Anti-CD99 antibody or functional fragment thereof and application thereof

Abstract

The invention relates to the field of biological detection, in particular to an anti-CD99 antibody or a functional fragment thereof and application thereof, and particularly discloses a CDR sequence and a heavy-chain and light-chain variable region of the antibody. The antibody has good binding specificity and affinity to CD99, can be used for detecting samples, and provides more antibody choices for detection of CD99 and diagnosis or auxiliary diagnosis of children acute lymphocytic leukemia with CD99 as a marker.

Description

Technical Field

[0001] The present invention relates to the field of biological detection, and in particular to an anti-CD99 antibody or a functional fragment thereof and applications thereof. Background Art

[0002] Leukemia is a malignant proliferative disease of the hematopoietic system and one of the diseases that seriously threatens the life and health of children. Childhood leukemia is the most common type of childhood malignant tumor, accounting for about 20-30% of childhood tumor patients. Among them, acute lymphoblastic leukemia (ALL) is the most common childhood leukemia, which is characterized by rapid onset, irregular fever of varying degrees in the early stage of the disease, long duration of fever, and generally difficult to find obvious infection foci.

[0003] Childhood acute lymphoblastic leukemia is very sensitive to chemotherapy, and cancer cells are easily killed. Combined with bone marrow transplantation and other treatments, its clinical treatment effect has been significantly improved in the past few decades. However, some patients still experience relapses and lead to adverse outcomes or even death.

[0004] Therefore, it is of great significance to find relevant factors that can accurately predict the prognosis of childhood leukemia and take targeted treatment for patients in advance.

[0005] CD99 is a type I transmembrane glycoprotein with a molecular weight of 32kDa and is a type of cell adhesion molecule. CD99 is involved in the process of cell adhesion and apoptosis. It is produced by thymocytes and T cells and plays an important role in the interaction between cells and extracellular matrix as well as between cells, and affects the occurrence, development and metastasis of tumor cells. The CD99 molecule plays different roles in the diagnosis, occurrence, development, metastasis and prognosis of different types of tumors. In recent years, it has been found that CD99 is also an important marker for the prognostic risk of childhood leukemia. The prognosis of childhood leukemia can be evaluated by detecting the content of CD99. Therefore, the development of highly specific antibodies is crucial for the detection of CD99. At present, the monoclonal antibodies used in China for detecting CD99 are not ideal in terms of sensitivity and specificity. Summary of the invention

[0006] The purpose of the present invention is to provide an anti-CD99 antibody or a functional fragment thereof and its application. The antibody has good binding specificity and affinity to CD99, can be used to detect samples, and provides more diverse antibody options for the detection of CD99 and the diagnosis or auxiliary diagnosis of childhood acute lymphoblastic leukemia using CD99 as a marker.

[0007] In order to achieve the above object, according to one aspect of the present invention, an anti-CD99 antibody or a functional fragment thereof is provided, wherein the antibody or the functional fragment thereof has the following complementary determining region:

[0008] Heavy chain complementarity determining region:

[0009] HCDR1, which comprises or consists of the amino acid sequence shown in SEQ ID NO: 1;

[0010] HCDR2, which comprises or consists of the amino acid sequence shown in SEQ ID NO: 2;

[0011] and HCDR3, which comprises or consists of the amino acid sequence shown in SEQ ID NO:3;

[0012] and light chain complementarity determining region:

[0013] LCDR1, which comprises or consists of the amino acid sequence shown in SEQ ID NO:4;

[0014] LCDR2, which comprises or consists of the amino acid sequence shown in SEQ ID NO:5; and

[0015] LCDR3 comprises or consists of the amino acid sequence shown in SEQ ID NO:6.

[0016] The complementarity determining regions were determined using the Kabat method.

[0017] "Antibodies" in the present invention include polyclonal antibodies and monoclonal antibodies and antigen compound binding fragments of these antibodies, including Fab, F(ab')2, Fd, Fv, scFv, bispecific antibodies and antibody minimum recognition units, as well as single-chain derivatives of these antibodies and fragments. The types of antibodies can be selected from IgG1, IgG2, IgG3, IgG4, IgA, IgM, IgE, and IgD. In addition, the term "antibody" includes naturally occurring antibodies and non-naturally occurring antibodies, including, for example, chimeric, bifunctional and humanized antibodies, and related synthetic isoforms. The term "antibody" can be used interchangeably with "immunoglobulin".

