Replication type retrovirus detection primer and method

Abstract

The invention relates to a primer and a method for detecting replication type retroviruses (RCR), and particularly provides a primer group capable of rapidly detecting the RCR in a sample, and methodological verification shows that the primer group has excellent specificity, sensitivity and durability. The method provided by the invention conforms to the provisions of 'Technical Guiding Principles for Pharmaceutical Research and Evaluation of Human Stem Cell Products (Trial)' published by the Drug Administration of State Drug Administration; the RCR detection requirement of a gene therapy product based on a retroviral vector in the industry guide of Retroviral Vector-based Human Gene Therapeutic Product Test on Replication Capability Retrovirus during Product Production and Patient Follow-up, published by the Food and Drug Administration FDA, is referred; the RCR detection primer and the method disclosed by the invention are developed, so that the period and the cost for detecting and releasing related gene treatment products such as immune cell treatment products such as CAR-T and CAR-NK can be effectively reduced.

Description

Technical Field

[0001] The present invention relates to the field of biological detection, and in particular to the detection of replicative retroviruses. Background Art

[0002] With the development of viral molecular biology and structural biology, people's deeper understanding of viruses has provided a stable theoretical basis for gene therapy and promoted the widespread application of viral vectors in clinical research. γ-retroviral vector is the first viral vector to enter clinical research, and the feasibility and safety of viral vectors in gene therapy have been evaluated. As of 2012, 2 / 3 of clinical trials still used viral vectors, of which retroviral vectors accounted for 19.7%. Among them, γ-retroviral vectors are a type of RNA virus, many of which are pathogenic, such as Murine leukaemia virus and Feline leukaemia virus, so the safety of viral vectors used in gene therapy products should be evaluated.

[0003] An important consideration is that retroviruses can integrate foreign genes into the cell genome, which may cause insertional mutagenesis, causing changes in the cell gene sequence and long-term effects on cell gene expression. For example, upregulation of cell gene expression near the proto-oncogene when the integration site is located can change cell growth, affect changes in the host cell genotype and phenotype, and lead to activation of endogenous viruses. In gene therapy for severe immunodeficiency syndrome SCID-X1, it has been reported that retroviral vector genes were integrated near the LMO2 proto-oncogene promoter, resulting in disordered LMO2 expression and uncontrolled cell proliferation, and these integrations were non-random; in gene therapy for X-linked chronic granulomatous disease X-CGD, some patients developed leukemia or myelodysplasia. These events have prompted the development of safer retroviral vector designs, such as the design of the self-inactivating γ-retroviral vector SIN-γRV. However, replication-defective self-inactivating retroviral vectors contain the ability to infect and transport genes, so there is still the possibility of integration events. Therefore, it is still necessary to monitor the presence of replication-competent retroviruses (RCR) during related gene therapy processes.

[0004] Due to the increase in clinical trials using γ-retroviral vectors, the European Medicines Agency (EMA) made requirements for virus safety in the European Commission Directive 2003 / 63 / EC in 2003, including safety assessment, requiring patient samples and final drugs to be traceable, non-replicating virus fluids to contain no replicating viruses, monitoring patients for possible infections and related sequelae throughout and after treatment, and monitoring those who frequently come into contact with patients, such as medical staff. In 2006, the U.S. Food and Drug Administration (FDA) issued guidance on RCR testing of gene therapy products based on retroviral vectors. The document recommended in detail the relevant testing methods, the content and amount of RCR testing required in the production process, and issued a new draft guidance document in 2018, which still has clear requirements for RCR testing. In 2017, my country's State Food and Drug Administration (CFDA) issued the "Technical Guidelines for Research and Evaluation of Cell Therapy Products" (Trial Implementation). For cell therapy products using gene modification, attention should be paid to the production of replication-competent viruses (RCV) and insertion mutations, especially the activation of oncogenes. The risk of RCV formation can be assessed during the production quality assessment stage, and the risk of insertion mutation caused by it should be evaluated. Relevant laws, regulations and guidance documents are being gradually improved. Taking into account the requirements of relevant laws, regulations and guidance documents, we mainly refer to the relevant guidance documents issued by the FDA for the development and method validation of RCR detection methods. Summary of the invention

[0005] The present invention provides a primer set for detecting whether a replicative retrovirus is present in a sample, characterized in that the forward primer of the primer set has at least or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity with SEQ ID NO:1, and the reverse primer of the primer set has at least or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity with SEQ ID NO:2.

