Application of ABC transporter family gene OsABCA3 in plant breeding regulation
By knocking out the ABC transporter gene OsABCA3 in rice, the problem of cadmium absorption and accumulation in rice was solved, the Cd content in grains was reduced, the tolerance of rice to Cd was enhanced, and the yield and nutritional quality of rice were guaranteed.
Patent Information
- Application Number
- CN202411586538.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-08
- Publication Date
- 2025-11-25
- Estimated Expiration
- 2044-11-08
AI Technical Summary
In the current technology, the absorption, translocation and accumulation mechanism of heavy metal cadmium (Cd) pollution in rice has not been fully studied, which leads to the accumulation of Cd in edible parts, posing a threat to food safety and human health, and there is a lack of effective gene regulation methods.
By knocking out the ABC transporter family gene OsABCA3 in rice, a knockout vector targeting the OsABCA3 gene was constructed using CRISPR/Cas9 technology. This specific knockout of the OsABCA3 gene improved rice's tolerance to Cd and reduced the Cd content in the grains.
It significantly reduces the Cd content in rice grains while maintaining a balance between rice yield and essential metal elements, providing breeding resources for low-Cd-accumulating rice varieties and mitigating the threat of Cd pollution to food safety and health.
Smart Images

Figure CN119530276B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of plant genetic engineering, in particular to the ABC transporter family gene OsABCA3 In the application of plant breeding regulation. BACKGROUND
[0002] With the accelerated urbanization, farmland has been seriously polluted by heavy metals, especially cadmium (Cd) pollution, which has become an important problem that needs to be solved for the sustainable development of agriculture. Cd is a highly toxic, non-essential heavy metal element for plants and humans, and is recognized as a class I human carcinogen by the International Agency for Research on Cancer (IARC). Industrial waste deposition, irrigation of mining and smelting wastewater, emission of automobile exhaust, and modern process technologies such as waste and crop straw burning are some of the main sources of Cd pollution. In addition, during the process of agricultural production, excessive use of Cd-containing chemical fertilizers and organic fertilizers also cause serious pollution to the environment. In addition, the waste gas containing Cd in the atmosphere seeps into farmland with rainwater, which further aggravates the heavy metal pollution of the soil. These pollution sources lead to the enrichment of Cd in farmland soil, which poses a great risk to farmland ecosystems and food safety.
[0003] After the plant absorbs Cd from the soil by the root system, Cd will be transported to the aboveground part of the plant, especially the edible part of cereal crops. Compared with other heavy metals, Cd is more likely to enter the food chain from the soil, causing great harm to food and human health. Excessive accumulation of Cd in plants can interfere with the nutrient balance of plants, cause damage to proteins, DNA, and cell membranes, and induce the accumulation of toxic reactive oxygen species, thereby adversely affecting the growth and yield of crops. Rice, as the most important food crop, is the main food for more than 60% of the population, and its production safety is highly valued. Studies have shown that rice is more likely to absorb Cd than other cereal crops, so rice has become the main way for people to intake Cd, with a contribution rate of up to 56%, and for people who like to eat rice, the contribution rate is increased to 65%. Therefore, studying the absorption, transport and accumulation mechanism of Cd in rice and exploring the related regulatory genes are of great significance for the cultivation of low-Cd accumulation rice varieties, food safety and human health.
[0004] ABC transporters are a large and conserved protein family that play important roles in plants. In the biological world, the ABC protein family currently known includes eight subfamilies from ABCA to ABCI, and the ABCH subfamily is absent in plants. ABC transporters usually contain two characteristic domains, namely the trans-membrane domain (TMD) and the nucleotide binding domain (NBD), which work together to drive the transport of various substrates on the biological membrane through the energy released by ATP hydrolysis. These substrates include small inorganic or organic molecules such as amino acids, sugars, nucleosides, vitamins and metal ions, and large organic compounds such as peptides, lipid molecules, oligonucleotides and polysaccharides; ABC proteins regulate the transmembrane transport of substrates, regulate key physiological processes such as hormone and lipid metabolism, stomatal opening and closing, and metal ion transport in plants, thereby improving their ability to cope with various biological or non-biological stresses and enabling plants to adapt to changing environments.
[0005] However, the specific genes of the ABC transporter family in plants and how to use the ABC transporter family genes to avoid Cd accumulation in plants, especially in edible parts, still need further research. SUMMARY
[0006] The purpose of the present application is to overcome the shortcomings and deficiencies of the prior art, and to provide an ABC transporter family gene OsABCA3 for use in plant breeding regulation.
[0007] The purpose of the present application is achieved by the following technical solutions:
[0008] ABC transporter family gene OsABCA3 for use in plant breeding regulation, wherein the ABC transporter family gene OsABCA3 codes for a protein with an amino acid sequence as shown in SEQ ID No: 2.
[0009] Further, the ABC transporter family gene OsABCA3 has a nucleotide sequence as shown in SEQ ID No: 1.