[0018] In the present invention, the heavy chain complementary determining region is represented by HCDR, which includes HCDR1, HCDR2 and HCDR3; the light chain complementary determining region is represented by LCDR, which includes LCDR1, LCDR2 and LCDR3. Commonly used CDR labeling methods in the art include: Kabat numbering scheme, IMGT numbering scheme, Chothia and Lesk numbering scheme, and the new standardized numbering system introduced by Lefranc et al. for all protein sequences of the immunoglobulin superfamily in 1997. Kabat et al. were the first to propose a standardized numbering scheme for immunoglobulin variable regions. Over the past few decades, the accumulation of sequences has led to the creation of the KABATMAN database, and the Kabat numbering scheme is generally considered to be a widely used standard for numbering antibody residues. The present invention uses the Kabat annotation standard to mark the CDR region, but CDR regions marked by other methods also fall within the scope of protection of the present invention.

[0019] In the present invention, the region other than CDR in the antibody heavy chain variable region and light chain variable region is the framework region; wherein the heavy chain framework region can be further subdivided into adjacent regions separated by CDR, comprising HFR1, HFR2, HFR3 and HFR4 framework regions; the light chain framework region can be further subdivided into adjacent regions separated by CDR, comprising LFR1, LFR2, LFR3 and LFR4 framework regions.

[0020] Typically, the variable regions of the heavy and light chains can be obtained by arranging and connecting the following numbered CDRs and FRs in the following combinations: FR1-CDR1-FR2-CDR2-FR3-CDR3-FR4.

[0021] Preferably, the anti-CD99 antibody is a monoclonal antibody.

[0022] More preferably, the amino acid sequences of the heavy chain variable region and the light chain variable region of the monoclonal antibody are the amino acid sequences shown in SEQ ID NO.7 and SEQ ID NO.8, respectively.

[0023] The "variable region" of an antibody in the present invention refers to the amino-terminal domain of the heavy or light chain of an antibody. These domains are usually the most variable parts of an antibody and contain the antigen binding site. The light or heavy chain variable region consists of a framework region interrupted by three hypervariable regions called "complementarity determining regions" or "CDRs". The scope of the framework region and CDR has been precisely defined, for example in Kabat (see Sequences of Proteins of Immunological Interest, E. Kabat et al., U.S. Department of Health and Human Services, (1983)) and Chothia. The framework region of an antibody, i.e., the combined framework region of the constituent light and heavy chains, plays a role in positioning and aligning the CDRs, which are primarily responsible for binding to the antigen. In the present invention, the term "complementarity determining region", "CDR" refers to the highly variable region of the heavy and light chains of immunoglobulins, and refers to the region containing one or more or even all of the major amino acid residues that contribute to the binding affinity of an antibody or antigen-binding fragment to its recognized antigen or epitope. In a specific embodiment of the present invention, CDR refers to the highly variable region of the heavy and light chains of the antibody.

[0024] In an alternative embodiment, the antibody further comprises a constant region.

[0025] In an alternative embodiment, the constant region includes a heavy chain constant region and / or a light chain constant region.

[0026] In an alternative embodiment, the heavy chain constant region is selected from the heavy chain constant region of IgG1, IgG2, IgG3, IgG4, IgA, IgM, IgE or IgD, and the light chain constant region is selected from the κ type or λ type light chain constant region.

[0027] In an alternative embodiment, the species of origin of the constant region is cattle, camel, horse, dairy cow, pig, sheep, goat, rat, mouse, dog, cat, rabbit, donkey, deer, mink, chicken, duck, goose, turkey, fighting cock or human.

[0028] In an alternative embodiment, the species origin of the constant region is mouse.

[0029] In another aspect, the present invention provides an isolated nucleic acid molecule, which is DNA or RNA, encoding the antibody or a functional fragment thereof.

[0030] In another aspect, the present invention provides a vector comprising the isolated nucleic acid molecule.

[0031] In another aspect, the present invention provides a host cell transformed with the vector.

[0032] On the other hand, the present invention also provides a method for preparing the anti-CD99 antibody or a functional fragment thereof.

[0033] On the other hand, the present invention also provides a detection reagent, which comprises the anti-CD99 antibody or a functional fragment thereof.

[0034] On the other hand, the present invention also provides the use of the anti-CD99 antibody or its functional fragment in detecting childhood leukemia.

[0035] Preferably, the childhood leukemia is childhood acute lymphoblastic leukemia.

