controlled to be 7.0). During the culture, the temperature of the culture can be 30 to 40° C. (e.g., 30° C.). During the culture, the rotation speed is controlled (e.g., the rotation speed is controlled to be 220 rpm). During the culture, the fermentation time can be controlled (e.g., the fermentation time is controlled to be 48 h).

[0040] In a specific embodiment of the present invention, the formula of the culture medium used in the fermentation culture is shown in Table 3, and the balance is water. When the fermentation culture is carried out, the fermentation control process is shown in Table 4. In the above aspects, the bacterium is a bacterium having the ability to produce L-amino acid (such as L-lysine).

[0041] "Bacteria capable of producing L-amino acids (such as L-lysine)" means that the bacteria have the following abilities: the ability to produce and accumulate L-amino acids (such as L-lysine) in the bacteria using external substances (such as culture medium), and further the ability to secrete L-amino acids (such as L-lysine) into the culture system. Thus, L-amino acids (such as L-lysine) can be collected when the bacteria are cultured in the culture medium.

[0042] The bacteria may be wild-type bacteria collected naturally or modified bacteria.

[0043] "Modified bacteria" refers to modified bacteria obtained by artificially mutating and / or inducing mutations in naturally collected wild-type bacteria.

[0044] Specifically, the bacterium may be Corynebacterium glutamicum. In a specific embodiment of the present invention, the Corynebacterium glutamicum is Corynebacterium glutamicum ( Corynebacterium glutamicum ) ATCC13032 or Corynebacterium glutamicum ( Corynebacterium glutamicum )YP097158.

[0045] Accordingly, the recombinant microorganism (recombinant bacteria) claimed in the third aspect above is specifically the recombinant bacteria NCgl1588 G241A or recombinant strain YPL-NCgl1588 G241A .

[0046] The recombinant bacterium NCgl1588G241A and Corynebacterium glutamicum ( Corynebacterium glutamicum ) ATCC13032 is only different in that: the recombinant bacteria NCgl1588 G241A To introduce Corynebacterium glutamicum ( Corynebacterium glutamicum ) The NCgl1588 gene (SEQ ID No.1) in the ATCC13032 genome was replaced by the mutant gene NCgl1588 G241A A strain is obtained by mutating the 241st position of SEQ ID No. 1 from G to A and keeping other sequences unchanged.

[0047] The recombinant bacteria YPL-NCgl1588 G241A With the Corynebacterium glutamicum ( Corynebacterium glutamicum ) The difference between YP097158 and YP097158 is that the recombinant bacteria YPL-NCgl1588 G241A In order to Corynebacterium glutamicum )YP097158 genome NCgl1588 Gene (SEQ ID No.1) is replaced by the mutated gene NCgl1588 G241A A strain is obtained by mutating the 241st position of SEQ ID No. 1 from G to A and keeping other sequences unchanged.

[0048] In the above aspects, the L-amino acid is L-lysine.

[0049] In the sixth aspect, the present invention claims protection for the use of the NCgl1588 protein mutant described in the first aspect above, or the biological material described in the second aspect above, or the recombinant Corynebacterium glutamicum described in the third aspect above in the preparation of food, cosmetics, medicine or feed containing L-lysine.

[0050] The NCgl1588 protein mutant of the present invention can be used to produce a variety of products, including but not limited to lysine in the examples, and the products produced can also be glutamic acid, valine, glycine, alanine, leucine, isoleucine, methionine, proline, tryptophan, serine, tyrosine, cysteine, phenylalanine, asparagine, glutamine, threonine, aspartic acid, arginine, histidine, shikimic acid, protocatechuic acid, succinic acid, α-ketoglutaric acid, citric acid, ornithine, citrulline, etc. When various products are produced, the coding gene of the NCgl1588 protein mutant of the present invention is placed in the synthesis pathway of the target product, and the gene in the synthesis pathway is expressed to achieve the production of the target product.

[0051] Experiments have shown that in Corynebacterium glutamicum NCgl1588 Point mutation NCgl1588 in the gene coding region G241A (i.e., the NCgl1588 The wild-type sequence of the gene coding region is replaced by the mutant sequence shown in SEQ ID No. 3), which can significantly increase the yield of L-lysine (p<0.01). The present invention has important significance for the yield of L-lysine.

[0052] Deposit description Classification name: Corynebacterium glutamicum ( Corynebacterium glutamicum ); Reference biological material: YP097158; Depository: General Microbiology Center, China Microbiological Culture Collection Administration; Abbreviation of depository institution: CGMCC; Address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing; Deposit date: August 16, 2016; The registration number of the Collection Center is: CGMCC No.12856. DETAILED DESCRIPTION

[0053] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0054] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0055] The Corynebacterium glutamicum ( Corynebacterium glutamicum )ATCC13032 is the ATCC number 13032 Corynebacterium glutamicum ( Corynebacterium glutamicum ). Hereinafter referred to as Corynebacterium glutamicum ATCC13032.

