Molecular marker co-segregated with melon powdery mildew resistance gene and application thereof

Abstract

The invention discloses a molecular marker co-segregated with a melon powdery mildew resistance gene and application of the molecular marker, the powdery mildew resistance gene is MELO3C002429.2, is named as CmANK and is located on a 12 # chromosome, and the full length of a coding region is 1953bp; the molecular marker is SNP24072061, is located on the fifth exon of the CmANK gene, is located at 1888bp, is mutated into C from base G, is non-synonymous mutation, and causes the amino acid sequence to be mutated into Gly from Arg. According to the invention, DNA is extracted from young muskmelon leaves for genetic typing of different single plants, the powdery mildew resistance of the plants is pre-judged according to genetic typing results, and by combining genetic typing and powdery mildew phenotype data analysis, the molecular marker is co-separated from the powdery mildew resistance gene of the muskmelon, so that the powdery mildew resistance of the muskmelon is determined. The molecular marker is used for muskmelon molecular marker-assisted breeding, and breeding efficiency can be greatly improved.

Description

Technical Field

[0001] The invention belongs to the field of plant molecular marker-assisted breeding, and particularly relates to a molecular marker co-segregated with a melon powdery mildew resistance gene and an application thereof. Background Art

[0002] Muskmelon (Cucumis melo L.) is an annual herbaceous plant belonging to the Cucurbitaceae family. It is widely planted around the world and is widely loved by people for its unique fruit flavor and rich nutrition. Muskmelon germplasm resources are diverse, showing rich genetic diversity in fruit size, shape, color, ripening behavior (i.e., respiratory climacteric and non-respiratory climacteric), cortex texture (smooth to reticular), and sex determination (i.e., monoecious and andromonoecious). As consumers have higher and higher requirements for the flavor quality of melons, food safety and green pollution-free are also the main constraints on whether melons are popular in the market. In order to reduce pesticide residues in production, it is imperative to cultivate disease-resistant varieties.

[0003] Powdery mildew is one of the most important plant diseases worldwide and is common in Cucurbitaceae crops. Powdery mildew is caused by biotrophic fungi (Erysiphales) and can infect leaves, stems, flowers and fruits, greatly reducing the quality and yield of the fruits. It is reported that there are three pathogens that affect Cucurbitaceae plants, namely Leveillula taurica, Golovinomyces orontii and Podosphaera xanthii. The most common powdery mildew pathogen in Cucurbitaceae is P. xanthii, while L. taurica has less economic impact. Melon production is often restricted by a large number of pests and diseases, including powdery mildew caused by the fungus Podosphaera xanthii / Golovinomyces orontii. Powdery mildew has become the main fungal disease occurring in protected and open-field melon cultivation in my country, seriously hindering the green production of melons and food safety. It can occur during the entire growth period of melons, generally from the bottom to the top. The leaf surface first shows scattered chlorotic spots, and then powdery spots quickly spread in sheets, mainly causing damage to the leaves. When the disease is serious, it also damages the petioles and stems. Especially in the middle and late growth stages, the disease is serious, causing the entire plant to wither and die, premature vine pulling, reducing the yield and quality of melon fruit, and causing serious economic losses. In protected cultivation, due to high temperature, humidity, and dense planting, melon powdery mildew is more likely to occur. In production, powdery mildew is mainly controlled by spraying chemical pesticides, but the use of pesticides not only endangers food safety and causes environmental pollution, but also long-term use of pesticides will promote resistance mutations in the physiological subspecies of powdery mildew pathogens, thereby increasing the difficulty of prevention and control and raising the production costs of growers. Therefore, screening and cultivating new melon varieties that are durable and highly resistant is the most economical, safe and effective way to solve the damage caused by powdery mildew.

[0004] At present, the selection and breeding of new melon varieties mainly adopts conventional hybrid breeding methods, but conventional disease-resistant breeding is time-consuming and requires multiple generations of hybridization and backcrossing. The phenotypic selection method is usually used for quantitative traits such as powdery mildew resistance, which is easily affected by the environment and has low selection efficiency. In addition, since the pathogen of powdery mildew is an obligate living parasite, it cannot be artificially cultivated and is generally preserved and propagated on a living host, which brings many inconveniences to the acquisition of strains. The occurrence of the disease is closely related to environmental conditions. Disease detection is greatly affected by the environment and season, and a special nursery is required for inoculation and identification. It is difficult to carry out field identification work in the non-disease season, which increases the difficulty of cultivating disease-resistant melon varieties.