[0010] Further, the plant breeding regulation refers to knocking out the ABC transporter family gene OsABCA3 in plants to improve the tolerance of plants to Cd, increase the biomass of plants, and reduce the Cd content in plant grains.
[0011] Further, the plant is a plant of the family Poaceae; more specifically, it is at least one of wheat, corn and rice; and more specifically, it is rice.
[0012] The ABC transporter family gene OsABCA3 application in improving plant tolerance to Cd and / or preparing / cultivating grain Cd low-accumulation plant varieties.
[0013] Further, the plant is a plant in the family Poaceae; more further, at least one of wheat, corn and rice; still more further, rice.
[0014] The ABC transporter family gene OsABCA3 application of the knockout vector in improving plant tolerance to Cd and / or preparing / cultivating grain Cd low-accumulation plant varieties.
[0015] Further, the ABC transporter family gene OsABCA3 The knockout vector is directed to OsABCA3 two target sites of the gene; the two target sites are U3 and U6a ;
[0016] The target site of the gRNA vector is U3 The target site primer is:
[0017] Forward primer: 5'- GGCAGCAAGAACGCCACGCTCACC -3'; and
[0018] Reverse primer: 5'- AAACGGTGAGCGTGGCGTTCTTGC -3';
[0019] The target site of the gRNA vector is U6a The target site amplification primer of the gRNA vector is:
[0020] Forward primer: 5'- GCCGCGAACTCCACTCCGGTAGCT -3'; and
[0021] Reverse primer: 5'- AAACAGCTACCGGAGTGGAGTTCG -3'.
[0022] Further, the plant is a plant in the family Poaceae; more further, at least one of wheat, corn and rice; still more further, rice.
[0023] A method for enhancing plant tolerance to Cd and / or reducing Cd content in plant grain, comprising the step of knocking out the ABC transporter family gene OsABCA3 application in improving plant tolerance to Cd and / or preparing / cultivating grain Cd low-accumulation plant varieties.
[0024] Further, the plant is a plant in the family Poaceae; more further, at least one of wheat, corn and rice; still more further, rice.
[0025] The present application has the following advantages and effects relative to the prior art:
[0026] (1) The present application knocks out ABC transporter family genes OsABCA3 In rice, the knockout makes the Cd content in the grains of the knockout lines significantly lower than that of the wild type under Cd stress. OsABCA3 The growth of the knockout lines is significantly better than that of the wild type, and the Cd content in the grains of the knockout lines is significantly lower than that of the wild type. At the same time, the knockout lines do not have obvious adverse effects on the yield-related traits and the content of essential metal elements of rice. OsABCA3 It can be used as a potential candidate gene for breeding rice varieties with low Cd accumulation to reduce the threat of Cd pollution to food safety and human health, and also provides a potential remediation method for Cd pollution of rice.
[0027] (2) The present application knocks out OsABCA3 , which can effectively improve the tolerance of rice to Cd and reduce the Cd content in the grains of rice, providing a candidate gene resource for low-Cd molecular breeding of rice and Cd pollution remediation. BRIEF DESCRIPTION OF DRAWINGS
[0028] Figure 1 The present application knocks out ABC transporter family genes OsABCA3 Gene information map; wherein the blank rectangle and the black line part in the middle are 5' untranslated region (untranslated region, UTR), the blank pentagon represents 3' UTR, the black rectangle represents exon (exon), and the black line is intron (intron). The double-headed arrow below the figure represents the coding sequence (coding sequence, CDS) region of the gene.
[0029] Figure 2 The present application knocks out ABC transporter family genes
[0030] Figure 3 The present application knocks out ABC transporter family genes (a) is a subcellular localization result map in rice protoplast; (b) is a subcellular localization result map in tobacco mesophyll cells. The excitation wavelength and observation wavelength of GFP observation are 488 nm and 507 nm, respectively, and green fluorescence is observed; the excitation wavelength and emission wavelength of membrane marker protein OsRac3-Mcherry are 587 nm and 610 nm, respectively, and red fluorescence is observed; wherein the scale of the OsABCA3 subcellular localization map is 130 μm.
[0031] Figure 4 The present application knocks out ABC transporter family genes OsABCA3Figure of relative expression under different concentrations of Cd (0, 1, 10, 100 μM CdCl2) treatment, 3 independent biological replicates; t P < 0.05; * represents P <0.01. P <0.01.
[0032] Figure 5 Figure of relative expression of rice ABC transporter family gene OsABCA3 Figure of relative expression under different time of cultivation at a final concentration of 10 μM CdCl2, 3 independent biological replicates; t P < 0.05; * represents P <0.01. P <0.01.
[0033] Figure 6 Figure of relative expression of rice ABC transporter family gene OsABCA3 Figure of relative expression under different metal element treatment (100 μM), CK is blank control, rice Actin1 gene ( Os10g0510000 ) is used as internal reference gene, 3 independent biological replicates; t P < 0.05; * represents P <0.01.
