Application of OsSPL3 in regulating root thickness traits in rice

Abstract

The present application relates to the field of plant genetic engineering, in particular to a plant development related protein and application of a coding gene thereof in regulating root thickness traits. The present application discloses the use of a rice OsSPL3 gene: for regulating plant (rice) root thickness; knocking out OsSPL3 to make rice roots thin; overexpressing OsSPL3 to make rice roots thick.

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering, and in particular to the application of a plant development-related protein and its encoding gene in regulating root thickness traits. Background Technology

[0002] Although the root system is crucial for crop growth and yield formation, root traits have not received sufficient attention compared to aboveground agronomic traits in breeding (Voss-Fels et al., 2018). Researching the molecular mechanisms regulating rice root growth is of great significance.

[0003] Root thickness is an important indicator of root physiological function and plays a crucial role in the regulation of root structure. Studies on woody plants have found that root thickness largely determines the efficiency of nutrient and water absorption (Gu et al., 2014). Thicker roots increase mechanical strength, preventing bending; thicker roots have stronger penetrating power, which is conducive to the formation of deep root systems (Gu et al., 2014; Klein et al., 2020). Elucidating the molecular mechanisms regulating root thickness is of great significance for the genetic improvement of root structure.

[0004] Currently, only a very few genes have been reported to participate in regulating root thickness in rice. Overexpression of the NAC family transcription factor OsNAC5 can increase the size of the stele and aerenchyma, thereby leading to thicker stems and roots (Jeong et al., 2013); overexpression of the oval family protein OsOFP19 can also increase root thickness, but at the same time, it will lead to phenotypes that are not conducive to yield formation, such as shorter roots and smaller grains (Yang et al., 2018).

[0005] Previous studies have shown that the SBP family gene OsSPL3 controls adventitious root development in rice, and that OsSPL3 is post-transcriptionally regulated by OsmiR156 (Shao et al., 2019). The invention CN109868278B, "Application of OsSPL3 in Controlling Adventitious Root Development in Rice," discloses that mutations in the miRNA target site of the mutant OsSPL3 lead to high accumulation of OsSPL3 transcripts, inhibiting the initiation and development of adventitious root primordia.

[0006] The references mentioned above are as follows:

[0007] Voss-Fels KP et al. (2018). Designer roots for future crops. Trends in Plant Science, 23:957-960.

[0008] Jeong, JS et al. (2013). OsNAC5 overexpression enlarges root diameter in rice plants leading to enhanced drought tolerance and increased grain yield in the field. Plant Biotechnology Journal, 11:101-114.

[0009] Klein, SP et al. (2020). Multiple integrated root phenotypes areas associated with improved drought tolerance. Plant Physiology, 183:1011-1025.

[0010] GU,J et al.(2018).Root diameter variations explained by anatomy andphylogeny of 50

[0011] Tropical and temperate tree species. Tree Physiology, 34:415-425. (Explanation of root diameter variations using anatomy and phylogeny of 50 tropical and temperate tree species. Tree Physiology, 34:415-425).

[0012] Yang, C et al. (2018). OsOFP19 modulates plant architecture by integrating the cell division pattern and brassinosteroid signaling. The Plant Journal, 93:489-501.

[0013] Shao, Y et al. (2019). OsSPL3, an sbp-domain protein, regulates crown root development in rice. Plant Cell, 31:1257-1275. Summary of the Invention

[0014] The technical problem to be solved by the present invention is to provide the application of OsSPL3 in regulating the root thickness trait of rice.

[0015] To address the aforementioned technical problems, this invention provides the use of the rice OsSPL3 gene for regulating plant root thickness.

[0016] As an improvement to the use of the rice OsSPL3 gene of the present invention: the coding region nucleotide sequence of the rice OsSPL3 gene is shown in SEQ ID NO.2, and the genomic nucleotide sequence of the rice OsSPL3 gene is shown in SEQ ID NO.3.

[0017] As a further improvement to the use of the rice OsSPL3 gene of the present invention: the plant is rice.

[0018] As a further improvement to the use of the rice OsSPL3 gene of the present invention:

[0019] Knocking out OsSPL3 resulted in thinner rice roots;

[0020] Overexpression of OsSPL3 resulted in thicker rice roots.

