Application of silence, inhibition or knockout of SlSnRK1.1 gene, SlSnRK1.1 gene mutant and application of SlSnRK1.1 gene mutant

Abstract

The invention discloses application of silence, inhibition or knockout of an SlSnRK1.1 gene, an SlSnRK1.1 gene mutant and application of the SlSnRK1.1 gene mutant, and belongs to the technical field of plant genetic engineering. According to the present invention, the research results show that the tomato SlSnRK1.1 gene (the ID number of the NCBI gene is 778276) can regulate and control the accumulation of lycopene in the tomato fruit; the tomato SlSnRK1.1 mutant Slsnrk1.1 is obtained by virtue of a CRISPR-Cas9 (clustered regularly interspaced short palindromic repeats-associated protein 9) technology, and the content of lycopene in the tomato SlSnRK1.1 mutant Slsnrk1.1 is found to be obviously increased. The invention provides reference for subsequent improvement of lycopene content in tomato fruits and breeding and variety improvement.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant genetic engineering, and specifically relates to the application of tomato SlSnRK1.1 gene in regulating the synthesis of lycopene in tomato fruit; in particular, silencing, inhibiting or knocking out SlSnRK1.1 Gene application and SlSnRK1.1 Gene mutants and their applications. Background Art

[0002] Tomato (Solanum lycopersicum L.) belongs to the Solanaceae family and the genus Tomato. It is native to South America and is one of the most produced and consumed vegetables in the world. It is an important economic crop worldwide. According to FAOSTAT statistics, in 2022, the world's top five tomato producers were China, India, Turkey, the United States and Egypt, with global fruit production of 186 million tons. Tomatoes have high nutritional value, and the fruit contains a variety of compounds that are beneficial to human health, such as ascorbic acid and carotenoids. Sucrose non-fermenting protein kinase SnRK1 is a key component that senses and regulates cellular energy homeostasis. It is widely present in eukaryotes and its functions are highly conserved. It regulates plant growth, development, aging, metabolism and other biological processes by coordinating nutrient availability, energy status and hormone signals. Tomatoes are rich in lycopene and have strong antioxidant capacity. In recent years, they have been widely used in the production of antioxidant skin care products. But tomatoes SlSnRK1.1 It is still unknown whether the gene (NCBI gene number: 778276) is involved in the synthesis of lycopene. The present invention obtains the tomato SlSnRK1.1 mutant by CRISPR-Cas9 technology Slsnrk1.1 The study found that tomato SlSnRK1.1 affects the accumulation of lycopene in its fruit. The experimental results showed that the content of lycopene in the mutant Slsnrk1.1 Significantly increased in tomatoes. Summary of the invention

[0003] The primary purpose of the present invention is to provide an application of silencing, inhibiting or knocking out the SlSnRK1.1 gene in increasing the lycopene content of plants. It is found that knocking out the SlSnRK1.1 gene can increase the lycopene content of plants.

[0004] The SlSnRK1.1 gene includes the tomato SlSnRK1.1 gene; the mRNA sequence is shown in SEQ ID No: 1, and the protein sequence is shown in SEQ ID No: 2.

[0005] The plants include tomatoes.

[0006] The second aspect of the present invention aims to provide a mutant with the SlSnRK1.1 gene knocked out.

[0007] The mutants include cells, tissues or plants.

[0008] The mutant is a mutant obtained by CRISPR-Cas9 technology.

[0009] The mutant is a tomato mutant.

[0010] The third object of the present invention is to provide the use of the mutant in increasing the lycopene content of plants or in breeding thereof.

[0011] Specifically, the invention relates to increasing the lycopene content of tomato plants or using it in breeding.

[0012] This study first found that the SlSnRK1.1 gene regulates the accumulation of lycopene in tomato fruits. The tomato SlSnRK1.1 mutant was obtained by CRISPR-Cas9 technology. Slsnrk1.1 The experimental results showed that lycopene accumulated in the mutant Slsnrk1.1 tomato, which provided a reference for the subsequent improvement of lycopene content in tomato fruit and breeding and variety improvement. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 :CRISPR-Cas9 vector map.