[0006] In one or more embodiments, the forward primer of the primer set has or is about 90%, 90.9%, 95%, 95.2% or 100% identity to SEQ ID NO:1; the reverse primer of the primer set has or is about 91.3%, 92%, 95.7%, 95.8% or 100% identity to SEQ ID NO:2.

[0007] In one or more embodiments, the primer set further comprises a probe having no less than 85% identity to SEQ ID NO: 3. In one or more embodiments, the probe has or is about 86.7%, 88.2%, 93.3%, 93.8% or 100% identity to SEQ ID NO: 3.

[0008] The present invention also provides use of the primer set described in any of the above embodiments in preparing a reagent for detecting whether a replicative retrovirus exists in a sample.

[0009] In one or more embodiments, the detection is based on a polymerase chain reaction (PCR) method. In one or more embodiments, the PCR method is selected from ordinary PCR (first generation PCR), real-time fluorescence quantitative PCR (Quantitative Real-time PCR, qPCR), real-time fluorescence quantitative reverse transcription PCR (Real-time RT-PCR, RT-qPCR) and digital PCR (Digital PCR, Dig-PCR, dPCR). In one or more embodiments, the real-time fluorescence quantitative PCR is a chimeric fluorescent dye method or a fluorescent probe method. In one or more embodiments, the fluorescent dye method uses a saturated fluorescent dye or an unsaturated fluorescent dye. In one or more embodiments, the fluorescent dye method uses SYBRGreenⅠ, Eva Green, LC Green or Pico Green, etc. In one or more embodiments, the fluorescent probe method is selected from TaqMan probe method, molecular beacon probe method, MGB probe method and LightCycler probe method.

[0010] In one or more embodiments, the retrovirus is a γ-retrovirus. In one or more embodiments, the γ-retrovirus contains a GaLV envelope. In one or more embodiments, the retrovirus is a γ-retrovirus with a Gibbon Ape Leukemia Virus (GALV) envelope protein as an envelope.

[0011] In one or more embodiments, the sample is genomic DNA or cDNA. In one or more embodiments, the sample is cDNA. In one or more embodiments, the genomic DNA or cDNA comes from a host cell of the retrovirus, and the host cell can produce the retrovirus. In one or more embodiments, the host cell of the retrovirus is a HEK293 cell.

[0012] The present invention also provides a kit for detecting whether a replicative retrovirus exists in a sample, wherein the kit comprises a primer set as described in any of the above embodiments.

[0013] In one or more embodiments, the primer sets are stored individually or mixed in a container (eg, an EP tube).

[0014] In one or more embodiments, the primers in the primer set are in solid or liquid form.

[0015] In one or more embodiments, the kit further comprises conventional components of a PCR reaction system. In one or more embodiments, the conventional components of the PCR reaction system are selected from dNTPs, PCR reaction buffer and DNA polymerase. In one or more embodiments, the kit further comprises a fluorescent probe for qPCR, and in certain embodiments, the fluorescent probe method is selected from TaqMan probes, molecular beacon probes, MGB probes and LightCycler probes.

[0016] In one or more embodiments, the kit comprises a retroviral host cell (a cell that can produce the virus). In one or more embodiments, the retroviral host cell is a HEK293 cell.

[0017] In one or more embodiments, the kit comprises a standard with a known copy number or concentration of the target gene or fragment.

[0018] The present invention also provides a method for detecting replicative retrovirus in a sample, wherein the method uses the primer set described in any one of the above embodiments.

[0019] In one or more embodiments, the method is based on a polymerase chain reaction (PCR) method. In one or more embodiments, the PCR method is selected from ordinary PCR (first generation PCR), real-time fluorescence quantitative PCR (Quantitative Real-time PCR, qPCR), real-time fluorescence quantitative reverse transcription PCR (Real-time RT-PCR, RT-qPCR) and digital PCR (Digital PCR, Dig-PCR, dPCR). In one or more embodiments, the real-time fluorescence quantitative PCR is a chimeric fluorescent dye method or a fluorescent probe method. In one or more embodiments, the fluorescent dye method uses a saturated fluorescent dye or an unsaturated fluorescent dye. In one or more embodiments, the fluorescent dye method uses SYBRGreenⅠ, Eva Green, LC Green or Pico Green, etc. In one or more embodiments, the fluorescent probe method is selected from TaqMan probe method, molecular beacon probe method, MGB probe method and LightCycler probe method.