[0021] The technical solution provided by this invention is as follows:

[0022] This invention provides a rice root thickness regulating protein OsSPL3, the amino acid sequence of which is shown in SEQ ID NO.1, the coding region nucleotide sequence of which is shown in SEQ ID NO.2, and the genomic nucleotide sequence of which is shown in SEQ ID NO.3.

[0023] The key point of this invention is that it provides the amino acid sequence shown in SEQ ID NO.1 and the coding region nucleotide sequence shown in SEQ ID NO.2, and the genomic nucleotide sequence shown in SEQ ID NO.3. Given that the nucleotide and amino acid sequences are known, the acquisition of the nucleotide and amino acid sequences, as well as the acquisition of related vectors and host cells, are obvious to those skilled in the art.

[0024] Due to the specific nature of nucleotide sequences, any variant of the coding region nucleotide sequence shown in SEQ ID NO. 2 and the genomic nucleotide sequence shown in SEQ ID NO. 3, provided that it shares more than 90% homology with the polynucleotide, falls within the scope of protection of this invention. Variants of the polynucleotide refer to mutants, alleles, and derivatives generated by adding, substituting, inserting, or deleting one or more nucleotides from the polynucleotide sequence.

[0025] Due to the specificity of amino acid sequences, any fragment of a polypeptide or its variants containing the amino acid sequence shown in SEQ NO. 1, such as its conserved variants, bioactive fragments, or derivatives, are within the scope of protection of this invention, provided that the fragment or polypeptide variant shares more than 95% homology with the aforementioned amino acid sequence. Specifically, the alterations may include the deletion, insertion, or substitution of amino acids in the amino acid sequence; wherein, for conserved alterations of variants, the substituted amino acid has a similar structure or chemical properties to the original amino acid, such as replacing isoleucine with leucine; variants may also have non-conserved alterations, such as replacing glycine with tryptophan.

[0026] This invention also provides an application of the rice root thickness regulating gene OsSPL3 in regulating rice root thickness. The application involves knocking out OsSPL3 using a CRISPR-Cas9 system, which significantly thins the rice seed roots and makes the root system shallower; while overexpression of OsSPL3 can significantly thicken the rice seed roots, indicating that OsSPL3 is a positive regulator of rice root thickness. This has significant application value for improving rice root traits to enhance environmental adaptability and increase yield.

[0027] The present invention also provides a transgenic rice cell constructed by mutating the rice root thickness regulating gene OsSPL3.

[0028] This invention provides OsSPL3, a protein that regulates the thickness of rice roots, and its applications. The protein is involved in regulating the thickness of rice roots.

[0029] Compared with existing technologies, the main advantages of this invention are as follows: Unlike previous reports on OsSPL3 regulating adventitious root development in rice, the OsSPL3 described in this invention is a direct positive regulator of rice root thickness. Specifically, knocking out this gene significantly thins the seed roots and shallows the root system. Conversely, overexpressing this gene significantly thickens the rice seed roots, thereby promoting root development. Therefore, the content of this invention has significant guiding and application value in exploring the molecular mechanisms of plant root diameter formation and in the breeding practice of ideal root architecture in crops.

[0030] It should be noted that OsNAC5 and OsOFP19, which are currently known to regulate rice root thickness, have no homology with the OsSPL3 protein or encoding gene described in this invention, and do not belong to the same protein or gene family. Therefore, the involvement of OsNAC5 and OsOFP19 in regulating rice root thickness does not provide technical guidance for this invention. Furthermore, prior to the application date of this invention, whether OsSPL3 is involved in regulating rice root thickness has not been reported. Attached Figure Description

[0031] The specific embodiments of the present invention will be further described in detail below with reference to the accompanying drawings.

[0032] Figure 1 Phenotypic images and statistical analysis of root thickness of HJ2, crd1, OX156 and MIM156 materials after 5 days of germination and growth;

[0033] Figure 1 middle:

[0034] A. Stereoscopic observation of the root coarseness phenotype of the main root of materials such as HJ2, crd1, OX156 and MIM156, with a scale bar of 1 mm; BC. Cross-section and longitudinal section of the roots of the corresponding materials in A, with a scale bar of 50 micrometers; D. Statistical analysis of root diameter of the roots of the corresponding materials in A and gene expression analysis of miR156 and OsSPL3.