[0005] With the rapid development of modern biotechnology, the differences in the DNA sequences of disease-resistant genes in resistant and susceptible materials have been used to develop molecular markers that co-segregate with resistance genes, opening up new ways for disease-resistant breeding. Molecular marker-assisted selection breeding can track disease-resistant genes, eliminating the selection process of self-pollination in each generation. It can also integrate multiple disease-resistant genes into one variety, significantly improving breeding efficiency, significantly shortening the breeding cycle, and also improving the durability of disease resistance. Identifying the genetic laws of disease resistance in genetic populations, combining molecular marker technology, locating and cloning powdery mildew resistance genes, and studying their functions and molecular regulatory mechanisms of resistance can provide a theoretical basis for molecular marker-assisted breeding and molecular design breeding of melon resistance genes. Therefore, the isolation of disease-resistant genes and the study of their disease-resistant mechanisms are important bases for formulating disease-resistant breeding strategies. Accelerating the study of powdery mildew resistance inheritance and the mining of disease-resistant genes, revealing the molecular mechanism of melon resistance to powdery mildew, and using new resistant germplasm resources to cultivate new varieties with multiple disease-resistant genes through molecular marker-assisted selection (MAS) are effective ways to solve this problem. Summary of the invention

[0006] One of the purposes of the present invention is to provide a molecular marker co-segregated with the melon powdery mildew resistance gene, to locate, clone and study the biological function of the melon powdery mildew resistance gene by forward genetics, and to provide important scientific guidance and application value for creating high-quality, multi-resistant, green and safe new melon germplasm.

[0007] The second object of the present invention is to provide the use of the above-mentioned molecular marker co-segregated with the melon powdery mildew resistance gene in melon molecular marker-assisted breeding.

[0008] To achieve the above object, the present invention provides the following technical solutions:

[0009] The present invention provides a molecular marker co-segregating with a melon powdery mildew resistance gene, wherein the powdery mildew resistance gene is MELO3C002429.2, named CmANK, and is located on chromosome 12;

[0010] The molecular marker is SNP24072061, located in the fifth exon of the CmANK gene, which is a non-synonymous mutation from base G to C, causing the amino acid sequence to mutate from Arg to Gly;

[0011] The full length of the MELO3C002429.2 coding region is 1953 bp, and SNP24072061 is located at 1888 bp.

[0012] Preferably, the melon varieties are 'Pelita' and 'M120'.

[0013] The present invention also provides primers for amplifying the molecular marker co-segregated with the melon powdery mildew resistance gene, the sequences of which are shown in SEQ ID NOs: 1 to 3, specifically:

[0014] R: GCAGTGATCATCCTTCCACCT (SEQ ID NO: 1);

[0015] FAM-G: GAAGGTGACCAAGTTCATGCTGAAAACAGCTTAAATGCAATAT ATCCCG (SEQ ID NO: 2);

[0016] HEX-C: GAAGGTGACCAAGTTCATGCTGAAAACAGCTTAAATGCAATAT ATCCCC (SEQ ID NO: 3).

[0017] The present invention also provides a probe for marking the molecular marker co-segregated with the melon powdery mildew resistance gene, the sequence of which is shown in SEQ ID NO:4 and SEQ ID NO:5, specifically:

[0018] FAM-AGCGATGCGTTCGAGCATCGCTGCGATTAGCCGTTAGGATGA-Da bcyl (SEQ ID NO: 4);

[0019] HEX-AGGACGCTGAGATGCGTCCTGTCGGTGAACAGGTTAGAGA-Dabc yl (SEQ ID NO: 5).

[0020] The present invention also provides primers for amplifying the molecular marker co-segregated with the melon powdery mildew resistance gene, or primers with sequences as shown in SEQ ID NOs: 1 to 3, and their use in melon molecular marker-assisted breeding.

[0021] The present invention also provides application of the molecular marker co-segregated with the melon powdery mildew resistance gene in melon molecular marker-assisted breeding.