[0036] Beneficial effects:

[0037] The present invention provides a highly specific anti-CD99 antibody and its use, which provides more diverse antibody selections for the detection of CD99 and the diagnosis or auxiliary diagnosis of childhood acute lymphoblastic leukemia using CD99 as a marker. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0039] Figure 1 : Stability of monoclonal antibodies against CD99. DETAILED DESCRIPTION

[0040] The embodiments of the present invention will be described in detail below in conjunction with the examples, but it will be appreciated by those skilled in the art that the following examples are only used to illustrate the present invention and should not be considered as limiting the scope of the present invention. If no specific conditions are specified in the examples, the conditions are carried out according to normal conditions or the conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be obtained commercially.

[0041] The practice of the present invention will employ, unless otherwise indicated, conventional techniques of cell biology, molecular biology (including recombinant techniques), microbiology, biochemistry, and immunology, which are within the capabilities of a skilled artisan. This technique is fully explained in the literature, such as Molecular Cloning: A Laboratory Manual, 2nd Edition (Sambrook et al., 1989); Oligonucleotide Synthesis (MJ Gait, ed., 1984); Animal Cell Culture (RI Freshney, ed., 1987); Methods in Enzymology (Academic Press, Inc.); Handbook of Experimental Immunology (DM Weir and CC Blackwell, eds.); Gene Transfer Vectors for Mammalian Cells (JM Miller and MP Calos, eds., 1987); Current Protocols in Molecular Biology (FM Ausubel et al., eds., 1987); PCR: The Polymerase Chain Reaction (PCR: The Polymerase Chain Reaction) (Academic Press, Inc.); Reaction" (Mullis et al., eds., 1994); and Current Protocols in Immunology (JE Coligan et al., eds., 1991), each of which is expressly incorporated herein by reference.

[0042] The features and performance of the present invention are further described in detail below in conjunction with the embodiments.

[0043] Example 1: Expression and purification of recombinant protein CD99

[0044] The human CD99 gene sequence was cloned into a prokaryotic expression vector to construct a prokaryotic expression plasmid, which was transformed into E. coli BL21 and cultured on an LB plate containing antibiotics. A single clone was picked and inoculated into LB medium. After the bacterial solution OD value reached 0.6, IPTG was added to induce protein expression. After 16 hours of induction, the bacterial solution was centrifuged and collected. After the bacterial cells were broken, the supernatant was collected by centrifugation, and the antigen protein was purified by ion exchange and molecular sieve.

[0045] After SDS-PAGE electrophoresis confirmed that the protein band size was correct, no dragging or mixed bands were generated, and the purity reached more than 90%, it could be used for the preparation of monoclonal antibodies.

[0046] Example 2: Mouse immunization and antibody detection

[0047] Select 5 6-8 week old SPF female BALB / c mice, mix and emulsify Freund's complete adjuvant and 2 mg / ml antigen protein in equal volumes. Use the emulsified antigen to immunize 6-8 week old SPF female BALB / c mice, and inject 40 μg of antigen protein into each mouse by subcutaneous injection in the foot or back. Two weeks after the first immunization, mix and emulsify the antigen protein with Freund's incomplete adjuvant, and inject 40 μg of antigen protein into each mouse by subcutaneous injection in the foot or back. Two weeks later, collect blood through the tail vein, collect the supernatant by centrifugation, and test the serum titer by ELISA. Immunize and test the serum titer every two weeks. After two immunizations, the serum titer is as high as 2.0 or above after a million-fold dilution. Screening serum titer 10 6 Lymph was taken from the above mice to separate lymphocytes for cell fusion.

[0048] Example 3: Cell fusion and positive hybridoma cell screening and subcloning

[0049] Lymphocytes of isolated immune mice were fused with cultured SP2 / 0 cells by PEG1500 or electrofusion. The fused cells were cultured in HAT-1640 medium containing 20% ​​FBS serum. After 6 days of culturing the fused cells, the original culture medium was aspirated and 200 μl of fresh HAT medium was added. The culture supernatant was taken on the second day and the positive wells were screened by ELISA. The ELISA method uses an ELISA detection plate. The preparation conditions of the ELISA detection plate are as follows: the CD99 antigen amount per well is coated at 50 ng, the coating liquid is carbonate buffer, and the blocking liquid is 5% skim milk powder; the positive wells are replaced with fresh culture medium again, and the culture supernatant is tested again by ELISA after 1 day of culture; the wells that are positive in both tests are selected for the first cloning culture, that is, by limiting dilution, each well of the 96-well plate contains only 1 cell on average; after 7 days, the cell culture supernatant of the cloning culture plate is tested by ELISA to select the positive wells. The culture supernatant of the positive wells is then subjected to affinity screening. The specific method is as follows: the CD99 antigen is coated on the ELISA test plate, the cell culture supernatant is first incubated with the antigen for 1 hour, the antibody in the culture supernatant will bind to the free antigen, and then the incubated culture supernatant is added to the antigen-coated ELISA test plate. The unbound free antibody in the culture supernatant will bind to the coated antigen on the ELISA test plate and remain on the plate. Finally, an enzyme-labeled secondary antibody is added for color development. A positive result indicates that the antibody binds to the coated antigen. The higher the positive value, the more free antibodies remain after the supernatant is incubated with the antigen, that is, the higher the relative affinity. Select the clone wells with high relative affinity to continue cloning until the clone well test results are 100% positive. Generally, 2-4 clonings are required. The cloned cell lines are expanded and finally frozen in liquid nitrogen.

