Adenylate deaminase mutant and application thereof in preparation of inosine

Abstract

The invention discloses an adenylate deaminase mutant and application of the adenylate deaminase mutant in preparation of inosine. The adenylate deaminase mutant disclosed by the invention can directly catalyze adenosine to obtain inosine, the highest product concentration can reach 120 g / L, and the adenylate deaminase mutant has a wide prospect of large-scale industrial application.

Description

Technical field:

[0001] The invention belongs to the technical field of biocatalysis, and in particular relates to an adenylate deaminase mutant and application thereof in the preparation of inosine. Background technology:

[0002] Inosine, also known as hypoxanthine ribonucleoside, is composed of ribose and hypoxanthine connected by a β-glycosidic bond. Inosine is a component of ATP, coenzyme A, ribonucleic acid and deoxyribonucleic acid in the body, and participates in the body's material metabolism and energy metabolism.

[0003] Inosine has a wide range of uses. In the food industry, inosine is the raw material of 5'-inosinic acid and is also a nutritious flavor enhancer for various seasoning foods (such as monosodium glutamate, soy sauce, etc.). In the pharmaceutical industry, inosine and its derivatives are intermediates for a variety of antiviral drugs, such as ribavirin. In addition, inosine is also used in agriculture, chemical industry, nutrition and health care industries.

[0004] At present, the biosynthesis methods of inosine are mainly divided into two types: microbial fermentation and enzyme catalysis.

[0005] The microorganisms used in the microbial fermentation method mainly include Bacillus subtilis, Bacillus amyloliquefaciens or Bacillus pumilus, etc. The Bacillus subtilis fermentation strain disclosed in patent CN104531670A can produce 72g / L of inosine after 4 days of fermentation, but the strain has a long production cycle, carries many plasmids, and is easy to lose, resulting in unstable production, and is difficult to separate and purify, resulting in a low yield of inosine.

[0006] Enzymatic catalysis mainly uses adenosine as the starting material, which is first phosphorylated under the action of adenosine kinase (ADK) to generate adenylate AMP, then deaminated under the action of adenylate AMP deaminase to form inosinic acid, and finally inosinic acid is hydrolyzed and dephosphated under the catalysis of 5'-nucleotidase to obtain inosine. This route is long and has a low conversion rate. The route is shown in Scheme 1. In 2008, Iribarren et al. tried to use adenosine deaminase (ADA) from Arthrobacter oxydans to directly catalyze the conversion of adenosine into inosine, but the maximum yield was only 37% (Nucleic Acids Symposium Series (2008), 52 (1), 541-542.), which seriously restricted the industrial production of inosine.

[0007]

[0008] Scheme1 Enzyme catalysis route

[0009] Therefore, we need to improve the catalytic efficiency of deaminase through directed evolution, realize the one-step enzymatic synthesis of inosine from adenosine, and promote the speed of industrial application. Summary of the invention:

[0010] The purpose of the present invention is to provide an adenylate deaminase (AMP deaminase) mutant and an inosine preparation method which is simple to operate and easy to industrialize in view of the deficiencies of the prior art.

[0011] The present invention analyzes the structures of adenosine and adenylic acid and finds that the two have only one more phosphate on the hydroxymethyl group, and the rest of the structures are completely identical. Currently, AMP deaminase can catalyze the conversion of adenylic acid into inosinic acid. If AMP deaminase can directly catalyze the deamination of adenosine and avoid the conversion of the phosphate group, the enzyme can have the function of adenosine deaminase, so that the one-step enzymatic conversion of adenosine to inosine can be achieved.

[0012] Therefore, in view of the properties of existing AMP deaminase, the present invention provides a new AMP deaminase mutant and realizes the one-step enzymatic synthesis of inosine from adenosine.

[0013] On the one hand, the present invention provides a novel AMP deaminase mutant, which is obtained by site mutation using the wild-type AMP deaminase shown in SEQ ID NO.1 as a template.

[0014] Furthermore, the wild-type AMP deaminase is derived from Arabidopsis Thaliana, with NCBI accession number 2A3L_A, and the amino acid sequence and nucleotide sequence are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively.

[0015] Furthermore, the wild-type AMP deaminase can only catalyze adenylic acid to inosinic acid, but cannot catalyze adenosine to inosine.