[0035] Figure 2 Phenotypic analysis of root crude mutants in two rice subspecies;

[0036] Figure 2 middle:

[0037] A, wild-type Kas and lcrn1 Kas Photographs of mutant phenotypes and longitudinal and transverse sections of the roots of the corresponding materials; B, wild-type HJ2 and lcrn1 HJ2 Photographs of the mutant phenotype and longitudinal and transverse sections of the corresponding material roots.

[0038] Figure 3 For the identification and phenotypic analysis of HJ2, spl3-1 and lcrn1;

[0039] Figure 3 middle:

[0040] A shows the gene structure of OsSPL3, a rice root thickness regulatory gene, and the sequencing identification of spl3-1 and lcrn1. B shows the expression level of OsSPL3 in HJ2, spl3-1 and lcrn1 materials analyzed by real-time quantitative PCR. CF shows the observation and statistical analysis of root thickness phenotypes in HJ2, spl3-1 and lcrn1 materials.

[0041] Figure 4 To verify the function of OsSPL3, a rice root thickness regulatory gene, in the japonica rice variety XS134.

[0042] Figure 4 middle:

[0043] A, Identification of the spl3-2 mutant in the XS134 background; B, Crude root phenotypic analysis of XS134, spl3-2, and OXSPL3 materials; C, Real-time quantitative PCR analysis of OsSPL3 expression level in XS134, spl3-2, and OXSPL3 materials; D, Root phenotypic analysis of XS134, spl3-2, and OXSPL3 materials, with arrows indicating the position of the maximum root length end; E and F, Root structure phenotypic analysis and statistical analysis of the correlation between adventitious root number and root length in XS134 and OXSPL3 lines, with a scale bar of 3 cm. Detailed Implementation

[0044] The present invention will be further described below with reference to specific embodiments, but the scope of protection of the present invention is not limited thereto:

[0045] Example 1: Identification and Phenotypic Analysis of Mutant Lines of Rice Root Thickness

[0046] I. Rice Cultivation Conditions and Nutrient Solution Formula

[0047] The rice cultivation conditions are as follows:

[0048] Daytime temperature: 28-30℃, nighttime temperature: 20-22℃; light duration: 7:00-19:00; relative humidity: 65%; light intensity: 250-300 μmol m⁻² s⁻¹; pH of rice nutrient solution: 5.5-5.8. The nutrient solution should be changed every 7 days.

[0049] The rice nutrient solution formula is shown in Table 1 below:

[0050] Table 1

[0051]

[0052]

[0053] II. Identification of mutant lines of rice root thickness trait

[0054] Wild-type rice varieties Heijing 2 (HJ2) and Kasalath (Kas), as well as mutants crd1, OX156, MIM156, and lcrn1 (including the lcrn1 mutant from both the indica and japonica rice subspecies Kas): lcrn1 Kas and lcrn1 HJ2Seeds, such as those listed above, were taken from the storage according to their numbers and immersed in 0.66% dilute nitric acid. They were then placed at room temperature (24-26℃ as described in this invention) for 16 hours to break seed dormancy. Afterward, the seeds were rinsed three times with clean water to remove excess nitric acid. They were then immersed in clean water and germinated in a 37℃ oven for approximately two days (changing the water every 12 hours) until the seeds showed signs of sprouting. The sprouted seeds were then sown according to their numbers on a mesh floating plate (10 liters / plate, nutrient solution formula as shown in Table 1) floating on rice nutrient solution, under the conditions described above. After 5 days of cultivation, wild-type material was placed on one side of an observation dish (black plastic tray). Other mutant materials were then placed in the observation dish according to their numbers. The differences in root thickness between the wild-type and mutant materials were observed, photographed, measured, and recorded.

[0055] illustrate:

[0056] Wild-type and mutant materials such as HJ2, crd1, OX156 and MIM156 are from articles published by the inventors' research group (Zhu et al., 2019); materials such as Kas and lcrn1Kas are from articles published by the inventors' research group (Shao et al., 2019).

[0057] CRD1, an Xpo1 domain protein, regulates miRNA accumulation and crownroot development in rice;

[0058] OsSPL3,an SBP-Domain Protein,Regulates Crown Root Development inRice.