[0022] Preferably, the molecular markers are used for co-segregation of melon powdery mildew resistance genes, that is, the constructed F2 population genotyping is as follows:

[0023] The homozygous genotype CmANK / CmANK, with genotype C / C, shows resistance to powdery mildew;

[0024] Homozygous genotype Cmank / Cmank, genotype G / G, showing susceptibility to powdery mildew;

[0025] The heterozygous genotype CmANK / Cmank, genotype C / G, shows resistance to powdery mildew.

[0026] The present invention also provides a method for breeding a powdery mildew resistant melon variety, comprising the following steps:

[0027] (1) Extract DNA from young melon leaves;

[0028] (2) performing PCR amplification using the primers and labeling using the probe;

[0029] (3) Genotyping detection is performed after sequencing the amplified product; wherein:

[0030] The homozygous genotype CmANK / CmANK, with genotype C / C, shows resistance to powdery mildew;

[0031] Homozygous genotype Cmank / Cmank, genotype G / G, showing susceptibility to powdery mildew;

[0032] The heterozygous genotype CmANK / Cmank, with genotype C / G, showed resistance to powdery mildew;

[0033] (4) The melon seedlings with homozygous genotype CmANK / CmANK are used as parents for seedling cultivation, which is a melon variety resistant to powdery mildew.

[0034] Compared with the prior art, the present invention has the following beneficial effects: DNA is extracted from young melon leaves through the molecular marker provided by the present invention and co-segregated with the powdery mildew resistance gene of the melon to perform genotyping of different individual plants, and the powdery mildew resistance of the plant is predicted based on the genotyping result; analysis is performed by combining genotyping with powdery mildew phenotypic data and finding that the molecular marker is co-segregated with the powdery mildew resistance gene of the melon, indicating that the molecular marker can be used to perform genotyping on the plant at the seedling stage, and the powdery mildew resistance of each individual plant is predicted based on the typing result; at the same time, powdery mildew-resistant melon seedlings are cultivated with homozygous powdery mildew-resistant genotypes as parents, thereby improving the breeding efficiency of powdery mildew-resistant melons. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 This is a diagram showing the disease resistance identification of muskmelon 'Pelita' and 'M120' to powdery mildew at the adult stage in the example.

[0036] Figure 2 The frequency distribution diagram of the average disease index of the F2 group in the embodiment, disease classification: IV represents the disease index type, I 0≤DI<0.5; II 0.5≤DI<1.5; III 1.5≤DI≤2.5; IV 2.5 <DI≤3.5;V3.5<DI≤4。

[0037] Figure 3The four molecular markers in the example are polymorphic markers in the disease resistance gene pool and the disease susceptibility gene pool.

[0038] Figure 4 This is the precise positioning of the melon PM12.1 gene in the example; (A) the PM12.1 locus was located between PM12-22.7 and PM12-24.7 on chromosome 12 using a 138-strain F2 population; (B) the PM12.1 locus was located within a 107 kb interval between PM12-23.96 and PM12-24.07 on chromosome 12 using a 2353-strain F2 population.

[0039] Figure 5 The distribution of delta All-index of two offspring on chromosomes in the embodiment; horizontal axis: chromosome length (Mb); vertical axis: △ (All-index).

[0040] Figure 6 The structure and mutation site of CmANK (MELO3C002429.2) gene in the examples.

[0041] Figure 7 : is a scatter plot of the CmANK locus genotyping in the embodiment; the blue circle represents the homozygous genotype CmANK / CmANK, and the genotype is C / C; the red circle represents the homozygous genotype Cmank / Cmank, and the genotype is G / G; the green circle represents the heterozygous genotype CmANK / Cmank, and the genotype is C / G. DETAILED DESCRIPTION

[0042] In order to make the purpose, technical solution and advantages of the embodiment of the present invention clearer, the technical solution of the embodiment of the present invention will be clearly and completely described in conjunction with the drawings of the embodiment of the present invention. Obviously, the described embodiment is a part of the embodiment of the present invention, not all of the embodiments. Based on the described embodiment of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work belong to the scope of protection of the present invention.

[0043] The experimental methods in the following examples where specific conditions are not specified are generally performed under conventional conditions, such as those described in Sambrook et al. Molecular Cloning, Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989) or according to the conditions recommended by the manufacturer.