[0020] In one or more embodiments, the retrovirus is a γ-retrovirus. In one or more embodiments, the γ-retrovirus contains a GaLV envelope. In one or more embodiments, the retrovirus is a γ-retrovirus with a Gibbon Ape Leukemia Virus (GALV) envelope protein as an envelope.

[0021] In one or more embodiments, the sample is genomic DNA or cDNA. In one or more embodiments, the sample is cDNA. In one or more embodiments, the genomic DNA or cDNA comes from a host cell of the retrovirus, and the host cell can produce the virus. In one or more embodiments, the host cell of the retrovirus is a HEK293 cell.

[0022] In one or more embodiments, the detecting of retrovirus in a sample is detecting whether retrovirus exists in the sample. In some other embodiments, the detecting of retrovirus in a sample is detecting the number or concentration of retrovirus copies in the sample.

[0023] The present invention also provides a method for detecting whether a biological product contains a replicative retrovirus, wherein the biological product uses or has been in contact with a γ-retrovirus containing a GaLV envelope during its preparation process, and the method comprises the following steps: co-culturing the biological product with a γ-retrovirus host cell containing a GaLV envelope, then extracting the γ-retrovirus host cell containing the GaLV envelope, and then using the primer set described in any of the above embodiments to detect whether the expression of the GaLV gene or protein is present in the γ-retrovirus host cell containing the GaLV envelope.

[0024] In one or more embodiments, the detection is based on a polymerase chain reaction (PCR) method. In one or more embodiments, the PCR method is selected from ordinary PCR (first generation PCR), real-time fluorescence quantitative PCR (Quantitative Real-time PCR, qPCR), real-time fluorescence quantitative reverse transcription PCR (Real-time RT-PCR, RT-qPCR) and digital PCR (Digital PCR, Dig-PCR, dPCR). In one or more embodiments, the real-time fluorescence quantitative PCR is a chimeric fluorescent dye method or a fluorescent probe method. In one or more embodiments, the fluorescent probe method is selected from TaqMan probe method, molecular beacon probe method, MGB probe method and LightCycler probe method.

[0025] In one or more embodiments, the detection is based on TaqMan probe method.

[0026] In one or more embodiments, the biological product is or contains an engineered immune cell. In one or more embodiments, the engineered immune cell uses or has been exposed to a γ-retrovirus containing a GaLV envelope during its preparation process. In one or more embodiments, the engineered immune cell is selected from CAR-T cells, TCR-T cells, CAR-NK cells, CAR-NKT cells, etc. In one or more embodiments, the engineered immune cell is co-cultured with a retroviral host cell, and then the RNA of the retroviral host cell is extracted and reversely transcribed into cDNA, and then the retroviral host cell is detected based on the qPCR method to determine whether GaLV expression exists in the retroviral host cell or the number of copies or expression of GaLV in the retroviral host cell. In one or more embodiments, the qPCR is a TaqMan probe method qPCR. In one or more embodiments, the TaqMan probe method qPCR reaction system includes:

[0027]

[0028]

[0029] In one or more embodiments, the TaqMan probe qPCR reaction procedure is: step 1, 95°C for 30 seconds, 1 cycle; step 2, 95°C for 5 seconds → 60°C for 34 seconds, 40 cycles; step 3, 95°C for 15 seconds → 60°C for 1 minute → 95°C for 15 seconds.

[0030] In one or more embodiments, the engineered immune cells are subjected to retroviral host cell culture medium acclimatization before co-culturing with retroviral host cells to allow the retroviral host cells to adapt to co-culturing with the engineered immune cells. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 : Trend graph of cellular plaque lesion positive rate versus dilution.

[0032] Figure 2 : Batch 1 anti-human CD19 T cells were co-cultured with HEK293 cells to amplify the GALV copy number in the genome.

[0033] Figure 3 : Batch 2 anti-human CD19 T cells were co-cultured with HEK293 cells to amplify the GALV copy number in the genome.

[0034] Figure 4 : Batch 3 anti-human CD19 T cells were co-cultured with HEK293 cells to amplify the GALV copy number in the genome. DETAILED DESCRIPTION

[0035] After extensive and in-depth research, the inventors of this application have revealed for the first time a primer set that can quickly detect replicative retroviruses in samples, which has been verified by the method to have excellent specificity, sensitivity and durability. The method of the present invention complies with the provisions of the "Technical Guidelines for Pharmaceutical Research and Evaluation of Human Stem Cell Products (Trial)" issued by the Drug Review Center of the State Food and Drug Administration, and refers to the requirements for RCR detection of gene therapy products based on retroviral vectors in the "Testing of Replication-Competent Retroviruses during Product Production and Patient Follow-up for Human Gene Therapy Products Based on Retroviral Vectors" industry guide issued by the U.S. Food and Drug Administration FDA, and has developed the RCR detection primers and methods described herein, which can effectively reduce the cycle and cost of detection and release of related gene therapy products such as CAR-T, CAR-NK and other immune cell therapy products.

