KASP molecular markers related to maize ear height under drought conditions and their application

Abstract

The present invention provides a KASP molecular marker related to the trait of corn ear height under drought conditions and its application, belonging to the technical field of molecular genetics. The present invention obtains a polymorphic SNP marker site related to the trait of ear height under drought conditions through whole genome association analysis, the SNP marker site refers to the corn B73 RefGen_v4 genome, and there is a nucleotide polymorphism T / C at position 147243591 of chromosome 10, C is a dominant trait, and the nucleotide sequence of the primer set for amplifying the KASP molecular marker is shown in SEQ ID NO.1-3. The present invention uses KASP typing technology to quickly, simply and efficiently perform genotyping identification, without enzyme cutting and electrophoresis, and can accurately identify and select in the seedling stage, which can reduce a large amount of breeding workload, shorten the cycle of corn ear height breeding selection, and can be used for molecular marker-assisted breeding of corn ear height.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular genetics, and in particular relates to a KASP molecular marker associated with a corn ear height trait under drought conditions and an application thereof. Background Art

[0002] corn( zea mays L.) is an important food crop in my country, and it also plays an important role in other fields such as industry and energy. With the continuous increase of my country's population and the development of corn-related industries such as animal husbandry and new energy, the demand for corn has increased year by year. Northwest, Southwest, North China and Northeast China are the main corn producing areas in my country, with the characteristics of large water evaporation, rapid loss and uneven precipitation. In recent years, droughts have occurred frequently in these areas and have become increasingly serious. Drought stress is an important abiotic stress that has an adverse effect on corn production. It changes various aspects of corn plants, such as morphology and physiology. Drought stress can affect the plant height and ear height of corn. Appropriate plant height and ear height can improve the plant structure of corn, increase nutrient utilization and photosynthesis capacity, and improve the ability of corn plants to transport and distribute photosynthetic products to the ear, thereby increasing the harvest index of corn per plant, and ultimately achieving the goal of high and stable yields.

[0003] Genome wide association study (GWAS) is a reliable method to efficiently detect genetic variation of complex traits in different species and to find markers or genes associated with them. This method has been used to study complex traits caused by a large number of genetic variations in different populations and helps to determine the connection between phenotypic information and genetic background. The development of KASP molecular markers related to ear height of maize under drought conditions through GWAS technology provides an effective molecular tool for precision breeding of maize. Summary of the invention

[0004] The technical problem to be solved by the present invention is to develop a KASP molecular marker related to the corn ear height trait under drought conditions and its application to solve the problems existing in the above-mentioned prior art. In the field of corn molecular genetics technology, it can be used to screen new corn varieties with higher ear height at the seedling stage.

[0005] Specifically, the present invention uses genome-wide association analysis to obtain a SNP site SNP_Chr10_147243591 that is significantly associated with the corn ear height trait under drought conditions. 10 The (P.value) value is 4.1, and the phenotypic explanation rate is 6.1%. The locus is located at 147243591 on chromosome 10 of the maize B73 RefGen_v4 reference genome. Its nucleotide polymorphism is T / C. Zm00001d026501In the intron of the gene (Chr10: 147240629-147249381), the polymorphism of this SNP site was significantly associated with ear height in the tested corn materials.

[0006] The KASP molecular marker of the present invention is located at the 147243591th base of chromosome 10 of maize, and the base difference is T / C. The maize material with base C has a higher ear height, and the maize material with base T has a lower ear height. When C is expressed as a polymorphism, it is a dominant trait.