[0044] The primer and probe sequences used in the following examples are as follows:

[0045] Primer:

[0046] R: GCAGTGATCATCCTTCCACCT (SEQ ID NO: 1);

[0047] FAM-G: GAAGGTGACCAAGTTCATGCTGAAAACAGCTTAAATGCAATAT ATCCCG (SEQ ID NO: 2);

[0048] HEX-C: GAAGGTGACCAAGTTCATGCTGAAAACAGCTTAAATGCAATAT ATCCCC (SEQ ID NO: 3).

[0049] Probe:

[0050] FAM-AGCGATGCGTTCGAGCATCGCTGCGATTAGCCGTTAGGATGA-Da bcyl (SEQ ID NO: 4);

[0051] HEX-AGGACGCTGAGATGCGTCCTGTCGGTGAACAGGTTAGAGA-Dabc yl (SEQ ID NO: 5).

[0052] Example 1

[0053] 1. Identification of physiological races of melon powdery mildew

[0054] In 2021 and 2022, 13 internationally used Cucurbitaceae powdery mildew physiological race identification hosts were planted at the Qingpu Chonggu base of Shanghai Academy of Agricultural Sciences and inoculated with powdery mildew fungi. The resistance and sensitivity reactions of each identification host to powdery mildew were investigated and counted, and the statistical results are shown in Table 1. The resistance and sensitivity of the 13 Cucurbitaceae powdery mildew physiological race identification hosts in 2021 and 2022 were consistent, among which PMR 5, PMR 6, Edisto 47, WMR 29, PI 414723, MR-1, PI 124111 and PI 124112 were resistant to the powdery mildew strain, while Iran H, Védrantais, Top Mark, Nantais Oblong and PMR 45 were susceptible to the powdery mildew strain, indicating that the powdery mildew fungi in this example are P. xanthii physiological race 2F.

[0055] Table 1: Identification of dominant physiological races of powdery mildew fungi in Shanghai

[0056]

[0057]

[0058] 2. Analysis of inheritance pattern of powdery mildew resistance

[0059] Previous studies have found that the phenotype of melons during the natural disease stage in the adult stage can better reflect the true resistance of melon plants to powdery mildew. Therefore, the classification of disease resistance and identification of disease resistance in this example were carried out when the melons were naturally diseased during the adult stage. A preliminary analysis of the inheritance pattern of powdery mildew resistance was conducted using 138 F2 populations constructed by combining 'Pelita' and 'M120'. The results showed that in the adult stage, 'Pelita' showed high resistance to powdery mildew (no powdery mildew spots), while 'M120' showed susceptibility to powdery mildew ( Figure 1 ), their reciprocal cross F1 all showed high resistance to powdery mildew, close to the disease resistance of the resistant parent 'Pelita'. When 'M120' showed severe disease symptoms and the leaf surface was covered with a thick layer of powdery mildew, 'Pelita' and F1 strains had almost no disease symptoms on the leaf surface. In the F2 population, the resistance level to powdery mildew was continuous, but there was a trough at levels 1.5 to 2.5 (average disease index type III), and the disease resistance level tended to be bimodal, and the disease index distribution tended to be resistant to the disease type ( Figure 2 ). The above results indicate that the powdery mildew resistance of the parent 'Pelita' is controlled by a single major dominant resistance gene.

[0060] 3. Localization of the major gene for powdery mildew resistance

[0061] Before gene localization, powdery mildew resistance was analyzed by BSA according to the disease grade and disease resistance phenotype of each plant in the F2 population, and the chromosomal location of the major effect gene of powdery mildew resistance was preliminarily determined. First, based on the resequencing data of the parents 'Pelita' and 'M120', 98 pairs of InDel markers were developed that were evenly distributed on 12 chromosomes and polymorphic between the two parents. According to the BSA method and the disease grade of each plant in the F2 population, 20 highly resistant powdery mildew plants and 20 highly susceptible powdery mildew plants were selected from the Pelita X M120 F2 population to construct resistance and susceptibility gene pools. The pooled DNA was subjected to BSA analysis using the above 98 pairs of parental polymorphic InDel markers, and the results showed that 4 markers on chromosome 12 were polymorphic between the two pools ( Figure 3 ), and therefore believed that the major powdery mildew resistance gene in 'Pelita' was located in this region of chromosome 12, and this gene was named PM12.1. Then, 9 pairs of polymorphic markers located on chromosome 12 were selected for verification in a 138-strain Pelita×M120 F2 population, and the PM12.1 locus was finally located between PM12-22.7 and PM12-24.7 on chromosome 12 ( Figure 4 A).