[0016] Furthermore, the AMP deaminase crystal structure was molecularly docked with coformycin 5'-Phosphate, where the amino acids that interact with the phosphate group are Q602 and K324, see Figure 1 .

[0017] Furthermore, Q602 of the wild-type AMP deaminase was mutated to alanine to obtain the AMP deaminase mutant Mut1 (Q602A).

[0018] Furthermore, Q602 of the wild-type AMP deaminase was mutated to phenylalanine (Phe), and K324 was mutated to leucine (Leu) to obtain the AMP deaminase mutant Mut2 (K324L / Q602F).

[0019] Furthermore, the amino acid sequence and nucleotide sequence of the AMP deaminase mutant Mut2 are shown in SEQ ID NO.3 and SEQ ID NO.4, respectively.

[0020] Furthermore, the adenylate deaminase mutant is expressed in genetically engineered bacteria.

[0021] Furthermore, the adenylate deaminase mutant expression strain is selected from Escherichia coli, yeast, Streptomyces or Bacillus subtilis, preferably Escherichia coli.

[0022] In another aspect, the present invention provides a method for preparing inosine using an AMP deaminase mutant, wherein adenosine is used as a substrate and converted into inosine under the catalytic action of the AMP deaminase mutant.

[0023] Furthermore, the AMP deaminase mutant is selected from AMP deaminase mutant cells, AMP deaminase mutant enzyme powder, immobilized AMP deaminase mutant or various solid or liquid preparations of AMP deaminase mutants, preferably AMP deaminase mutant cells.

[0024] Furthermore, a buffer needs to be added in the reaction, and the buffer is selected from phosphate, Tris-HCl, triethanolamine buffer, preferably phosphate buffer.

[0025] Furthermore, the substrate concentration is 10-210 g / L, preferably 130 g / L.

[0026] Furthermore, the reaction needs to be controlled at a pH of 6.0 to 9.0, preferably at a pH of 8.0.

[0027] Furthermore, the reaction temperature is 30°C to 45°C, preferably 40°C.

[0028] The beneficial effect of the present invention is that the present invention discloses an adenylate deaminase mutant, which is obtained by modification on the basis of the wild type. The mutant can catalyze the conversion of adenosine into inosine in vitro, and the product concentration can reach up to 120g / L, thereby realizing the application of enzymatic preparation of inosine in industry. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 Complex structure of wild-type adenylate deaminase and coformycin 5'-Phosphate

[0030] Figure 2 Electrophoresis of nucleic acid in Example 1

[0031] Figure 3 Expression diagram of wild-type protein in Example 2

[0032] Figure 4Example 4 Full plasmid amplification results

[0033] Figure 5 Example 6 HPLC analysis of the catalytic products of mutant MAT2 DETAILED DESCRIPTION

[0034] The technical content of the present invention is further described below in conjunction with specific embodiments, the purpose of which is to provide a better understanding of the content of the present invention, but the protection scope of the present invention is not limited thereto.

[0035] Example 1 In vitro expression of AMP deaminase in Escherichia coli

[0036] The gene sequence of AMP Deaminase from Arabidopsis thaliana was mined from the NCBI database. The PDB number of the enzyme is 2A3L. The pET28a-amda recombinant plasmid containing NdeI and XbaI restriction sites was obtained by gene sequence total synthesis technology. The nucleotide sequence is shown in SEQ ID NO.1. The recombinant plasmid was transferred into BL21 (DE3) competent cells by transfection competent cells. + Single clones were screened on the resistance plate and were found to be of the same size after gene amplification and identification. The nucleic acid electrophoresis diagram is shown in Figure 2 .

[0037] Example 2 Heterologous expression of wild-type AMP deaminase

[0038] The monoclonal colony picked from the resistance plate was transferred to a test tube containing LB and cultured at 37°C. After culturing for 16 hours, 2 mL was transferred to 2YT medium and cultured at 37°C with shaking for 4-6 hours. When the OD 600 When the absorbance value reached 0.5, the temperature was lowered to 25°C and 0.5 mM IPTG was added to induce expression for 12 hours. The bacteria were then ultrasonically disrupted and the solution after ultrasonication was divided into a supernatant and a precipitate for electrophoresis analysis. The results were as follows: Figure 3 As shown, most of the protein was expressed in a soluble form, with a small amount of inclusion bodies in the precipitate.