[0014] Figure 2 : Mutation site and sequencing identification of tomato SlSnRK1.1 gene.

[0015] Figure 3 : Tomato SlSnRK1.1 gene knockout mutant ( Slsnrk1.1 ) and wild type (WT) fruit phenotypes.

[0016] Figure 4 : Tomato SlSnRK1.1 gene knockout mutant ( Slsnrk1.1 ) and wild type (WT) fruits at maturity. DETAILED DESCRIPTION

[0017] The following examples are intended to further illustrate the present invention, but are not intended to limit the present invention.

[0018] Example 1

[0019] Planting materials: Tomato seeds (Solanum lycopersicum L.'Micro-Tom') were stored in a 4℃ refrigerator. Selected plump tomato seeds were placed in a petri dish containing soaked filter paper and germinated at 25℃ in the dark for 2-3 days. White seeds were sown in a 72-hole seedling tray filled with humus and vermiculite (2:1; v / v). When the plant grew to three leaves and one heart, it was transferred to a culture pot containing the same substrate. The growth conditions were 25℃ with 16 h of light, a light intensity of 10,000 Lx, 8 h of darkness, and a relative humidity of 60%.

[0020] 1. Using CRISPR technology to obtain mutants Using CRISPR-Cas9 system in tomato ( Solanum lycopersicum SlSnRK1.1 mutants were obtained in the L. ‘Micro-Tom’) background (1) Design the knockout target site based on the cDNA of the target gene SlSnRK1.1. The website used is: https: / / crispr.dbcls.jp / The target site sequences are as follows: target 1 CATAAAGCCGTATAATATG (reverse); target 2 GTTGAGAAGGGCAGATTGC (forward).

[0021] (2) Construction of vector 20 μl PCR reaction system: 2 μl 10× buffer 2 μl 2mM dNTPs 2 μl DNA template (CR-PCR plasmid) 1 μl DMSO 0.8 μl 10pmol / ml upstream and downstream primers 0.5 U kod DNA polymerase (KOD-401, TOYOBO) Add water to make up to 20 μl.

[0022] PCR amplification procedure: Pre-denaturation at 94°C for 4 min; Denaturation at 94°C for 30 s, annealing at 50-64°C for 30 s, and extension at 68°C for 30 s, for 40 cycles; Keep warm at 68℃ for 8 min.

[0023] Enzyme digestion: 40 μl enzyme digestion system: PCR product / CR empty vector 4 μl 10× digestion buffer 4 μl 10× BSA 6 U BsaI restriction enzyme (NEB) Add water to make up to 40 μl Incubate in 37℃ water bath and digest for about 1 h.

[0024] Plasmid construction steps: The PCR fragments after restriction digestion and the CR empty vector after restriction digestion (M2CRISPR referred to as CR vector, Shanghai Pujie Biotechnology Co., Ltd.) were recovered from agarose gel and connected with DNA ligase (#M0202M, NEB). The connection system is as follows: 2ul 10× Ligation Buffer 2ul digested vector DNA 8ul fragment DNA 1ul DNA ligase Add water to 20ul The reaction system was added to a 250ul EP tube, placed in a 16°C water bath for 30 minutes, and then the transformed E. coli was plated. After the plate was placed in a 37°C incubator for 16 hours, the bacteria were picked and sequenced.

[0025] The above process was completed by Shanghai Pujie Biotechnology Co., Ltd.

[0026] 2. Agrobacterium-mediated genetic transformation of tomato (1) Agrobacterium transformation Take the competent Agrobacterium stored at -80℃ and place it at room temperature or in the palm of your hand for a while until it partially melts, and insert it into ice when it is in an ice-water mixture state. Add 0.1 μg (volume not more than 10ul) plasmid DNA to every 100μl competent state, stir the bottom of the tube by hand to mix, and place it on ice for 5 minutes, liquid nitrogen for 5 minutes, 37℃ water bath for 5 minutes, and ice bath for 5 minutes.