[0034] Figure 7 Figure of relative expression of rice ABC transporter family gene OsABCA3 Figure of relative expression in different growth periods and different tissue parts of rice, rice Actin1 gene ( Os10g0510000 ) is used as internal reference gene, 3 independent biological replicates.
[0035] Figure 8 Figure of overexpression vector and knockout vector of the gene, (a) is the map of rice gene overexpression vector pOX (containing 5x flag tag); (b) is the map of CRISPR / gRNA intermediate vector; (c) is the map of pYLCRISPR / Cas9-MH binary expression vector.
[0036] <0.01. Figure 9 Figure of phenotype observation and growth trait statistics of OsABCA3 gene overexpression strain ( OE-A3-1 , OE-A3-2 ), knockout strain ( cas-a3-1 , cas-a3- 2 ), and wild type (ZH11); (a) is the phenotype of the rice plants under the conditions of water culture without Cd, with 10 μM CdCl2 and 100 μM CdCl2 for 7 days,OsABCA3 Overexpression lines ( OE-A3-1 , OE-A3-2 ), knockout strains ( cas-a3-1 , cas-a3-2 Phenotypic observation results of (a) and wild type (ZH11), scale bar is 5 cm; (b) shows the results after 7 days of culture with Cd (100 μM CdCl2; +Cd) or without Cd (-Cd). OsABCA3 Overexpression lines ( OE-A3-1 , OE-A3-2 ), knockout strains ( cas-a3-1 , cas-a3-2 (c) Statistical results of plant height of the wild type (ZH11) and the wild type (ZH11); (c) shows the plant height after 7 days of cultivation with Cd (100 μM CdCl2; +Cd) or without Cd (-Cd). OsABCA3 Overexpression lines ( OE-A3-1 , OE-A3-2 ), knockout strains ( cas-a3-1 , cas-a3-2 The fresh weight statistics of the wild type (ZH11) and the wild type (ZH11) were obtained; (d) shows the results after 7 days of culture with Cd (100 μM CdCl2; +Cd) or without Cd (-Cd). OsABCA3 Overexpression lines ( OE-A3-1 , OE-A3-2 ), knockout strains ( cas-a3- 1 , cas-a3-2 The dry weight statistics of the wild type (ZH11) and wild type (ZH11) were obtained; the experiment was a 3-time independent biological replicate. t Test; * represents P <0.05.
[0037] Figure 10 After culturing in a Cd-containing solution with a final concentration of 100 μM for 7 days, OsABCA3 Gene overexpression lines ( OE- A3-1 , OE-A3-2 ), knockout strains ( cas-a3-1 , cas-a3-2 The results of Cd content testing in wild-type rice (ZH11) are shown in Figure 1; (a) shows the Cd content determination results in the aboveground parts and roots, and (b) shows the Cd content determination results in the xylem sap. The experiment consisted of three independent biological replicates. t Test, * represents P <0.05, ** indicates P <0.01.
[0038] Figure 11 Cultivation experiment in Cd-contaminated soil OsABCA3 Gene overexpression lines ( OE-A3-1 , OE-A3-2), knock-out lines ( cas-a3-1 , cas-a3-2 ) and wild type (ZH11); (a) is the phenotype observation result of the overexpression lines of the gene ( OsABCA3 OE-A3-1 , OE-A3-2 ), knock-out lines ( cas-a3-1 , cas-a3-2 ) and wild type (ZH11) in the Cd contaminated soil cultivation experiment, the scale is 20 cm; (b-e) are the results of the plant height (b), effective tiller number (c), seed setting rate (d) and yield per plant (e) of the overexpression lines of the gene ( OsABCA3 OE-A3-1 , OE-A3-2 ), knock-out lines ( cas-a3-1 , cas-a3-2 ) and wild type (ZH11) at the mature stage in the Cd contaminated soil cultivation experiment; 3 independent biological repeats; t tests; * represents P <0.05, ** represents P <0.01.
[0039] Figure 12 The analysis results of the Cd content and the essential metal element content in the grains of the overexpression lines of the gene ( OsABCA3 OE-A3-1 , OE-A3-2 ), knock-out lines ( cas-a3-1 , cas-a3-2 ) and wild type rice (ZH11) in the Cd contaminated soil cultivation experiment; (a) is the analysis result of the Cd content, (b) is the analysis result of the essential metal element content; 3 independent biological repeats; t tests; * represents P <0.05; ** represents P <0.01. DETAILED DESCRIPTION
[0040] The application will be described in further detail below with reference to the embodiments and the accompanying drawings, but the embodiments of the application are not limited thereto.