[0007] Furthermore, the present invention also provides a primer set for detecting KASP molecular markers for identifying corn ear height under drought conditions, comprising two specific forward primers and a universal reverse primer; the nucleotide sequences of the two specific forward primers are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively, and the nucleotide sequence of the universal reverse primer is shown in SEQ ID NO.3. The specific primer sequences are as follows:

[0008] SNP_Chr10_147243591_F1 (SEQ ID NO.1):

[0009] 5'- GAAGGTGACCAAGTTCATGCT TGCGGAATGGCACAAAAGGGCTGAT-3',

[0010] SNP_Chr10_147243591_F2 (SEQ ID NO.2):

[0011] 5'- GAAGGTCGGAGTCAACGGATT TGCGGAATGGCACAAAAGGGCTGAC -3',

[0012] SNP_Chr10_147243591_R (SEQ ID NO.3):

[0013] 5'-GGCAACAACGTTTTGGTACTTCCCATCGC-3',

[0014] in, GAAGGTGACCAAGTTCATGCT It is a universal tag for FAM fluorescent linker sequence; GAAGGTCGGAGTCAACGGATT It is a universal tag for HEX fluorescent linker sequences.

[0015] The present invention also provides a biological detection product containing the KASP molecular marker detection primer set, and the product is a detection reagent or a kit.

[0016] The present invention also provides the application of the above method in molecular marker-assisted breeding.

[0017] Furthermore, the present invention provides applications of the above-mentioned KASP molecular marker and KASP molecular marker detection primer set, specifically including but not limited to any of the following applications:

[0018] (1) Identification of the ear height trait of maize under drought conditions;

[0019] (2) Maize molecular marker-assisted breeding;

[0020] (3) Improve corn germplasm resources;

[0021] (4) Detect and predict the height of corn ears.

[0022] The present invention also provides a method for identifying corn ear height and a method for corn genotyping. The detection principle is to use corn DNA to be detected as a template, use the KASP primer combination, and judge the corn ear height trait and the corn genotyping according to the fluorescence detection result after primer amplification.

[0023] The specific steps include:

[0024] Extract the corn DNA to be tested; dilute the DNA template to 30 ng / uL, add KASP 2X PCR mix, use the primer set to perform ordinary PCR amplification on the template, and use fluorescent quantitative PCR to read the amplification results to determine the height of the corn ear.

[0025] Preferably, the amplification reaction system, in 10 μL, includes: 5 μL of KASP 2X PCR mix, 0.5 μL of primer premix, and 4.5 μL of template DNA.

[0026] Preferably, the PCR amplification program is: pre-denaturation at 95°C for 10 min; denaturation at 95°C for 15 s, annealing and extension at 61°C for 60 s, 10 cycles, each annealing and extension temperature is reduced by 0.6°C; denaturation at 95°C for 15 s, annealing and extension at 55°C for 60 s, 30 cycles; fluorescence quantitative PCR at 37°C for 60 s, collecting fluorescence signals.

[0027] In the present invention, if the universal tag detected is a FAM fluorescent linker sequence, it is a TT genotype, and the corresponding corn material has a lower ear height; if the universal tag detected is a HEX fluorescent linker sequence, it is a CC genotype, and the corresponding corn material has a higher ear height; if the fluorescent linker sequences of the universal tags FAM and HEX are detected at the same time, it is a CT genotype, and the corresponding corn material has an intermediate ear height.

[0028] Beneficial effects of the present invention:

[0029] Compared with the prior art, the present invention has the following beneficial effects:

[0030] The present invention uses genome-wide association analysis to obtain a SNP site SNP_Chr10_147243591 that is significantly associated with the corn ear height trait under drought conditions. 10 The (P.value) value was 4.1, and the phenotypic explanation rate was 6.1%. The locus was located at 147243591 on chromosome 10 of the maize B73 RefGen_v4 reference genome. Its nucleotide polymorphism was T / C, located at Zm00001d026501 In the intron of the gene (Chr10: 147240629-147249381), the polymorphism of this SNP site was significantly associated with ear height in the tested corn materials.

[0031] The present invention utilizes the KASP typing technology to rapidly, simply and efficiently perform genotyping identification without enzyme cutting and electrophoresis, and can accurately identify and select in the seedling stage, thereby reducing a large amount of breeding workload, shortening the cycle of corn ear height breeding selection, and can be used for molecular marker-assisted breeding of corn ear height. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 This is the result of genome-wide association analysis of ear height trait in maize under drought stress conditions, and the Manhattan plot based on Blink model analysis.