[0059] OsSPL3 was overexpressed in crd1, MIM156 and lcrn1 compared to the corresponding wild type; while OsSPL3 was underexpressed in OX156 compared to the corresponding wild type.

[0060] III. Phenotypic Analysis of Mutant Lines of Rice Root Thickness

[0061] Five days after seed germination and growth, root tissues from HJ2, crd1, OX156, and MIM156 samples were collected. Total RNA was extracted, reverse transcribed, and OsSPL3 expression was detected using standard RT-qPCR methods. The results showed that:

[0062] OsSPL3 gene expression was significantly induced in crd1 and MIM156 materials compared to the control HJ2, resulting in a significant increase in root thickness; while OsSPL3 gene expression was significantly suppressed in OX156 material compared to the control HJ2, resulting in a significant decrease in root thickness. Figure 1 ).

[0063] Furthermore, it is more clearly stated that in both rice subspecies (Indica Kas and Japonica HJ2), the gain-of-function mutant lcrn1 of OsSPL3... Kas and lcrn1 HJ2 The root thickness was significantly increased compared to the corresponding wild type. Figure 2 This suggests that OsSPL3 may be a potential positive regulator of root thickness in rice.

[0064] The methods for total RNA extraction and first-strand cDNA synthesis from root tissue are as follows:

[0065] (1) Turn on the centrifuge and pre-cool it to 4°C;

[0066] (2) Label the centrifuge tubes and add 1 ml of Trizol reagent (1 ml / 100 mg tissue);

[0067] (3) Grind rice roots into a fine powder in liquid nitrogen and immediately transfer the powder to a centrifuge tube containing Trizol reagent. Shake vigorously and let stand at room temperature for 5-10 minutes.

[0068] (4) Centrifuge at 4℃ and 12000rpm for 10min, and transfer 800μl of supernatant to another 1.5ml centrifuge tube;

[0069] (5) Add 200 μl of chloroform, shake thoroughly, and let stand at room temperature for 10 min until the liquid separates into layers;

[0070] (6) Centrifuge at 4℃ and 12000rpm for 10min, and transfer 600μl of supernatant to another 1.5ml centrifuge tube;

[0071] (7) Add 600 μl of isopropanol, mix gently, and place at -20℃ for 30 min;

[0072] (8) Centrifuge at 4℃ and 12000rpm for 15min;

[0073] (9) Discard the supernatant and gently swirl and wash with 70% ethanol (prepared with DEPC water);

[0074] (10) Centrifuge at 4℃ and 10,000 rpm for 5 min, discard the supernatant, and repeat the washing process once.

[0075] (11) Centrifuge at 4℃ and 10000rpm for 5min, discard the supernatant, place in a clean bench to dry the residual liquid, add 50-100μl of DEPC water to dissolve, determine the concentration, and the sample can be used immediately for subsequent reverse transcription experiments.

[0076] (12) First-strand cDNA was synthesized according to the method provided by the Total Gold Reverse Transcription Kit AU341-022.

[0077] The quantitative primer sequences for OsSPL3 are as follows (5' to 3'):

[0078] OsSPL3 QRT-F: AGCCACAACCAGAAGCAATTTCC

[0079] OsSPL3 QRT-R: CTTGCCTGTTGCCTTGCATCAC

[0080] The RT-qPCR reaction system and procedure are as follows:

[0081] RT-qPCR reaction system (384-well plate):

[0082] cDNA template: 0.1 μl;

[0083] 2×Master: 2.5μl;

[0084] Upstream / downstream primers: 0.1 μl / 0.1 μl;

[0085] RNase-free H2O: 2.2 μl.