[0041] Unless otherwise specified, the experimental methods used in the following examples are generally performed under standard experimental conditions or as recommended by the manufacturer. Unless otherwise specified, the vectors (including gene knockout vectors, overexpression vectors, and subcellular localization vectors) mentioned in the examples were constructed according to standard procedures in the field of genetic engineering. The pCAMBIA-1300 backbone vector sequence, promoter elements (including 35S and Ubi), reporter genes (including GFP), and other sequences used are all publicly available sequences in the field of genetic engineering on relevant websites or databases (https: / / cambia.org and https: / / www.ncbi.nlm.nih.gov); pCAMBIA35s-eGFP can be obtained through conventional commercial channels. Unless otherwise specified, the materials and reagents used are commercially available. All chemical reagents used in the examples are imported or domestically produced analytical grade.
[0042] The pOx vector was provided by Academician Liu Yaoguang of the State Key Laboratory of Subtropical Agricultural Bioresources Conservation and Utilization, South China Agricultural University. The pOx vector has been used in the study "Li YH, Yang YQ, Liu Y, Li CX, Zhao YH, Li ZJ, Liu Y, Jiang DG, Li J, Zhou H, Chen JH, Zhuang CX, Liu ZL. Overexpression of..." OsAGO1b induces adaxially rolled leaves by affecting leaf abaxialsclerenchymatous cell development in rice. Rice (NY), 2019, 12(1): 60. " published in the article.
[0043] pYLCRISPR / Cas9-MH and CRISPR / gRNA vectors were provided by Academician Liu Yaoguang of the State Key Laboratory of Subtropical Agricultural Bioresources Conservation and Utilization, Nanjing Agricultural University. pYLCRISPR / Cas9-MH and CRISPR / gRNA have been published in the article “Zeng Dongchang, Ma Xingliang, Xie Xianrong, Zhu Qinlong, Liu Yaoguang. Operational methods for construction and mutation analysis of plant CRISPR / Cas9 multi-gene editing vectors. Science in China: Life Sciences. 2018, 48(7): 783-794. doi: 10.1360 / N052018-00069.”
[0044] Unless otherwise specified, the rice used in the examples is wild-type Zhonghua 11 rice, which is commercially available.
[0045] Example 1
[0046] (1) Rice ABC transporter family genes OsABCA3 Structure
[0047] OsABCA3 The search number in the GenBank database (https: / / www.ncbi.nlm.nih.gov) is Os08g0398000. This gene is located on chromosome 8 of rice, and its DNA length is 6144 bp (SEQ ID No:1), containing 17 exons and 16 introns (e.g., ...). Figure 1 (As shown); the predicted amino acid sequence length of the encoded protein is 968 amino acids (SEQ ID No: 2). OsABCA3 The mRNA length of the gene is 3229 bp, and the CDS length is 2907 bp (SEQ ID No: 3).
[0048] (2) Subcellular localization analysis of OsABCA3, a member of the rice ABC transporter family
[0049] Following standard procedures in the field of genetic engineering, green fluorescent protein (GFP) was fused to the C-terminus of the OsABCA3 protein, i.e. OsABCA3 The gene was inserted into the protein subcellular localization GFP empty vector (pCAMBIA35s-eGFP) containing the 35S promoter, which was stored in our laboratory (see schematic diagram of pCAMBIA35s-eGFP). Figure 2 The 35S promoter in the vector (shown) is used to generate a transient expression recombinant vector driven by the 35S promoter, which is then connected to eGFP. p35S::OsABCA3-GFP ), transforming rice protoplasts and tobacco. Additionally, GFP empty vector ( p35S::GFP ; namely pCAMBIA35s-eGFP, cell membrane fluorescent labeling protein carrier ( p35S::OsRac3-Mcherry As a control, fluorescence localization was observed. Results showed that, regardless of whether it was rice or tobacco, the transfer... OsABCA3 In cells with the fusion expression vector, the green fluorescence of GFP was mainly distributed in the cell membrane and cytoplasm; while the green fluorescence signal emitted by the GFP empty vector control was distributed throughout the entire cell (results are shown in Figure 1). Figure 3 (As shown).
[0050] (3) OsABCA3 qRT-PCR analysis of gene responses to Cd stress, other metal stresses, and hormone treatment
[0051] Rice seedlings of Zhonghua 11 (ZH11) were cultured in a phytotron with Kimura B nutrient solution changed every 3 days, under conditions of 12 h light at 28℃, 12 h darkness at 25℃, and 60% relative humidity. The 30-day-old seedlings were treated with Cd (CdCl2 was added to the Kimura B nutrient solution to give a final concentration of 0, 1, 10, or 100 µM CdCl2, and cultured for 1 day; in the same way, the seedlings were treated with 10 µM CdCl2 for 0, 3, 6, 9, 12, 24, 48, 60, or 72 h; in the same way, the seedlings were treated with 100 µM MnSO4, AlCl3·6H2O, MgSO4, ZnSO4, or FeSO4 for 1 day;
[0052] The aboveground and root parts were selected as the materials, and the RNA of the rice tissues was extracted using the Trizol reagent of Genstar (China) according to the operation manual of the reagent company. The cDNA was obtained by reverse transcription using the StarScript Ⅲ All-in-one kit of Genstar (China), and the expression amount of the gene in the aboveground and root parts of the rice was detected by qRT-PCR using the Realstar Fast SYBR qPCR Mix kit of Genstar (China). OsABCA3 The forward primer for qRT-PCR detection was 5’- AGACGAACTCCACTCCGGTA -3’, and the reverse primer was 5’-TGAGCGAACTCCTTGAACCC -3’. The reaction program for qRT-PCR was as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 10 s, 60℃ annealing for 10 s, 72℃ extension for 30 s / kb, for 35 cycles; 72℃, 5 min. In addition, OsABCA3 The qRT-PCR detection reaction of the gene used rice Actin1 ( Os10g0510000 ) as the internal reference gene, and the primers used were 5’-AGACGAACTCCACTCCGGTA -3’ (forward primer) and 5’-TGAGCGAACTCCTTGAACCC -3’ (reverse primer).