[0033] Figure 2 This is a box plot of haplotype analysis of ear height trait corresponding to different genotyping at site SNP_Chr10_147243591 in 196 multi-parent DH lines.

[0034] Figure 3 The KASP genotyping results of ear height of 18 maize materials; each material was repeated twice, the horizontal axis represents the genotype CC, represented by a square; the vertical axis represents the genotype TT, represented by a triangle; the three controls NTC are represented by ×. DETAILED DESCRIPTION

[0035] In order to better understand the technical content of the present invention, specific examples are provided below. Unless otherwise specified, the technical means used in the examples are conventional methods. The reagents used in the examples, unless otherwise specified, can be obtained from commercial channels. The corn materials used in the present invention can all be obtained from the College of Agriculture of China Agricultural University.

[0036] Example 1 GWAS analysis and haplotype analysis of ear height trait

[0037] 1.1 Field experiment design

[0038] The DH population used in the present invention is a total of 196 high-quality maize inbred lines collected from various breeding units across the country, with rich genetic backgrounds and wide sources. In 2020, the test materials were planted in Urumqi, Xinjiang and Yulin, Shaanxi, respectively, and two treatments were set up: water area (normal irrigation) and drought area (half-quantity irrigation). The amount of water in the drought area was half of that in the water area. The field test adopted an alpha design, with two rows planted in each plot and repeated twice. Except for the water treatment, the rest of the field management remained consistent.

[0039] 1.2 Phenotypic data

[0040] The present invention selects the ear height trait of corn, randomly selects 8 plants in each plot, and measures the average height from the ground to the top of the ear growth position as the ear height, expressed in centimeters (cm). The R package lmer is used to perform BLUE estimation on the ear height data under drought conditions, and the analysis model is:

[0041] .

[0042] 1.3GWAS analysis and SNP site determination

[0043] After resequencing quality control, 176,675 high-quality SNPs data were obtained from 196 multi-parent DH materials. Combined with the phenotypic values ​​of maize ear height determined above, GWAS analysis was performed using the Blink model of the R package GAPIT. The threshold was corrected by Bonferroni. 10 (P.value) = 4 was used as the threshold to determine the significantly associated SNPs. The results obtained were a significant locus located on chromosome 10 SNP_Chr10_147243591 (see the specific results for details). Figure 1 ), this site is significantly correlated with the ear height of corn, and its nucleotide polymorphism is T / C. 10 The (P.value) value was 4.1, and the phenotypic explanation rate (PVE) was 6.1%. The information of this SNP is shown in Table 1.

[0044] Table 1 Information on significant association loci related to maize ear height traits

[0045]

[0046] 1.4 Haplotype analysis

[0047] Haplotype analysis combining SNP variant sites with ear height traits of 196 tested maize materials ( Figure 2). Among them, SNP site variation typing is divided into two categories. Specifically combined with the base T / C difference, 178 materials with genotype TT have lower ear height, and 18 materials with genotype CC have higher ear height. The difference analysis of ear height between the two haplotypes and phenotypes is 0.0058, which is significantly different (P<0.01). The ear height of the CC genotype is significantly higher than that of the TT genotype corn materials.

[0048] Example 2 Development and application of KASP molecular markers related to ear height traits

[0049] 2.1 Test materials

[0050] The developed KASP molecular markers were used to verify the accuracy of the 18 selected core materials with obvious differences in ear height. The specific information of the materials used is shown in Table 2, including 9 materials with higher ear height and 9 materials with lower ear height.