[0050] Example 4 Production and purification of monoclonal antibodies

[0051] Two groups of 6-8 week old BALB / c mice were selected and intraperitoneally injected with 500 μL paraffin oil to suppress the immune response of the mice. One week after the injection, the cell line described in Example 3 was intraperitoneally injected into one group of mice at a cell density of about 1×10 6 After two weeks, the ascites was collected. The collected ascites was precipitated with ammonium sulfate and purified with protein A affinity to obtain the target antibody, and the purification effect was identified by PAGE electrophoresis.

[0052] Example 5: Identification of subtypes of monoclonal antibodies and gene sequence cloning

[0053] The SBA Clonotyping System-HRP kit from Southern Biothech was used to identify the subtypes of the heavy and light chains of the monoclonal antibody according to the instructions. The specific procedures were as follows:

[0054] 1. Dilute the capture antibody to 1 μg / mL with coating solution (0.05M carbonate and bicarbonate buffer at pH 9.5), add 100 μL / well to the ELISA plate, and coat overnight at 4°C. Wash the plate three times with PBS buffer (washing solution) containing 0.05% Tween-20.

[0055] 2. Dilute the culture supernatant of the hybridoma cells to be tested with diluent (1% BSA, 0.1% PBST) at a ratio of 1:1, add 100 μL / well to the ELISA plate, and incubate at 37°C for 30 minutes. Dilute the corresponding enzyme-labeled antibodies (Ig-HRP, IgG1-HRP, IgG2a-HRP, IgG2b-HRP, IgG3-HRP, IgM-HRP, kappa-HRP, lamda-HRP) at a ratio of 1:3000 with diluent.

[0056] 3. After washing the plate three times with the plate washing solution, add 100 μL of diluted enzyme-labeled antibody to each well and incubate at 37°C for 30 minutes. After washing the plate three times again, add the color developing solution, and after about 5 minutes (depending on the strength of the reaction), add 2M sulfuric acid to terminate the reaction and read the OD450 absorbance value.

[0057] After identification, the antibody was found to be an IgG1 mouse monoclonal antibody. Based on the antibody subtype results, the antibody gene sequence was cloned using a mature technical route. Hybridoma cells with good growth were collected, and total RNA of hybridoma cells was extracted using Trizol from Thermo Company. The mRNA was reverse transcribed into cDNA according to the instructions of PrimeScript II ReverseTranscriptase from Takara Company, and then frozen at -20°C for future use.

[0058] The specific operation process of reverse transcription is as follows:

[0059] First, prepare a 10 μL total volume of template RNA / primer DNA premix, including 1 μL 10 μM concentration of specific primers (sequences are atgggtgccagtgtctcttagga and gaagcctccaagaccttagaagggaa), 4 μL 2.5 mM dNTP mixture, and 5 μL RNA (total amount less than 5 μg). After mixing, treat at 65°C for 5 minutes and immediately put on ice.

[0060] Add 4 μL 5× PrimeScript II buffer, 20 units of RNase inhibitor, and 1 μL PrimeScript II RTase (200 units) to the premix, mix well, react at 42°C for 60 minutes, then at 70°C for 15 minutes, and then cool on ice for later use.

[0061] Using cDNA as a template, the antibody gene amplification primers reported in the literature were used to perform amplification attempts independently, and the primers that can efficiently amplify the antibody gene were screened out. PCR was performed according to the operating scheme of the Phanta Max Super-Fidelity DNA Polymerase instruction manual of Nanjing Novozymes. The PCR reaction system is:

[0062] 25μL 2×Phanta

[0063] 1 μL dNTP

[0064] 4μL 10uM primer pair

[0065] 4 μL hybridoma cell cDNA

[0066] 1μL DNA polymerase

[0067] 15 μL dd HO

[0068] The total reaction volume was 50 μL. The amplification conditions were: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s; annealing at 56°C for 30 s; extension at 72°C for 2 min. The PCR product was recovered by gel according to the instructions of OMEGA Gel Extraction Kit from OMEGA. After the amplified product was linked to the T vector, the antibody gene sequence was obtained by plasmid sequencing.