[0039] Example 3 Rational evolution design of wild-type AMP deaminase

[0040] According to the interaction between the kinase activity pocket of the protein and the product, the site Q602 was first mutated to the hydrophobic amino acid alanine A. The design sequence information of the specific primers is shown in Table 1.

[0041] Table 1 Primer design for rational evolution

[0042] Primer name Sequence information Q602A-F CTACTGATGACCCCCTTGCCATTCACTTAACTAAAGAAC Q602A-R TTAGTTAAGTGAATGGCAAGGGGGTCATCAGTAGACAGAG

[0043] The mutant gene can be effectively amplified by the primers in the table, and the mutant is determined to be the AMP deaminase mutant Mut1 (Q602A) after sequencing. The mutant Mut1 was transferred to a shake flask for expression, and the protein expression was consistent with the wild-type WT by electrophoresis test. The mutant Mut1 cells and wild-type WT cells were then tested for adenosine and adenylate substrates, respectively, and the reaction conditions are shown in Table 2.

[0044] Table 2 Reaction system of mutant Mut1 and wild type WT

[0045]

[0046] The reaction was carried out in a water bath at 37°C and the pH was adjusted to 7.0. After 16 hours of reaction, HPLC analysis was performed, and the results after the reaction are shown in Table 3. It can be clearly seen from the data table after the reaction that the modified mutant Mut1 can change the substrate selectivity, so that AMP deaminase loses its catalytic effect on AMP and has a catalytic effect on adenosine, while WT has a high catalytic activity only for AMP but has no effect on adenosine.

[0047] Table 3 Catalytic data of mutant Mut1 and wild type WT

[0048] sample Substrate Adenylate Residue Substrate adenosine residue Inosinic acid concentration Inosine concentration 1# Reaction / 10g / L / 0 2# Reaction / 3.5g / L / 4.2g / L 3# Reaction 0.5g / L / 8.6g / L / 4# Reaction 9.7g / L / 0 /

[0049] Example 4 Semi-rational evolution design of wild-type AMP deaminase

[0050] In order to further improve the activity of AMP deaminase in catalyzing adenosine, with the help of substrate docking structure, saturation mutation library screening was performed on two sites Q602 and K324 that interact with phosphate groups, and saturation mutation primers were designed using Primer software as shown in Table 4.

[0051] Table 4 Primer design for rational evolution

[0052] name Sequence (5'~3') 602X-F GATGACCCCCTTNNNKATTCACTTAACTAAAGA 602X-R TAAGTGAATMNNAAGGGGGTCA TCAGTAGA 324X-F CTTTCATCGTTTTGATNNKTTCAACCTAAAGTATAACCC 324X-R ACTTAGGTTGAAMNNATCAAAACGATGAAAGGTA

[0053] The whole plasmid was amplified under the action of high-fidelity polymerase, and the product after amplification was analyzed by nucleic acid electrophoresis. The results are shown in Figure 4 Then, the plasmid template in the amplification system was digested with DpnI restriction endonuclease and directly transferred into BL21 (DE3) competent cells. After inverted culture at 37°C, mutant cells were obtained.

[0054] Example 5 Screening of the best mutants

[0055] The monoclonal cells obtained after saturation mutation were picked and cultured in 96-well plates, each well of which contained 100uL of LB medium. After culturing at 37°C for 5h, 50ul / well of seed solution was transferred to 96 deep-well plates for culture, each well of which contained 1mL of 2YT medium. After culturing at 37°C for 5h, 10uL of IPTG was transferred to each well for induction culture at 25°C. After induction overnight, the cells were collected by centrifugation at 4000rpm for 30min for reaction screening.

[0056] The reaction was carried out in a deep 96-well plate, and adenosine was added to each well. The reaction system was in 500uL, and after shaking at 37°C for 16h, the reaction solution was analyzed by TLC spot plate analysis, and the positive mutants were determined based on the reduction of adenosine. By similar methods, superposition screening of other sites was performed, and finally a mutant Mut2 (K324L / Q602F) with significantly improved catalytic efficiency and product concentration was obtained. Sequencing revealed that there were two more mutations in the wild type, namely Q602 mutated to phenylalanine and K324 mutated to leucine. The amino acid sequence of the mutant Mut2 is shown in SEQ ID NO.3.