[0053] The results showed that, whether in the root or the aboveground part of the seedlings, after the seedlings were cultured in different concentrations (0, 1, 10, or 100 µM) of CdCl2 solution for 1 day, the relative expression amount of the gene in the aboveground and root parts of the seedlings showed an upward trend with increasing Cd concentration, indicating that OsABCA3 the gene had a significant response to Cd stress and had a concentration-dependent effect (e.g. OsABCA3 Figure 4 The results showed that the expression levels of OsHMA2 and OsHMA3 in the shoots and roots of rice seedlings grown in hydroponics for 30 d were generally higher than those in the control (0 h) after Cd (10 µM) treatment for different times. In the shoots, the expression levels reached the highest peak after 24 h of Cd treatment, while in the roots, the expression levels reached the highest peak after 3 h of Cd treatment (as shown in FIG. 2). OsABCA3 The results showed that the expression levels of OsHMA2 and OsHMA3 in the shoots and roots of rice seedlings grown in hydroponics for 30 d were generally higher than those in the control (0 h) after Cd (10 µM) treatment for different times. In the shoots, the expression levels reached the highest peak after 24 h of Cd treatment, while in the roots, the expression levels reached the highest peak after 3 h of Cd treatment (as shown in FIG. 2). Figure 5 The results showed that the expression levels of OsHMA2 and OsHMA3 in the shoots and roots of rice seedlings grown in hydroponics for 30 d were generally higher than those in the control (0 h) after Cd (10 µM) treatment for different times. In the shoots, the expression levels reached the highest peak after 24 h of Cd treatment, while in the roots, the expression levels reached the highest peak after 3 h of Cd treatment (as shown in FIG. 2).
[0054] The results showed that the expression levels of OsHMA2 and OsHMA3 in the shoots and roots of rice seedlings grown in hydroponics for 30 d were generally higher than those in the control (0 h) after Cd (10 µM) treatment for different times. In the shoots, the expression levels reached the highest peak after 24 h of Cd treatment, while in the roots, the expression levels reached the highest peak after 3 h of Cd treatment (as shown in FIG. 2). OsABCA3 The results showed that the expression levels of OsHMA2 and OsHMA3 in the shoots and roots of rice seedlings grown in hydroponics for 30 d were generally higher than those in the control (0 h) after Cd (10 µM) treatment for different times. In the shoots, the expression levels reached the highest peak after 24 h of Cd treatment, while in the roots, the expression levels reached the highest peak after 3 h of Cd treatment (as shown in FIG. 2). OsABCA3 The results showed that the expression levels of OsHMA2 and OsHMA3 in the shoots and roots of rice seedlings grown in hydroponics for 30 d were generally higher than those in the control (0 h) after Cd (10 µM) treatment for different times. In the shoots, the expression levels reached the highest peak after 24 h of Cd treatment, while in the roots, the expression levels reached the highest peak after 3 h of Cd treatment (as shown in FIG. 2). Figure 6 The results showed that the expression levels of OsHMA2 and OsHMA3 in the shoots and roots of rice seedlings grown in hydroponics for 30 d were generally higher than those in the control (0 h) after Cd (10 µM) treatment for different times. In the shoots, the expression levels reached the highest peak after 24 h of Cd treatment, while in the roots, the expression levels reached the highest peak after 3 h of Cd treatment (as shown in FIG. 2). OsABCA3 The results showed that the expression levels of OsHMA2 and OsHMA3 in the shoots and roots of rice seedlings grown in hydroponics for 30 d were generally higher than those in the control (0 h) after Cd (10 µM) treatment for different times. In the shoots, the expression levels reached the highest peak after 24 h of Cd treatment, while in the roots, the expression levels reached the highest peak after 3 h of Cd treatment (as shown in FIG. 2). OsABCA3 The results showed that the expression levels of OsHMA2 and OsHMA3 in the shoots and roots of rice seedlings grown in hydroponics for 30 d were generally higher than those in the control (0 h) after Cd (10 µM) treatment for different times. In the shoots, the expression levels reached the highest peak after 24 h of Cd treatment, while in the roots, the expression levels reached the highest peak after 3 h of Cd treatment (as shown in FIG. 2).