[0051] Table 2 Ear height data and genotypes of 18 maize materials

[0052]

[0053] 2.2 Development of KASP Marker

[0054] According to the SNP site information obtained above, there is a SNP mutation at position 147243591 of chromosome 10 of the reference genome B73 RefGen_v4, and the polymorphism is T / C. The 100 bp flanking sequence before and after the site is extracted and primers are designed. The KASP molecular marker consists of 3 primers, including 2 specific forward primers SEQ ID NO.1 and SEQ ID NO.2, and 1 universal reverse primer SEQ ID NO.3. The primers were commissioned to Shanghai Bioengineering for synthesis. The primer sequences are as follows:

[0055] SNP_Chr10_147243591_F1 (SEQ ID NO.1):

[0056] 5'- GAAGGTGACCAAGTTCATGCT TGCGGAATGGCACAAAAGGGCTGAT-3',

[0057] SNP_Chr10_147243591_F2 (SEQ ID NO.2):

[0058] 5'- GAAGGTCGGAGTCAACGGATT TGCGGAATGGCACAAAAGGGCTGAC -3',

[0059] SNP_Chr10_147243591_R (SEQ ID NO.3):

[0060] 5'-GGCAACAACGTTTTGGTACTTCCCATCGC-3',

[0061] in, GAAGGTGACCAAGTTCATGCT It is a universal tag for FAM fluorescent linker sequence; GAAGGTCGGAGTCAACGGATT It is a universal tag for HEX fluorescent linker sequences.

[0062] 2.3 DNA extraction

[0063] Eighteen fresh leaves of corn seedlings were used as materials to extract DNA using the CTAB method. The detailed steps are as follows:

[0064] (1) Take about 5 g of corn leaves, place them in a 2 mL centrifuge tube, add 2 sterilized steel balls, freeze them in liquid nitrogen, and quickly place them in an automatic sample grinder, and shake them for 30 seconds;

[0065] (2) Add 800 μl of heated CTAB buffer (with mercaptoethanol added) and gently stir to mix well;

[0066] (3) Place in a 65°C water bath, invert the sample every 10 minutes to mix, and take it out after 30 minutes;

[0067] (4) After the sample is taken out and cooled to a constant temperature, add 800 ul of chloroform:isoamyl alcohol (24:1), shake and mix, and centrifuge at 12000 rpm for 15 min;

[0068] (5) Pipette the supernatant into a new 2 ml centrifuge tube, add 600 μl of isopropanol, shake well, and place at -20°C for 20 min. Centrifuge at 4°C, 12,000 rpm for 15 min.

[0069] (6) Add 800 μl of 70% ethanol to suspend the precipitate; centrifuge at 12,000 rpm for 10 min at room temperature;

[0070] (7) Discard the supernatant and add 1 ml of anhydrous ethanol to suspend the precipitate. Centrifuge at 12,000 rpm for 10 min. Open the lid and wait for the residual ethanol to evaporate at room temperature. Add 50 μL of ddH2O to dissolve the DNA.

[0071] (8) Agarose electrophoresis: DNA integrity was detected by 1% agarose gel (60 V electrophoresis for 35 min). The concentration of all DNA samples was measured by NanoDrop and the OD value 260 / 280 ratio was evaluated to be between 1.8 and 2.0.

[0072] 2.4 KASP classification

[0073] The DNA concentration of the samples to be tested was diluted to 30 ng / ul, and each DNA sample was repeated twice for KASP typing. KASP molecular marker PCR amplification reaction system: KASP 2X PCR mix 5 μL, primer premix 0.5 μL (primers SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO.3 with a concentration of 10 μM were mixed in a volume ratio of 2:2:5), template DNA 4.5 μL, total reaction volume 10 μL;

[0074] The PCR amplification procedure was as follows: pre-denaturation at 95 °C for 10 min; the first step of amplification reaction was denaturation at 95 °C for 15 s, annealing and extension at 61 °C for 60 s, and cycled 10 times, with the annealing and extension temperature decreasing by 0.6 °C each time; the second step of amplification reaction was denaturation at 95 °C for 15 s, annealing and extension at 55 °C for 60 s, and cycled 30 times.