[0062] To further narrow the distance of the PM12.1 locus on the chromosome, the F2 mapping population was expanded to 2353 strains, and 14 InDel markers were developed in the regions of PM12-22.7 and PM12-24.7. The PM12.1 locus was finally located between markers PM12-23.96 and PM12-24.07 ( Figure 4 B), their physical positions are 23,968,275 bp and 24,075,887 bp respectively, the physical distance between the two markers is 107 kb, and there are 17 genes in the interval (Table 2).

[0063] Table 2: Predicted genes between markers PM12-23.96 and PM12-24.07

[0064]

[0065] 4. BSA-seq method locates PM12.1

[0066] In order to quickly locate the candidate genes of PM12.1, the BSA-seq sequencing method was used to locate the candidate genes. 20 completely resistant to powdery mildew plants and 20 susceptible plants were selected from the F2 population obtained by hybridization of 'Pelita' and 'M120', and DNA of young leaves was extracted. Disease-resistant DNA pools and disease-susceptible DNA pools were constructed by equal mixing. The two DNA pools and parental DNA were sequenced using the Illumina HiSeq TM PE150 sequencing platform (Beijing Novogene Technology Co., Ltd.). High-throughput sequencing (such as Illumina HiSeq TM / Miseq TM) The raw image data files obtained by CASAVA base calling analysis were converted into raw sequenced reads, which are called Raw Data or RawReads. The raw sequenced reads or raw reads obtained by sequencing contain low-quality reads with adapters. In order to ensure the quality of information analysis, the sequencing data must be filtered, sorted and quality evaluated to obtain high-quality clean reads. Then, the effective sequencing data are aligned to the reference genome through BWA software. For 'Pelita' and 'M120', the numbers of clean reads obtained after filtering the disease-resistant DNA pool and the disease-susceptible DNA pool were 51.2M, 53.4M, 163.7M and 145.9M, respectively. These clean reads were aligned to the melon CM3.6.1_pseudomol reference genome. 'Pelita' covered 98.67% of the entire genome, 'M120' covered 98.84% of the entire genome, the disease-resistant DNA pool covered 98.73% of the entire genome, and the disease-susceptible DNA pool covered 98.77% of the entire genome.

[0067] In order to locate the target trait, SNPs were calculated using the parents 'Pelita' and 'M120', the disease-resistant DNA pool and the disease-susceptible DNA pool, and a total of 436,021 polymorphic marker sites were obtained after filtering. In order to intuitively reflect the area of ​​difference between the two progeny pools, the difference in All-index of the two progeny was calculated: △(All-index) = Allindex(S2)-Allindex(S1). Then, 1Mb was selected as the window and 1kb as the step size, and the average value of △(All-index) in each window was calculated to reflect the distribution of △(All-index); combined with the population type (F2 / RIL) and the number of progeny pools, 1000 permutation tests were performed, and the 99% confidence level was selected as the threshold line. The window above the confidence level is the candidate interval, and the candidate interval is located within the 2.3Mb interval of chromosome 12 (22.6M~24.9M). The distribution of △(All-index) on the chromosome (Manhattan diagram) is shown in the figure. Figure 5As shown. In order not to ignore the influence of minor QTL, two SNP or InDel sites with significant differences in SNP-index or InDel-index were selected in the whole genome, that is, the sites with SNP-index or InDel-index greater than or equal to 1.0 in progeny 2 (extreme trait B) and SNP-index or InDel-index less than or equal to 0.0 in progeny 1 (extreme trait A) were selected. For the 122 candidate polymorphic marker sites, the annotation results of ANNOVAR were extracted, and genes with important mutation sites such as upstream, stop loss, stop gain, non-synonymous mutation, and alternative splicing were preferentially selected as candidate genes. Only 4 candidate SNP sites in this interval had non-synonymous mutations (Table 3).