[0036] Primer set

[0037] Disclosed herein is a primer set, wherein the forward primer of the primer set has no less than 90% identity with SEQ ID NO: 1, and the reverse primer of the primer set has no less than 90% identity with SEQ ID NO: 2.

[0038] In some embodiments, the forward primer of the primer set has at least or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO: 1, and the reverse primer of the primer set has at least or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO: 2. In some embodiments, the forward primer has 1-2 base substitutions compared to the nucleotide sequence shown in SEQ ID NO: 1 or increases or decreases 1-2 bases compared to the nucleotide sequence shown in SEQ ID NO: 1, preferably increases or decreases 1-2 bases in the 5' or 3' section of the nucleotide sequence shown in SEQ ID NO: 1. In some embodiments, the reverse primer has 1-2 base substitutions compared to the nucleotide sequence shown in SEQ ID NO: 2 or increases or decreases 1-2 bases compared to the nucleotide sequence shown in SEQ ID NO: 2, preferably increases or decreases 1-2 bases in the 5' or 3' section of the nucleotide sequence shown in SEQ ID NO: 2. In some embodiments, the forward primer of the primer set has or is about 90%, 90.9%, 95%, 95.2% or 100% identical to SEQ ID NO: 1. In some embodiments, the reverse primer of the primer set has or is about 91.3%, 92%, 95.7%, 95.8% or 100% identical to SEQ ID NO: 2.

[0039] In some embodiments, the primer set further comprises a probe, which has no less than 85% identity to SEQ ID NO:3. In some embodiments, the probe has at least or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO:3. In some embodiments, the probe has 1-2 base substitutions compared to the nucleotide sequence shown in SEQ ID NO:3 or increases or decreases 1-2 bases compared to the nucleotide sequence shown in SEQ ID NO:3, preferably increases or decreases 1-2 bases in the 5' or 3' section of the nucleotide sequence shown in SEQ ID NO:3. In some embodiments, the probe has or has about 86.7%, 88.2%, 93.3%, 93.8% or 100% identity to SEQ ID NO:3.

[0040] It is known in the art that the primer (or probe) can be replaced, increased or decreased in bases, or modified as long as it does not affect the binding of the primer (or probe) to the template chain, so the forward primer, reverse primer and probe of the primer set of the present application also include these situations. For example, the 5' end of the primer is modified, and the primer after the 5' end is phosphorylated can be used for connectors, cloning and gene construction, and ligase-catalyzed ligation reactions; the primer is biotin-labeled, which can be used for non-radioactive immunoassays to detect proteins, intracellular chemical staining, cell separation, nucleic acid separation, hybridization detection of specific DNA / RNA sequences, ion channel conformational changes, etc.; the primer is amino-modified for use in DNA chips (DNA Microarray) and multiple labeling diagnostic systems; the primer is thio-modified, and usually 2-5 bases of 5' and 3' can be selected for thio-modification, preferably 3 bases of 5' and 3' are selected for thio-modification, and thio-modified oligonucleotides are mainly used in antisense experiments to prevent degradation by nucleases. Primer modifications also include digoxigenin modification, thiol modification, spacer modification, and deoxyinosine (dI) modification.

[0041] The target gene of the primer set is the envelope gene of the gibbon ape leukemia virus GALV. In one or more embodiments, the forward primer and the reverse primer of the primer set completely match the fragment on the target gene.

[0042] Reagent test kit

[0043] A kit is disclosed herein, comprising a primer set as described in any embodiment of the present invention. The primer set is capable of hybridizing with a GALV target nucleic acid molecule. The kit may further comprise reagents for implementing the methods disclosed herein (e.g., DNA standards, buffers, polymerases, or agents to prevent contamination). The kit may also comprise a package insert, on which instructions for detecting GALV in a sample using the primer set as described in any embodiment of the present invention are recorded. On the other hand, the kit may also comprise other primer sets for determining the same gene target, or primer sets for detecting other gene targets. The kit may be produced in a variety of ways known in the art.