[0075] After the reaction, the PCR product was obtained and the fluorescence was collected at 37 degrees using QuantStudioTM Design Analysis Software v1.5.2 real-time fluorescence quantitative PCR instrument, and the PCR product was typed. The typing results were compared with the resequencing variation results of the SNP_Chr10_147243591 site, and it was found that the consistency rate between the site variation type detected by the KASP molecular marker and the resequencing variation results was 100%, indicating that the KASP marker for this SNP site was successfully developed ( Figure 3 ).

[0076] According to the color classification displayed by the fluorescence quantitative PCR instrument, the samples aggregated close to the X-axis are genotype CC connected to the HEX fluorescent label sequence, which is displayed in red and represented by a square; the samples aggregated close to the Y-axis are genotype TT connected to the FAM fluorescent label sequence, which is displayed in blue and represented by a triangle, and the three control NTCs are represented by ×.

[0077] The actual situation is consistent with the expectation, so the KASP molecular marker of the present invention can effectively identify the corn ear height trait and can be used for the prediction and screening of corn varieties with higher ear height under drought conditions.

[0078] Of course, the above description is not a limitation of the present invention, and the present invention is not limited to the above examples. Any changes, modifications, additions or substitutions made by ordinary technicians in this technical field within the essential scope of the present invention should fall within the protection scope of the present invention.

Claims

1. Application of a reagent for detecting KASP molecular markers associated with corn ear height trait under drought conditions in molecular assisted breeding of corn ear height trait, characterized in that: The SNP marker site of the KASP molecular marker is named SNP_Chr10_147243591. The molecular marker is developed for position 147243591 of chromosome 10 of the maize B73 RefGen_v4 reference genome. Its nucleotide polymorphism is T / C, and when the polymorphism is C, it is a dominant trait. If the site polymorphism of the KASP molecular marker is C, the height of the corn ear is high; if the polymorphism is T, the height of the corn ear is low; If the genotype of the corn plant is CC, the ear height is higher; if the genotype of the corn plant is CT, the ear height is at an intermediate level; if the genotype of the corn plant is TT, the ear height is lower.

2. The KASP primer set for identifying the high ear position trait of corn under drought conditions is used in any of the following applications: (1) Identification of the ear height trait of maize under drought conditions; (2) Maize molecular marker-assisted breeding; (3) Improve corn germplasm resources; (4) Detect and predict the height of corn ears; The KASP primer set includes two specific forward primers and a universal reverse primer for amplifying the site of the KASP molecular marker according to claim 1, the nucleotide sequences of the two specific forward primers are shown as SEQ ID NO.1 and SEQ ID NO.2 respectively, and the nucleotide sequence of the universal reverse primer is shown as SEQ ID NO.

3.

3. A method for identifying the height trait of corn cobs under drought conditions, characterized in that: The following steps are involved: Extracting DNA from corn samples to be tested; Using the DNA as a template, using the KASP primer set of claim 2, adding a KASP genotyping mixture, configuring a KASP reaction system, performing PCR amplification, performing fluorescence detection based on the obtained PCR amplification product, determining the ear height and genotyping of corn, and reading and exporting the data; If the amplification result shows that the genotype of the KASP molecular marker of claim 1 is CC, the ear height of the corn material to be tested is relatively high; if the genotype is CT, the ear height of the corn material to be tested is at an intermediate level; if the genotype is TT, the ear height of the corn material to be tested is relatively low.

4. The method according to claim 3, characterized in that The amplification reaction system comprises: KASP 2X PCR mix 5μL, primer premix 0.5μL, template DNA 4.5μL; the PCR amplification program is: 95℃ pre-denaturation for 10min; 95℃ denaturation for 15s, 61℃ annealing and extension for 60s, 10 cycles, each annealing and extension temperature is reduced by 0.6℃; 95℃ denaturation for 15s, 55℃ annealing and extension for 60s, 30 cycles; fluorescence quantitative PCR at 37℃ for 60s, and collecting fluorescence signals.

Images