[0068] Bioinformatics prediction and functional annotation of the genomic sequence of the positioning interval on the reference genome (Cucumber Genome Database) revealed a total of 3 predicted genes (Table 3). The genomic DNA sequences of the 3 genes in 'Pelita' and 'M120' were sequenced and analyzed. Only one SNP (24072061) was located in the positioning interval, and there was only one SNP located at MELO3C002429.2 SNP24072061 had differences in the DNA base sequences of the parents 'Pelita' and 'M120', and the 3 SNPs (23398060, 23398065 and 24344059) of the other two genes had no differences in the DNA base sequences of the parents 'Pelita' and 'M120'. Therefore, based on the genetic analysis and sequencing results, SNP24072061 was identified as the only target mutation site. The full length of the MELO3C002429.2 coding region is 1953 bp, and SNP24072061 is located at 1888 bp. This site is located in the fifth exon of the gene MELO3C002429.2, and the base G mutates to C. This is a non-synonymous mutation, which causes the amino acid sequence to mutate from arginine (Arg) to glycine (Gly) ( Figure 6 ).

[0069] Through the annotation information of melon and Arabidopsis, it was found that the homologous gene of MELO3C002429.2 in Arabidopsis is AT5G35810.1, which belongs to the Ankyrin repeat family protein. In Arabidopsis, ankyrin can mediate the interaction of disease resistance-related proteins and participate in the transmission of disease resistance signals. Recently, the role of TaANKTM genotype in wheat powdery mildew resistance was verified by barley stripe mosaic virus-induced gene silencing technology (BSMV-VIGS). The results showed that TaANKTM2A-5 gene silencing reduced the powdery mildew resistance of common wheat "Bai Nongkang 58" (AK58). The above studies show that ANKTM-type genes are involved in basic resistance or effect-triggered immunity. Therefore, through the comparison of gene sequences in the localization interval and the analysis of candidate gene functions, it is speculated that the gene MELO3C002429.2 may be a candidate gene for melon powdery mildew resistance, named CmANK.

[0070] Table 3: SNPs of candidate genes analyzed by BSA-seq method

[0071] chromosome Physical location (bp) Ref / Alt Mutation type Gene Gene annotation Chr12 23398065 G / C nonsynonymous MELO3C002529.2 Serine / threonine-protein Chr12 23398160 C / T nonsynonymous MELO3C002529.2 Serine / threonine-protein / Chr12 24072061 G / C nonsynonymous MELO3C002429.2 Ankyrin Chr12 24344059 T / C nonsynonymous MELO3C002394.2 LRR

[0072] 5. Analysis of variation of candidate genes in natural population materials

[0073] In order to analyze whether the above mutation site exists in other melon inbred lines and affects their powdery mildew resistance, 17 melon inbred lines were identified for powdery mildew resistance and genotype identification (CmPMR1 and tCmANK). First, 17 melon inbred lines were identified for powdery mildew resistance in the field at the mature plant stage. The powdery mildew resistance phenotypes of the 17 melon inbred lines are shown in Table 4. Then, the sequences of CmPMR1 and CmANK in the 17 melon inbred lines were analyzed (Table 4). Among the 17 melon inbred lines, 6 melon inbred lines had a genotype background (CmPMR1 / CmPMR1), and 11 melon inbred lines had a genotype background (Cmpmrl / Cmpmrl). Among the 8 melon inbred lines with the genotype CmPMR1 / CmPMR1, 3 melon inbred lines showed complete resistance to powdery mildew (2 with genotypes CmPMR1 / CmPMR1 and CmANK / CmANK and 1 with genotypes CmPMR1 / CmPMR1 and CmANK / Cmank), while the other 5 melon inbred lines (with genotypes CmPMR1 / CmPMR1 and Cmank / Cmank) showed a phenotype of early resistance to powdery mildew and late susceptibility to powdery mildew. Consistent with their phenotypes, the gene sequences of all disease-resistant inbred lines were consistent with the gene sequence of the disease-resistant parent 'Pelita', and the gene sequences of all early resistance to powdery mildew and late susceptibility to powdery mildew inbred lines were consistent with the gene sequence of the susceptible parent 'M120'. These results indicate that when the background is the CmPMRl / CmPMRl genotype, the complete resistance to powdery mildew in the melon inbred line is co-segregated with the SNP variation site in CmANK, which indirectly indicates that the CmANK gene is a dominant powdery mildew resistance gene.

[0074] In addition, among the 9 melon inbred lines with the Cmpmrl / Cmpmrl genotype, the gene sequence of all 9 melon inbred lines was Cmank / Cmank, and all 9 melon inbred lines were susceptible to powdery mildew. The above results show that only when both CmPMR1 and CmANK are disease-resistant genotypes (CmPMR1 / CmPMR1-CmANK / CmANK) can melon show complete resistance to powdery mildew.