[0056] The Corynebacterium glutamicum ( Corynebacterium glutamicum )YP097158 was deposited in the General Microbiological Center of China Microorganism Culture Collection Administration on August 16, 2016, with the deposit number CGMCC No. 12856. Hereinafter referred to as Corynebacterium glutamicum YP097158.

[0057] Example 1: Construction of a NCgl1588 Genetically engineered strains 1. Build includes NCgl1588 G241A Recombinant vector for gene point mutation Based on the genome sequence of Corynebacterium glutamicum ATCC13032 published by NCBI, two pairs of amplification NCgl1588 Primers for the mutation site in the gene coding region were used to replace the wild-type gene in Corynebacterium glutamicum YP097158 (sequencing confirmed that the wild-type gene was retained on the chromosome of this strain). NCgl1588 gene coding region) and wild-type Corynebacterium glutamicum strain ATCC13032 NCgl1588 A point mutation was introduced into the gene coding region (SEQ ID No. 1), wherein the point mutation NCgl1588 The 241st guanine (G) in the nucleotide sequence of the gene (SEQ ID No.1) was mutated to adenine (A), and the DNA molecule shown in SEQ ID No.3 was obtained (mutated NCgl1588 Gene, named NCgl1588 G241A ).

[0058] The DNA molecule shown in SEQ ID No.1 encodes a protein with an amino acid sequence of SEQ ID No.2, and the name of the protein is NCgl1588. The DNA molecule shown in SEQ ID No.3 encodes a protein with an amino acid sequence of SEQ ID No.4, and the name of the mutant protein is NCgl1588. V81I SEQ ID No. 4 shows the mutant protein NCgl1588 V81I The isoleucine (I) at position 81 in the gene was mutated to valine (V).

[0059] The recombinant vector was constructed using NEBuilder assembly technology. The primers were designed as follows (synthesized by Shanghai Invitrogen). The bases in bold red are the mutation positions: P1: 5'- CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAG ttctggatgcatcgcaggg-3'; P2: 5'-attctgcttcgcctgcgaTgaccttaacagtgacc-3'; P3: 5'-ggtcactgttaaggtcAtcgcaggcgaagcagaat-3'; P4: 5'- CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCC gctggtgcgacttcttcag-3'.

[0060] Note: The underlined parts of P1 and P4 are the sequences contained in the pK18mobsacB vector.

[0061] Construction method: Using Corynebacterium glutamicum ATCC13032 as a template, KAPA HiFi HotStart DNA polymerase (Cat. No. KK2501, Kapa Biosystems) was used for PCR amplification with primer pairs P1 / P2 and P3 / P4, respectively, to obtain two DNA fragments containing the NCgl1588 gene coding region with mutant bases, with sizes of 732 bp and 676 bp, respectively. The amplification product of primer pair P1 / P2 was named NCgl1588 Up, and the amplification product of primer pair P3 / P4 was named NCgl1588 Down.

[0062] PCR amplification system: 5×HiFi with Mg 2+ Buffer 10μL, dNTP Mixture (10 mM) 1.5μL, upstream and downstream primers (10pM) 1.6μL each, KAPA HiFi HotStart (1U / μL) 0.5μL, add ddH2O to a total volume of 50μL.

[0063] PCR amplification program: pre-denaturation at 95°C for 5 min, (denaturation at 98°C for 20 s; annealing at 60°C for 15 s; extension at 72°C for 30 s; 30 cycles), over-extension at 72°C for 5 min.

[0064] The two DNA fragments (NCgl1588 Up and NCgl1588 Down) were separated by agarose gel electrophoresis and recovered by QIAquick gel recovery kit (Cat. No. 28706, QIAGEN GmbH). Xba I / BamH I) The purified pK18mobsacB plasmid (BioVector NTCC Type Culture Collection Center, the plasmid contains a kanamycin resistance marker) was connected with the NEBuilder HiFi DNA Assembly Cloning Kit (Cat. No. E2621S, New England Biolabs) at 50°C for 30 min. The single clone grown after the ligation product was transformed was identified by PCR using primers PNCgl1588-1 / PNCgl1588-4. The one that could amplify a fragment of 1373 bp (SEQ ID No. 5) was a positive recombinant vector pK18-NCgl1588 G241A The recombinant vector contains a kanamycin resistance marker. G241AThe recombinant vector pK18-NCgl1588 containing the correct point mutation (G241A) was sent to a sequencing company for sequencing and identification. G241A Save for later use.