[0055] (4) OsABCA3 Analysis of the spatiotemporal expression pattern of OsHMA2 and OsHMA3 in rice
[0056] The rice seedlings of Zhonghua 11 (ZH11) were cultured in a phytotron, and the Kimura B nutrient solution was replaced every 3 d. The conditions were set as 12 h light at 28°C, 12 h darkness at 25°C, and a relative humidity of 60%. The samples were taken at different stages (seedling stage, tillering stage, heading stage, and mature stage) and different parts (roots, shoots, stems, leaves, etc.) of the wild-type rice ZH11.
[0057] The RNA of the rice tissues was extracted using the Trizol reagent of Genstar (China) according to the conventional methods in the field of genetic engineering and the operation manual of the reagent company. The cDNA was obtained by reverse transcription using the StarScript III All-in-one kit of Genstar (China). The expression levels of OsHMA2 and OsHMA3 in the materials of different parts were quantitatively detected using the Realstar Fast SYBR qPCR Mix kit of Genstar (China). OsABCA3The expression level of OsHMA3 was detected by qRT-PCR. The forward primer for qRT-PCR was 5'- AGACGAACTCCACTCCGGTA -3', and the reverse primer was 5'- TGAGCGAACTCCTTGAACCC -3'. The reaction procedure of qRT-PCR was as follows: 95 °C pre-denaturation for 3 min; 95 °C denaturation for 10 s, 60 °C annealing for 10 s, 72 °C extension for 30 s / kb, 35 cycles; 72 °C, 5 min. In addition, OsABCA3 The qRT-PCR detection reaction of the gene was performed with rice Actin1 ( Os10g0510000 ) as the internal reference gene, and the primers used were 5'- AGACGAACTCCACTCCGGTA -3' (forward primer) and 5'- TGAGCGAACTCCTTGAACCC -3' (reverse primer).
[0058] The results showed that OsABCA3 the gene was expressed in each growth period and various tissues of rice; among them, OsABCA3 the gene maintained a high expression level in the root and leaf tissues of rice throughout the entire growth period (as shown in Figure 7 ). These results implied that OsABCA3 the gene not only participates in the transport process in the root of rice, but also may participate in the transport or redistribution of Cd in various tissues of the aboveground part.
[0059] (5) OsABCA3 Obtaining of the gene overexpression strain
[0060] According to the conventional operation method in the field of genetic engineering, the RNA of rice leaf tissue was extracted according to the method of Example 1, and single-stranded cDNA was obtained by reverse transcription, and then the double-stranded cDNA fragment containing the full-length CDS sequence of the gene was amplified by using the high-fidelity enzyme Phanta Max Super-Fidelity DNA Polymerase of Vazyme (China) Company. The program of PCR amplification was 95 °C denaturation for 5 min, then 95 °C denaturation for 15 s, 58 °C annealing for 15 s, extension time according to 1 kb / 30 s at 72 °C, 35 cycles, and finally 72 °C terminal extension for 5 min. OsABCA3
[0061] The primers used for PCR of the gene were: 5'- ATGGAGCTCCTGAGCGGGG-3' (forward primer) and 5'- TCATCTTGCTGCTGTGACCT -3' (reverse primer). After sequencing verification, according to the conventional operation in the field of genetic engineering, the double-stranded cDNA fragment containing the full-length CDS sequence of the gene was obtained. OsABCA3 OsABCA3 The double-stranded cDNA fragment containing the full-length CDS sequence of the gene was inserted into the pOx overexpression vector containing the Ubi promoter stored in our laboratory (e.g., Figure 8 In (a) shown in the figure, the Ubi promoter is obtained. OsABCA3 Gene overexpression vector, i.e. pUbi::OsABCA3 Then, ZH11 rice was transformed. The transformed seedlings and progeny were planted and screened for identification to obtain... OsABCA3 Two independent, stable, homozygous lines with gene overexpression, namely OE-A3-1 , OE-A3-2 .
[0062] (6) OsABCA3 Obtaining gene knockout lines
[0063] Using standard operating procedures in the field of genetic engineering, intermediate vectors (such as...) are employed. Figure 8 (as shown in (b)) and gene knockout vectors (such as...) Figure 8 As shown in (c) in the figure), construct targets respectively. OsABCA3 Knockout vectors for two gene targets (T1 and T2). OsABCA3 T1 of gRNA vector in gene knockout lines (i.e. U3 The target primers are: 5'-GGCAGCAAGAACGCCACGCTCACC-3' (forward primer) and 5'-AAACGGTGAGCGTGGCGTTCTTGC-3' (reverse primer); T2 (i.e. U6a The amplification primers for the target site were: 5'- GCCGCGAACTCCACTCCGGTAGCT-3' (forward primer) and 5'- AAACAGCTACCGGAGTGGAGTTCG-3' (reverse primer). After transformation of Zhonghua 11, the target site was identified through planting and screening. OsABCA3 Two independent, stable homozygous gene knockout lines, namely cas-a3-1 , cas-a3-2 .