[0027] Add 700 μl of LB liquid medium without antibiotics, and culture at 28°C, 200 rpm for 2-3 hours. Centrifuge at 6000 rpm for one minute to collect the bacteria, and take about 100 μl of the supernatant and gently blow to resuspend the bacteria, spread it on the LB plate containing the corresponding antibiotics, and invert it in a 28°C incubator for 2-3 days. Randomly select 2-3 single colonies, perform colony PCR, identify the correct Agrobacterium single clone, and mark it for later use.

[0028] Use a sterile pipette tip to pick up the marked Agrobacterium single clone and inoculate it into 5 ml LB liquid medium containing the corresponding antibiotics (use a 50 ml blue-capped centrifuge tube) and culture it at 28°C with shaking at 200 rpm for 24 hours.

[0029] Centrifuge at 20°C, 4,000 rpm for 15 min to collect the cells; pipette the cells evenly with transformation buffer and resuspend them to about OD600=0.5.

[0030] (2) Agrobacterium inoculation and co-cultivation of explants Select sterile true leaves, cotyledons, and hypocotyls as explants for transformation. Cut off the leaf tips and petioles of true leaves and cotyledons, and cut the rest into leaf pieces of 0.5 cm × 0.5 cm; cut the hypocotyls into segments of about 0.5-0.6 mm in length and place them horizontally on the pre-culture medium, 15-20 pieces per dish. The culture conditions are the same as above, and the pre-culture is 1 day. Remove the explants from the pre-culture medium and place them in a culture dish with Agrobacterium diluted to about OD600=0.5 with transformation buffer. Transform for 30 min, remove the explants, blot dry on sterile paper, and put them back into the pre-culture medium for 1-2 days.

[0031] (3) Selective training The co-cultivated explants are transferred to the selection medium for selection culture. After a few days of selection culture, the cotyledons begin to thicken and the hypocotyls begin to thicken. The transformed explants will form callus and adventitious buds on the selection medium. Subculture once every two weeks until regenerated seedlings grow out.

[0032] 3. Sequencing to identify whether the target region is mutated (1) PCR identification reaction system and conditions Design upstream and downstream primers at 120-200 bp on both sides of the target region selected by CRISPR mutation and name them F: GATATACCTTGATGGAGGATG, R: GGTCTCTATGAACCACCATG, and amplify the genomic DNA of all genetically transformed seedlings using ordinary taq enzyme or high-fidelity PCR enzyme (KOD FX DNA polymerase - TOYOBO is recommended).

[0033]

[0034] (2) Sequencing The PCR product was electrophoresed, the target band was recovered by gel cutting, and sent to a sequencing company for sequencing. Positive plants were obtained according to the sequencing results. From the sequencing results, we can see that we have obtained a homozygous mutant with a deletion of 104 bp Slsnrk1.1 ( Figure 2 ).

[0035] 3. Lycopene determination The watering frequency, watering amount, fertilization frequency and fertilization amount of the control group and the experimental group were kept the same. The red color of the tomatoes was measured after the fruits were fully ripe. After washing with ethanol, the filtrate was extracted with petroleum ether and measured with an ultraviolet spectrophotometer (Zhang Lianfu and Ding Xiaolin 2001). Figure 3 The content determination results are shown in Figure 4 shown.

Claims

1. Silencing, inhibition or knockout SlSnRK1.1 The application of genes in increasing the lycopene content of plants.

2. The use according to claim 1, characterized in that: The SlSnRK1.1 gene includes the tomato SlSnRK1.1 gene; the mRNA sequence is shown in SEQ ID No: 1, and the protein sequence is shown in SEQ ID No:

2.

3. The use according to claim 1, characterized in that: The plants include tomatoes.

4. Mutants with SlSnRK1.1 gene knockout.

5. The mutant according to claim 4, characterized in that Includes cells, tissues or plants.

6. The mutant according to claim 4, characterized in that Mutants obtained using CRISPR-Cas9 technology.

7. The mutant according to claim 4, characterized in that The mutant is a tomato mutant.

8. Use of the mutant according to any one of claims 4 to 7 in increasing the lycopene content of plants or in breeding thereof.

9. The use according to claim 8, characterized in that: Specifically, the invention relates to increasing the lycopene content in tomato fruits or using it in breeding.

Images