[0065] This recombinant vector pK18-NCgl1588 G241A Contains a mutation site (G241A), which will lead to NCgl1588 The 241st guanine (G) in the gene coding region mutated to adenine (A), which ultimately led to the mutation of the 81st valine (V) in the encoded protein to isoleucine (I).

[0066] Recombinant vector pK18-NCgl0762 G241A Description of the structure: pK18mobsacB vector Xba I and BamH The fragment (small fragment) between the I recognition sites was replaced with the DNA fragment shown in SEQ ID No. 5 from position 37 to position 1335 in the sequence list, and the other sequences of the pK18mobsacB vector were kept unchanged to obtain the recombinant vector. Recombinant vector pK18-NCgl1588 G241A Containing the mutant gene shown in SEQ ID No.3 (the 474th to 1031st positions of SEQ ID No.5 are SEQ ID No.3) NCgl1588 G241A .

[0067] 2. Construction of genes NCgl1588 G241A Engineered strains The constructed allelic replacement plasmid (pK18-NCgl1588 G241A ) was transformed into the Corynebacterium glutamicum strain YP097158 by electroporation (sequencing confirmed that the wild-type NCgl1588Gene coding region) and wild-type Corynebacterium glutamicum strain ATCC13032 were cultured on a solid culture plate containing kanamycin (50 mg / L) for 40 hours. The single colonies produced by the culture were identified by the primers P1 / P4 mentioned above (see step 1 for the specific sequence), and the strain that could amplify a 1373 bp band was a positive strain. The positive strain was streaked and cultured on a medium containing 15% sucrose (the medium was obtained by increasing the sucrose concentration in the medium in Table 2 to 150 g / L), and the single colonies produced by the culture were cultured on a medium containing kanamycin and a medium without kanamycin, respectively. The strain that grew on the medium without kanamycin but did not grow on the medium containing kanamycin (i.e., the positive strain that underwent homologous recombination with the genome) was selected for further PCR amplification using primers P1 / P4 (for the specific sequence, see step 1), and the obtained multiple DNA fragments (1373 bp, SEQ ID No. 5) were sequenced. Through sequence alignment, the strain with a mutation in the base sequence (G241A) was a positive strain with successful allelic replacement. The positive strain obtained from Corynebacterium glutamicum ATCC13032 was named the recombinant strain NCgl1588 G241A The positive strain obtained from Corynebacterium glutamicum YP097158 was named as recombinant strain YPL-NCgl1588 G241A .

[0068] Recombinant bacteria NCgl1588 G241A and recombinant strain YPL-NCgl1588 G241A All of them contain the mutation gene shown in SEQ ID No.3 NCgl1588 G241A , and express the protein shown in SEQ ID No.4.

[0069] Recombinant bacteria NCgl1588 G241A The only difference from Corynebacterium glutamicum ATCC13032 is that the recombinant strain NCgl1588 G241A In order to transform the Corynebacterium glutamicum ATCC13032 NCgl1588 The gene (SEQ ID No.1) was replaced by NCgl1588 G241A The strain was obtained by amplifying the gene (SEQ ID No. 3) and keeping other sequences unchanged.

[0070] Recombinant bacteria YPL-NCgl1588 G241A The only difference from Corynebacterium glutamicum YP097158 is that the recombinant strain YPL-NCgl1588 G241A To transform the Corynebacterium glutamicum YP097158 NCgl1588 The gene (SEQ ID No.1) was replaced by NCgl1588G241A The strain was obtained by amplifying the gene (SEQ ID No. 3) and keeping other sequences unchanged.

[0071] Table 2. Composition of culture medium (solvent is water) and culture conditions

[0072] Embodiment 2, NCgl1588 G241A base L-Lysine shake flask fermentation of mutant strains The recombinant bacteria NCgl1588 constructed in Example 1 G241A and recombinant strain YPL-NCgl1588 G241A , and the original strains of Corynebacterium glutamicum ATCC13032 and YP097158 were fermented in 500 mL baffled shake flasks with the culture medium shown in Table 3 and the control conditions shown in Table 4. After the fermentation, the L-lysine production was detected by SBA-biosensor analyzer. Each strain was repeated three times, and the L-lysine production data were analyzed by one-way analysis of variance. The experimental results showed that P<0.05 (*) indicated a significant difference, and P<0.01 (**) indicated an extremely significant difference.

[0073] Table 3. Shake flask fermentation medium formula (solvent is water)

[0074] Table 4. Fermentation control conditions

[0075] The results are shown in Table 5. Corynebacterium glutamicum ) NCgl1588 After site-directed mutagenesis (G241A) was performed in the gene coding region to change its sequence, the result was helpful to increase the production of L-lysine.