[0064] right OsABCA3 Sequencing and alignment analysis of target sites in gene knockout lines revealed that... cas-a3-1 In the strain, there was an 11 bp deletion at target site 1 (T1), while a 1 bp insertion was present at target site 2 (T2); cas-a3-2 In the strain, a 1 bp insertion was observed at target site 1 (T1), and a 2 bp deletion was present at target site 2 (T2). These deletions or insertions resulted in two... OsABCA3 The coding sequence (CDS) in the gene knockout line has a frameshift mutation, which causes the amino acid sequence of the encoded protein to terminate prematurely during translation.
[0065] (7) Statistical analysis of growth traits and Cd content of hydroponic seedlings
[0066] The OsABCA3 overexpression lines of the gene OE-A3-1 , OE-A3-2 ), knock-out lines cas-a3-1 , cas-a3- 2 and ZH11 were hydroponically cultured. After 30 days of culture, the plants were treated with different concentrations (0, 10, 100 μM) of CdCl2, and after 7 days of continuous culture, the plant phenotypes were observed and the physiological traits and Cd concentrations in different parts were determined. The method for determining Cd concentration is as follows: the rice samples were washed with water, dried in a 60°C oven, weighed (0.05-1.0 g for the aboveground part, 0.01-0.1 g for the root, and 1.0 g for the seed, of which the unhusked rice was husked in advance, ground into powder, and weighed; the same amount was weighed for each group of overexpression lines, knock-out lines, and wild type). The samples were placed in a glass digestion cup, 10 mL of mixed acid (concentrated nitric acid and perchloric acid were mixed in a volume ratio of 87:13 to prepare the mixed acid) was added to the cup, and the samples were digested with a graphite digestion furnace. The digestion was stopped when the sample volume in the cup was ≤0.5 mL. After the sample cooled, 2 mL of 1% dilute nitric acid was added, mixed well, and the glass cup was rinsed with ultrapure water for 3-5 times, filtered, and made up to volume (note: the seed sample was made up to 15.0 mL, the aboveground sample was made up to 15.0 mL, and the root sample was made up to 50.0 mL), and the Cd content was determined by inductively coupled plasma optical emission spectrometry (ICP-OES).
[0067] Under Cd treatment, the growth of the two overexpression lines OE-A3-1 , OE-A3-2 was weaker than that of the wild type, while the growth of the two knock-out lines cas-a3-1 , cas - a3 -2 was stronger than that of the wild type, and as the Cd concentration increased, the difference in growth became more obvious (as shown in (a) of Figure 9 ). The plant height, fresh weight, and dry weight of the rice seedlings under 0 and 100 μM Cd treatment were further determined and statistically analyzed. The results showed that under no Cd treatment, the growth traits of the overexpression and knock-out lines were not significantly different from those of the wild type; but under Cd treatment, the plant height, fresh weight, and dry weight of the overexpression lines were significantly reduced by at least 31.48%, 11.00%, and 12.10%, respectively, compared with the wild type, while these growth traits of the knock-out lines were significantly increased by at least 8.34%, 15.36%, and 15.27%, respectively, compared with the wild type (as shown in (b), (c), and (d) of Figure 9 ).
[0068] Cd content determination results show that the Cd contents in the overexpression lines ( OE-A3-1 , OE-A3-2 ) in the aboveground and root parts showed an increasing trend compared with the wild type, with an increase of 12.76% and 4.13% in the aboveground parts and 9.86% and 10.96% in the root parts; however, the Cd contents in the two knockout lines ( cas-a3-1 , cas-a3-2 ) were significantly lower than those in the wild type, with a decrease of 20.12% and 18.82% in the aboveground parts and 17.21% and 12.60% in the root parts (as shown in (a) of Figure 10 ), which indicates that knocking out the OsABCA3 gene can significantly reduce the absorption of Cd by rice.
[0069] Further detection of the Cd content in the xylem sap of each line under Cd treatment found that there was no significant difference in the Cd content in the xylem sap between the overexpression lines and the knockout lines of the OsABCA36 gene and the wild type, which indicates that the OsABCA3 gene may not directly participate in the Cd redistribution process in the aboveground part of rice through the xylem pathway (as shown in (b) of OsABCA3 ). Figure 10
[0070] (8) Cd-contaminated soil cultivation experiment
[0071] The overexpression lines ( OsABCA3 , OE-A3-1 ) and the knockout lines ( OE-A3-2 , cas-a3-1 , cas- a3-2 ) of the gene and the wild type rice ZH11 were selected, and when the rice seedlings grew to the four-leaf stage, the seedlings with consistent growth were selected for planting in Cd-contaminated soil (the Cd content in the soil was 0.33 mg / kg (pH 5.02), which was slightly higher than the risk screening level (0.3 mg / kg, pH≤5.5); the contents of other heavy metals such as As, Hg, Pb and Zn in the soil did not exceed the corresponding risk screening level; GB15618-2018). The rice cultivation was carried out according to the conventional criteria of paddy rice production, and the trait statistics and metal element determination were carried out after the rice was completely matured.