[0075] Table 4: Powdery mildew resistance phenotypes of 17 melon materials and genotypes of CmPMR1 and CmANK

[0076]

[0077] 6.FRET + Co-segregation analysis of genotyping markers

[0078] To verify whether SNP24072061 is associated with the CmANK locus, a FRET + Genotyping Label FRET+ -CmANK. The F2 population was constructed by self-pollination with Zlo being heterozygous at the CmANK locus. FRET was used in the 123 F2 populations. + 2×Master Mix was used to perform real-time fluorescence quantitative PCR detection on the designed primers. After obtaining the raw data, the SNP typing software was used to open the raw data, and three genotyping values ​​were set to obtain a specific site scatter plot. The blue circle represents the homozygous genotype CmANK / CmANK, and the genotype is C / C; the red circle represents the homozygous genotype Cmank / Cmank, and the genotype is G / G; the green circle represents the heterozygous genotype CmANK / Cmank, and the genotype is C / G. Among them, 33 strains have a homozygous genotype of C / C, which is resistant to powdery mildew; 62 strains have a heterozygous genotype of C / G, which is resistant to powdery mildew; 28 strains have a homozygous genotype of G / G, which is susceptible to powdery mildew. The results showed that the marker was co-segregated with the target trait ( Figure 7 ).

[0079] The above description of the embodiments is to facilitate the understanding and use of the invention by those skilled in the art. It is obvious that those skilled in the art can easily make various modifications to these embodiments and apply the general principles described herein to other embodiments without creative work. Therefore, the present invention is not limited to the above embodiments, and improvements and modifications made by those skilled in the art based on the disclosure of the present invention without departing from the scope of the present invention should be within the scope of protection of the present invention.

Claims

1. A molecular marker co-segregating with a melon powdery mildew resistance gene, characterized in that: The powdery mildew resistance gene is MELO3C002429.2, named CmANK, and is located on chromosome 12; The molecular marker is SNP24072061, located in the fifth exon of the CmANK gene, which is a non-synonymous mutation from base G to C, causing the amino acid sequence to mutate from Arg to Gly; The full length of the MELO3C002429.2 coding region is 1953 bp, and SNP24072061 is located at 1888 bp.

2. The molecular marker co-segregating with the melon powdery mildew resistance gene according to claim 1, characterized in that: The melon varieties are 'Pelita' and 'M120'.

3. Primers for amplifying the molecular marker co-segregated with the melon powdery mildew resistance gene according to claim 1 or 2, characterized in that: The primer sequences are shown in SEQ ID NOs: 1-3.

4. A probe for detecting the molecular marker co-segregated with the melon powdery mildew resistance gene, characterized in that: The probe sequences are shown in SEQ ID NO:4 and SEQ ID NO:

5.

5. Use of primers for amplifying the molecular marker co-segregated with the melon powdery mildew resistance gene according to claim 1 or 2, or the primers according to claim 3 in melon molecular marker-assisted breeding.

6. Use of the molecular marker co-segregating with the melon powdery mildew resistance gene according to claim 1 or 2 in melon molecular marker-assisted breeding.

7. The use according to claim 6, characterized in that: The molecular markers are used for co-segregation of melon powdery mildew resistance genes, that is, the constructed F2 population genotyping is as follows: The homozygous genotype CmANK / CmANK, with genotype C / C, showed resistance to powdery mildew; Homozygous genotype Cmank / Cmank, genotype G / G, showing susceptibility to powdery mildew; The heterozygous genotype CmANK / Cmank, genotype C / G, shows resistance to powdery mildew.

8. A method for breeding a powdery mildew resistant melon variety, characterized in that: The steps include: (1) Extract DNA from young melon leaves; (2) using the primers described in claim 3 for PCR amplification and labeling with the probe described in claim 4; (3) The obtained amplified product is sequenced and then subjected to genotyping detection; wherein: The homozygous genotype CmANK / CmANK, with genotype C / C, shows resistance to powdery mildew; Homozygous genotype Cmank / Cmank, genotype G / G, showing susceptibility to powdery mildew; The heterozygous genotype CmANK / Cmank, with genotype C / G, showed resistance to powdery mildew; (4) The melon seedlings with homozygous genotype CmANK / CmANK are used as parents for seedling cultivation, which is a melon variety resistant to powdery mildew.

Images