[0076] Table 5. Results of shake flask fermentation experiments of L-lysine of Corynebacterium glutamicum and its mutants

[0077] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. A NCgl1588 protein mutant, characterized in that: The NCgl1588 protein mutant comprises any of the following: (A1) Protein obtained by replacing the 81st amino acid residue of NCgl1588 protein from V to other amino acids; (A2) a protein derived from bacteria and having more than 95% identity with the protein defined in (A1) and related to the production of L-amino acids by bacteria; (A3) a protein derived from (A1) or (A2) related to the production of L-amino acids by bacteria, obtained by substituting and / or deleting and / or adding one or more amino acid residues to the protein defined in (A1) or (A2); (A4) A fusion protein obtained by connecting a protein tag to the N-terminus and / or C-terminus of any of the proteins defined in (A1) to (A3).

2. The NCgl1588 protein mutant according to claim 1, characterized in that: The NCgl1588 protein mutant is a protein obtained by replacing the 81st amino acid residue of the NCgl1588 protein from V to I.

3. Biomaterial, characterized in that The biological material includes any of the following: (I) a nucleic acid molecule encoding the NCgl1588 protein mutant according to claim 1 or 2; (II) an expression cassette containing the nucleic acid molecule described in (I); (III) a recombinant vector containing the nucleic acid molecule described in (I) or a recombinant vector containing the expression cassette described in (II); (IV) a recombinant microorganism containing the nucleic acid molecule described in (I), a recombinant microorganism containing the expression cassette described in (II), or a recombinant microorganism containing the recombinant vector described in (III); (V) a recombinant host cell containing the nucleic acid molecule of (I) or a recombinant host cell containing the expression cassette of (II) or a recombinant host cell containing the recombinant vector of (III).

4. The biomaterial according to claim 3, characterized in that: The nucleic acid molecule comprises any of the following: (B1) DNA molecule shown in SEQ ID No. 3; (B2) a DNA molecule that hybridizes with the DNA molecule defined in (B1) under stringent conditions and encodes the NCgl1588 protein mutant; (B3) A DNA molecule having a sequence identity of more than 95% with any one of the DNA sequences defined in (B1) to (B2) and encoding the NCgl1588 protein mutant.

5. A recombinant Corynebacterium glutamicum, characterized in that: The recombinant Corynebacterium glutamicum includes the recombinant Corynebacterium glutamicum obtained by enhancing the activity of the protein having the amino acid sequence of SEQ ID No. 2 in Corynebacterium glutamicum.

6. Any of the following applications: (C1) Use of the NCgl1588 protein mutant according to claim 1 or 2, the biological material according to claim 3 or 4, or the recombinant Corynebacterium glutamicum according to claim 5 in the production of L-amino acids; (C2) Use of the NCgl1588 protein mutant according to claim 1 or 2, the biological material according to claim 3 or 4, or the recombinant Corynebacterium glutamicum according to claim 5 in increasing bacterial L-amino acid production; (C3) Use of the NCgl1588 protein mutant described in claim 1 or 2, the biological material described in claim 3 or 4, or the recombinant Corynebacterium glutamicum described in claim 5 in constructing an engineered strain producing L-amino acids.

7. Either of the following methods: Method I: A method for increasing bacterial L-amino acid production, comprising the following steps: increasing the expression and / or activity of the NCgl1588 protein mutant of claim 1 in a recipient bacterium to achieve an increase in the bacterial L-amino acid production; Method II: A method for constructing an L-amino acid producing engineered strain, comprising the following steps: increasing the expression and / or activity of the NCgl1588 protein mutant of claim 1 in a recipient bacterium to obtain the L-amino acid producing engineered strain.

8. The method according to claim 7, characterized in that: Improving the expression and / or activity of the NCgl1588 protein mutant in the recipient bacteria is achieved by any of the following methods: (D1) replacing the gene in the genome of the recipient bacterium that has the highest identity with the gene encoding the NCgl1588 protein in claim 1 with the nucleic acid molecule described in (I) of claim 3 or 4; (D2) Introducing the nucleic acid molecule described in (I) of claim 3 or 4, the expression cassette described in (II) of claim 3 or 4, or the recombinant vector described in (III) of claim 3 or 4 into the recipient bacterium.

9. The use or method according to any one of claims 6 to 8, characterized in that: The bacteria are Corynebacterium bacteria; Further, the bacteria is Corynebacterium glutamicum; and / or The L-amino acid is L-lysine.

10. Use of the NCgl1588 protein mutant according to claim 1 or 2, the biological material according to claim 3 or 4, or the recombinant Corynebacterium glutamicum according to claim 5 in the preparation of food, cosmetics, medicine or feed containing L-lysine.

Images