[0086] RT-qPCR reaction procedure (384-well plate):

[0087]

[0088] IV. Cytological Analysis of Root Thickness

[0089] To analyze the cytological mechanism by which OsSPL3 regulates root thickness, resin sections were prepared from the root tips of the corresponding materials. Sheaths of HJ2, Kas, crd1, OX156, MIM156, and lcrn1, obtained after 5 days of seed germination and growth, were fixed overnight at room temperature in a 4% (w / w) paraformaldehyde aqueous solution, then washed three times with 0.1M PBS (20 min each time), transferred to a 1% (v / v) osmium tetroxide aqueous solution, and incubated overnight at room temperature, followed by three washes with 0.1M PBS (20 min each time). Water in the tissues was replaced using acetone aqueous solutions with varying (v / v) concentrations. The acetone concentrations used were sequentially: 30% acetone (1 h) → 40% acetone (1 h) → 50% acetone (1 h) → 60% acetone (1 h) → 70% acetone (overnight) → 80% acetone (1 h) → 90% acetone (1 h) → 95% acetone (1 h) → 100% acetone (1 h) → 100% acetone (1 h) → 100% acetone (1 h). Then, the acetone in the tissue was replaced with resins of different concentration gradients. The resin-acetone ratio (volume ratio) used was sequentially: 2 / 3 acetone + 1 / 3 Spurr's resin (2 h) → 1 / 2 acetone + 1 / 2 Spurr's resin (2 h) → 1 / 3 acetone + 2 / 3 Spurr's resin (2 h) → pure Spurr's resin infiltration overnight → embedding → polymerization overnight (70°C incubator). The polymerized resin blocks were longitudinally sectioned from the root tips using a resin slicer (section thickness 3 μm) → the sections were spread onto glass slides → stained with methylene blue → washed with water to remove residual stain → baked → observed and photographed under an optical microscope. Observation of longitudinal and transverse resin sections revealed that the number of cortical layers in materials such as crd1 and MIM156 was significantly higher than that in the control group HJ2; while the number of cortical layers in the OX156 mutant material was significantly reduced. Figure 1 (B and C), lcrn1 Kas and lcrn1 HJ2 The roots of the materials were also significantly thicker than those of the corresponding control materials. Figure 2 The results showed that OsSPL3 mainly regulates the number root thickness of the cortex.

[0090] Example 2: Functional verification of the rice root thickness regulating gene OsSPL3

[0091] I. Development of OsSPL3 Artificial Knockout Mutants Using CRISPR-Cas9 Technology

[0092] A CRISPR-Cas9 vector was designed and constructed using a specific target. The correctly constructed and sequenced CRISPR vector containing OsSPL3 was then transformed into Agrobacterium (EHA105). Artificial knockout mutants of OsSPL3 were developed in HJ2 and XS134 backgrounds, respectively. The mutant obtained in the HJ2 background was named spl3-1, and the mutant obtained in the XS134 background was named spl3-2.

[0093] You can refer to the CRISPR-P program (http: / / skl.scau.edu.cn / ) to design CRISPR target primers for OsSPL3. The specific target primers designed in this case are shown below (5' to 3'):

[0094] Target 1: AATCAAAACTTGCAGGTGT

[0095] Target 2:TCTAGCTCAGAGATTGGGTA

[0096] The mutation mode and sequence of the OsSPL3 artificial knockout mutant are as follows: Figure 3 China A and Figure 4 As shown in Figure A.

[0097] II. Creation of OsSPL3 overexpression materials

[0098] To explore the potential application value of OsSPL3 in regulating rice root thickness, the OsSPL3 promoter and encoding nucleotide sequences were amplified using genomic DNA and cDNA of lcrn1 as templates (the encoding nucleotide sequence is shown in SEQ ID NO.2, and the promoter sequence is shown in SEQ ID NO.3). The purified amplified fragments were ligated into the pCAMBIA1300-eGFP binary vector using a homologous recombinase (purchased from Novizan Biosciences Co., Ltd.) to obtain an OsSPL3 overexpression vector. This correctly constructed and sequenced OsSPL3 overexpression vector was then transformed into Agrobacterium (EHA105) for transformation of wild-type XS134. The resulting vector was named OXSPL3.

[0099] III. The specific steps of Agrobacterium (EHA105)-mediated genetic transformation are as follows:

[0100] (1) Select the transformed single clones from step one or step two above and transfer them to a 50ml centrifuge tube containing 20ml of Agrobacterium culture medium. Incubate overnight at 28℃ and 250rpm with shaking until the bacterial culture reaches OD500. 600 At approximately 1.0, centrifuge at 4℃, 4000 rpm for 10 min to collect the bacterial cells;

[0101] (2) Prepare an Agrobacterium suspension using 30 ml of AAM inoculum containing 200 μmol / L acetylsuccinone (As), and adjust the OD of the bacterial suspension. 600 The final concentration is 0.6; place 50-80 HJ2 or XS134 callus tissues of 0.3-0.5 cubic centimeters into the container, shake on a horizontal shaker at room temperature for 5 minutes to infect, then remove the callus tissues and place them on sterile filter paper to drain.