[0069] Example 6: Stability evaluation of anti-CD99 monoclonal antibodies

[0070] The purified anti-CD99 monoclonal antibody was placed in -20℃, 4℃ and 37℃ environments with a concentration of 100ng / mL. Samples were taken every 5 days and the changes in its immune reactivity were detected by indirect ELISA. Figure 1 As shown, there was no difference in titer after 5 days of incubation at -20°C (-■-), 4°C (-●-) and 37°C (-▲-). After more than 10 days, the titer stored at 4°C and 37°C began to decrease, while within the 25-day range of the test, the titer stored at -20°C hardly decreased, indicating that the anti-CD99 monoclonal antibody has good stability.

[0071] Example 7: Determination of monoclonal antibody affinity constants

[0072] Coat CD99 protein at a coating concentration of 100 μg / ml, 100 μl / well, coat overnight at 4°C, and wash 3 times with PBS-T. Add 200 μl of blocking solution to each well and block at 37°C for 1 hour, and wash 3 times with PBS-T. The monoclonal antibody purified in Example 4 was diluted to the following concentrations (unit: ng / mL): 2000, 500, 125, 62.5, 31.25, 15.625, 3.125, 0.625, incubate at 37°C for 1 hour, and wash 3 times with PBS-T. HRP-labeled goat anti-mouse secondary antibody was diluted 1:5000, 100 μl per well, incubated at 37°C for 1 hour, and washed 3 times with PBS-T. Add 100 μl of TMB colorimetric solution to each well, color for 13 minutes, and add 100 μl of 1.0N hydrochloric acid solution to terminate the reaction. Use an enzyme marker to measure the absorbance at a wavelength of 450 nm. Draw a curve of OD value corresponding to antibody dilution multiple, find the antibody concentration A corresponding to 1 / 2 "platform OD value", and use the formula (affinity constant ≈ 15000 / A) to calculate the affinity constant to be 6.12×10 9 , indicating good affinity.

[0073] Finally, it should be noted that although the above embodiments have been described in the specification and drawings of this application, this does not limit the scope of patent protection of this application. All technical solutions generated by replacing or modifying equivalent structures or equivalent processes based on the essential concept of this application using the contents recorded in the specification and drawings of this application, as well as directly or indirectly implementing the technical solutions of the above embodiments in other related technical fields, are included in the scope of patent protection of this application.

Claims

1. An anti-CD99 antibody or a functional fragment thereof, characterized in that: The antibody or its functional fragment has the following complementarity determining region, heavy chain complementarity determining region: HCDR1, which comprises or consists of the amino acid sequence shown in SEQ ID NO: 1; HCDR2, which comprises or consists of the amino acid sequence shown in SEQ ID NO: 2; and HCDR3, which comprises or consists of the amino acid sequence shown in SEQ ID NO:3; and light chain complementarity determining region: LCDR1, which comprises or consists of the amino acid sequence shown in SEQ ID NO:4; LCDR2, which comprises or consists of the amino acid sequence shown in SEQ ID NO:5; and LCDR3 comprises or consists of the amino acid sequence shown in SEQ ID NO:

6.

2. The anti-CD99 antibody or functional fragment thereof according to claim 1, characterized in that: The anti-CD99 antibody is a monoclonal antibody.

3. The anti-CD99 antibody or functional fragment thereof according to claim 2, characterized in that: The amino acid sequences of the heavy chain variable region and the light chain variable region of the monoclonal antibody are the amino acid sequences shown in SEQ ID NO.7 and SEQ ID NO.8, respectively.

4. An isolated nucleic acid molecule, characterized in that The nucleic acid molecule is DNA or RNA, which encodes the anti-CD99 antibody or its functional fragment according to any one of claims 1 to 3.

5. A carrier, characterized in that The vector comprises the isolated nucleic acid molecule of claim 4.

6. A host cell, characterized in that The host cell is transformed with the vector according to claim 5.

7. A method for preparing the anti-CD99 antibody or a functional fragment thereof according to any one of claims 1 to 3.

8. A detection reagent, characterized in that The detection reagent comprises the anti-CD99 antibody or a functional fragment thereof according to any one of claims 1 to 3.

9. Use of the anti-CD99 antibody or a functional fragment thereof according to any one of claims 1 to 3 in detecting childhood leukemia.

10. The use according to claim 9, characterized in that The childhood leukemia is childhood acute lymphoblastic leukemia.

Images