[0072] The results show that the growth of the overexpression lines and the knockout lines of the OsABCA3 gene did not show significant differences compared with the wild type, indicating that the overexpression or knockout of the OsABCA3 gene had no significant effect on the growth of rice cultivated in Cd-contaminated soil (as shown in (a) of Figure 11 ). Further determination of the Cd content in the aboveground and root parts of the rice cultivated in Cd-contaminated soil found that the Cd contents in the aboveground and root parts of the overexpression lines and the knockout lines of the OsABCA3Yield traits were statistically analyzed in overexpression lines, knockout lines, and wild-type ZH11. The results showed that... OsABCA3 Plant height, effective tiller number, seed setting rate, and yield per plant were not significantly different between the overexpression and knockout lines and the wild type (e.g., Figure 11 (as shown in (b) to (e)). These results indicate that OsABCA3 Overexpression or knockout of genes had no significant negative impact on various agronomic traits of rice.
[0073] right OsABCA3 The Cd content and essential metal content in mature grains (brown rice) of overexpression lines, knockout lines, and wild-type rice ZH11 were determined. The results showed that the Cd content in brown rice from the two overexpression lines was not significantly different from that of the wild type; however, the Cd content in brown rice from the two knockout lines was significantly lower than that of the wild type, decreasing by at least 21.59%, indicating that… OsABCA3 Overexpression of this gene has a limited effect on grain Cd content, while knockout of this gene may reduce Cd accumulation in rice grains to some extent (e.g., Figure 12 (as shown in (a)).
[0074] When examining the content of essential metal elements (Fe, Mn, Cu, Zn, Mg) in brown rice, the results showed that... OsABCA3 The contents of these metal elements in the overexpression and knockout lines were not significantly different from those in the wild type, indicating that these two genes mainly and specifically affect the Cd content in brown rice, without adversely affecting the contents of essential metal elements (such as...). Figure 12 (as shown in (b)).
[0075] The above results indicate that OsABCA3 This gene provides an important candidate gene resource for molecular breeding of low-Cd rice. Through analysis of... OsABCA3 Knocking out the gene is expected to effectively reduce the Cd content in the grain, while also ensuring the yield and nutritional quality of rice, thus providing a potential genetic engineering strategy for the control of Cd pollution in rice.
[0076] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.
Claims
1. Knocking out a gene of the ABC transporter family OsABCA3 application in the breeding regulation of rice, characterized in that, The ABC transporter family gene OsABCA3 The amino acid sequence of the encoded protein is shown as SEQ ID No: 2; The rice breeding regulation is to improve the tolerance of rice to Cd and reduce the Cd content in rice grains.
2. Knocking out a gene of the ABC transporter family OsABCA3 In the use for increasing the tolerance of rice to Cd and / or making / cultivating a rice variety with low Cd accumulation in grains, characterized in that, The ABC transporter family gene OsABCA3 The amino acid sequence of the encoded protein is shown as SEQ ID No:
2.
3. The ABC transporter family gene OsABCA3 The application discloses a knockout vector for improving the tolerance of rice to Cd and / or preparing / cultivating a rice variety with low Cd accumulation in grains, characterized in that, The ABC transporter family gene OsABCA3 The amino acid sequence of the encoded protein is shown as SEQ ID No:
2.
4. The use according to claim 3, characterized in that, The ABC transporter family gene OsABCA3 The knockout vector is for OsABCA3 The knockout vector for two target sites of a gene; the two target sites are U3 and U6a ; gRNA vectors of the application U3 Target primers are: Forward primer: 5'-GGCAGCAAGAACGCCACGCTCACC-3'; and Reverse primer: 5'-AAACGGTGAGCGTGGCGTTCTTGC-3'; gRNA vectors of the application U6a Amplification primers for the target sites are: Forward primer: 5'-GCCGCGAACTCCACTCCGGTAGCT-3'; and Reverse primer: 5'-AAACAGCTACCGGAGTGGAGTTCG-3'.
5. A method for enhancing the tolerance of rice to Cd and / or reducing the Cd content in the grain of rice, characterized in that, comprising a gene of the ABC transporter family OsABCA3 knocking out the step; The ABC transporter family gene OsABCA3 The amino acid sequence of the encoded protein is shown as SEQ ID No: 2.
Citation Information
Patent Citations
Cadmium absorption regulation gene, protein, and rice plant having reduced cadmium absorption
CN103917646A
Application of GmABCA9 gene in improving soybean protein content and grain weight
CN110041416A