[0102] (3) Transfer the callus tissue to a co-culture medium lined with sterile filter paper, incubate in the dark at room temperature for 3 days, collect the callus, and wash it twice with sterile water containing 300 mg / L carbenicillin sodium (Carb), shaking it on a horizontal shaker for 30 minutes each time. Finally, place it on sterile filter paper to drain for 2 hours;

[0103] (4) The drained callus was transferred to a selective medium containing 300 mg / L carbenicillin sodium and 50 mg / L hygromycin for the first round of selection. It was cultured at 28°C under light for 14 days.

[0104] (5) Select the initial callus with resistance and transfer it to a medium containing 300 mg / L carbenicillin sodium and 50 mg / L hygromycin for a second round of selection. Culture at 28°C under light for 14 days. At this time, granular resistant callus tissue can be seen growing.

[0105] (6) Select 2-3 resistant calluses from the same callus and place them on the differentiation medium. Cover the differentiation tank and culture at 25°C under light (16h / 8h photocycle, light intensity of 2000lx) for about 30 days until the callus tissue differentiates into seedlings. When the seedlings grow to about 5-10cm, they can be directly transplanted to the rice culture conditions described in Example 1 for culture and identification.

[0106] (7) T0 generation transgenic seedlings were amplified using primers specifically for amplifying hygromycin, and transgenic positive seedlings were identified. The primer sequences for specific amplification of hygromycin are as follows (5' to 3'):

[0107] Hyg F:CGAGTACTTCTACACAGCCATC

[0108] Hyg R: TAGCGAGAGCCTGACCTATT;

[0109] (8) Continue to cultivate the T0 generation transgenic positive seedlings obtained from the identification until the seeds are harvested.

[0110] IV. Root thickness phenotypic analysis of OsSPL3 knockout and overexpression materials

[0111] Sequencing analysis revealed that the spl3-1 mutant coding sequence contained a large deletion (71 bp); the spl3-2 mutant coding sequence contained base deletions (15 bp deletion at target site 1 and 1 bp deletion at target site 2). Both spl3-1 and spl3-2 resulted in premature termination of OsSPL3 coding. Figure 3 China A and Figure 4 (A). Germination of transgenic lines and observation of root thickness phenotype revealed that the roots of the two mutants, spl3-1 (HJ2 background) and spl3-2 (XS134 background), were significantly thinner than the corresponding wild-type control materials. Figure 3 From C to F, Figure 4 (B)

[0112] The expression level of OsSPL3 was detected using the same RT-qPCR method as described above, and combined with phenotypic analysis, it was found that the expression level of OsSPL3 in the OXSPL3 line was significantly higher than that in the control XS134. Correspondingly, the root thickness of the OXSPL3 line was significantly thicker than that of the control XS134. In addition, the number of adventitious roots was reduced, but the root length was significantly increased relative to the control. Figure 4 These results further confirm that OsSPL3 directly regulates rice root thickness, and also indicate that by regulating the expression of OsSPL3, such as by using root-specific expression promoters to drive OsSPL3, it is possible to regulate rice root thickness and root architecture, thereby contributing to the breeding of new varieties with ideal root architecture.

[0113] Finally, it should be noted that the above examples are merely some specific embodiments of the present invention. Obviously, the present invention is not limited to the above embodiments and many variations are possible. All variations that can be directly derived or conceived by those skilled in the art from the disclosure of the present invention should be considered within the scope of protection of the present invention.

Claims

1. Use of overexpression of the rice OsSPL3 gene in making rice roots thicker, characterized in that: The nucleotide sequence of the coding region of the rice OsSPL3 gene is shown as SEQ ID NO.

2.

2. Use according to claim 1, characterized in that: The genomic nucleotide sequence of the rice OsSPL3 gene is shown as SEQ ID NO.

3. The genomic nucleotide sequence of the rice OsSPL3 gene is shown as SEQ ID NO. 3.

Images