[0057] Example 6 Catalysis of 50 g / L substrate by wild-type WT and mutant Mut2

[0058] Adenosine solid powder, purified water, and PBS buffer (1M, pH 7.0) were added to two reactors, respectively, and finally wild-type WT cells and mutant Mut2 cells were added. The reaction conditions are shown in Table 5. The temperature was controlled at 37°C and stirred for reaction. The pH was not controlled during the reaction. After 3 hours of reaction, samples were taken for HPLC analysis. No product was generated in the WT reaction system, and the substrate in the mutant Mut2 reaction system basically disappeared. The HPLC analysis spectrum is shown in Figure 5 shown.

[0059] Table 5 Reaction system of mutant Mut2 and wild type WT

[0060]

[0061]

[0062] Example 7 Optimization of reaction conditions - selection of temperature and pH

[0063] In order to optimize the effect of parameters on product synthesis during the conversion process, the induction temperature and pH of the mutant Mut2 fermentation process were optimized, and the temperature was set in the range of 30-45°C, and the initial pH value was 8.0. When optimizing the pH, the pH was set between 6.0 and 9.0, the temperature was controlled at 40°C, and the reaction was performed for 4 hours. After the same induction process, the synthesized product was finally analyzed. The specific data are shown in Table 6 below. The reaction results show that the conversion effect is better when the temperature and pH are 40°C and 8.0, respectively, with a conversion rate of 99.3% and an inosine concentration of 45.9 g / L.

[0064] Table 6 Optimization results at different temperatures and pH values

[0065] Parameter gradient Conversion rate Inosine concentration (g / L) 45℃, pH=8.0 89.2％ 30.4 40℃, pH=8.0 99.3％ 45.9 35℃, pH=8.0 97.5％ 41.3 30℃, pH=8.0 87.4％ 38.6 40℃, pH=6.0 87.5％ 34.7 40℃, pH=7.0 96.3％ 41.6 40℃, pH=8.0 99.3％ 45.9 40℃, pH=9.0 97.4％ 40.3

[0066] Example 8 Optimization of reaction conditions - increasing substrate concentration

[0067] In order to optimize the effect of parameters on product synthesis during fermentation, the substrate concentration of the mutant Mut2 during fermentation was optimized, and the substrate concentration was set between 50 and 210 g / L. After the same induction process, the synthesized products were finally analyzed. The specific data are shown in Table 7 below. The reaction results showed that when the substrate concentration was <130 g / L, the conversion rate was not much different from that at 50 g / L, while when the substrate concentration was >130 g / L, the conversion rate decreased significantly. Therefore, the optimal substrate concentration was 130 g / L, the conversion rate was 98.18%, and the product inosine concentration was 120 g / L.

[0068] Table 7 Optimization results of different substrate concentrations

[0069] Parameter gradient Conversion rate Inosine concentration (g / L) 50g / L 98.54％ 46 90g / L 98.43％ 83 130g / L 98.18％ 120 170g / L 90.52％ 141 210g / L 82.27％ 147

Claims

1. An adenylate deaminase mutant, characterized in that: The amino acid sequence of the adenylate deaminase mutant is compared with the wild-type adenylate deaminase with an amino acid sequence as shown in SEQ ID NO: 1, and a single point or multiple point combined mutation is performed at any one or more sites in the 324th and 602nd positions of the amino acid sequence shown in SEQ ID NO:

2.

2. The adenylate deaminase mutant according to claim 1, characterized in that The amino acid sequence of the adenylate deaminase mutant is shown in SEQ ID NO.

3.

3. The adenylate deaminase mutant according to claim 1, characterized in that The nucleotide sequence of the adenylate deaminase mutant is shown in SEQ ID NO.

4.

4. The adenylate deaminase mutant according to claim 1, characterized in that The adenylate deaminase mutant is expressed in genetically engineered bacteria.

5. The adenylate deaminase mutant according to claim 1, characterized in that The adenylate deaminase mutant expression strain is selected from Escherichia coli, yeast, Streptomyces or Bacillus subtilis.

6. A method for preparing inosine, characterized in that: The method uses adenosine as a substrate and obtains inosine through the catalysis of adenylate deaminase, wherein the adenylate deaminase is selected from the adenylate deaminase mutant described in claim 1.

Images