[0044] The kits provided herein can be used to detect RCR in a sample. In a specific embodiment, the kit includes a primer set and a probe specific for a target gene, wherein the target gene is a γ-retroviral gene and / or a gene for generating a γ-retroviral vector (such as a replication-defective γ-retroviral vector for gene delivery). In a specific embodiment, the target gene is GaLV.

[0045] Purpose / Method

[0046] The present invention provides a method for detecting whether there is a replicating retrovirus in a sample. The method uses a primer set as described in any of the above embodiments. Based on the primer set, the presence or absence of a retrovirus or the amount of a retrovirus in a sample can be detected by a PCR method. The PCR method includes but is not limited to ordinary PCR (first generation PCR), real-time fluorescence quantitative PCR (Quantitative Real-time PCR, qPCR), real-time fluorescence quantitative reverse transcription PCR (Real-time RT-PCR, RT-qPCR) and digital PCR (Digital PCR, Dig-PCR, dPCR). In some embodiments, the primer set herein is used to detect replicating retroviruses in a sample using a qPCR method.

[0047] qPCR is a method that adds fluorescent groups to the PCR reaction system, uses the accumulation of fluorescent signals to monitor the entire PCR reaction process in real time, and conducts quantitative analysis of the starting template. Depending on the fluorescent chemicals used, real-time fluorescent PCR can be divided into the chimeric fluorescent dye method and the fluorescent probe method.

[0048] The fluorescent dye method is to add an excess of fluorescent dye to the ordinary PCR reaction system. Fluorescent dyes basically do not emit light in the free state, and only release fluorescent signals after binding to double-stranded DNA. Therefore, in the PCR system, as the specific PCR product is amplified, the signal intensity generated by the dye incorporation into double-stranded DNA is positively correlated with the number of PCR products. Fluorescent dyes include saturated fluorescent dyes and unsaturated fluorescent dyes. The most commonly used dye molecule SYBR Green I is an unsaturated fluorescent dye, and Eva Green and Solis Green are saturated fluorescent dyes. The most widely used fluorescent probe in the fluorescent probe method qPCR is the Taqman probe. The Taqman technology is to add a specific fluorescent probe to the PCR amplification system while adding a pair of primers. The probe is a linear oligonucleotide, and the sequence of the probe itself is complementary to a certain sequence between the two primers of the target gene, thereby increasing the specificity of the reaction. A fluorescent reporter group is labeled at the 5' end, and a fluorescent quencher group is labeled at the 3' end. When the probe is complete, the fluorescent signal emitted by the reporter group is absorbed by the quencher group, and the PCR instrument cannot detect the fluorescent signal. When the PCR amplification reaction occurs, in the annealing stage, the probe binds to the complementary sequence of the target gene. In the reaction extension phase, the 5'-3' exonuclease activity of the Taq enzyme will degrade the probe, separate the reporter fluorescent group and the quencher group, so that the fluorescence monitoring system can receive the fluorescent signal, that is, each time a DNA chain is amplified, a fluorescent molecule is formed, and the accumulation of the fluorescent signal is completely synchronized with the formation of the PCR product. Available Taqman probe fluorescent reporter groups include FAM, TET, VIC, JOE, NED and HEX, etc., and available quencher groups include TAMRA, BHQ, MGB and ECLIPSE, etc. In some embodiments, the qPCR method herein is a fluorescent probe method, and in some embodiments, the qPCR method herein is a TaqMan fluorescent probe method.

[0049] In some embodiments, the sample to be tested is a gene (DNA or RNA) of a host cell of a γ-retrovirus. In some specific embodiments, the sample to be tested is a reverse transcription product of the total RNA of a HEK293 cell. By detecting the presence or absence of a retrovirus in a sample or its content, it is possible to indirectly know the presence or absence of a retrovirus in a sample related to an immune cell therapy product or its content, and the sample related to the immune cell therapy product may be an immune cell preparation that has been frozen and will be used for clinical transfusion, an immunotherapy cell or its culture supernatant that has just been prepared and has not yet been frozen, and an individual (such as a human or other animal) who has used immune cell therapy, peripheral blood, plasma, serum, tissue fluid, urine, etc. Specific detection methods are known in the art. For example, if it is necessary to detect whether immunotherapeutic cells contain RCR residues, the immunotherapeutic cells are co-cultured with host cells that can be used to produce the retrovirus, and then the total RNA of the host cells is extracted and reverse transcribed into cDNA. The cDNA is used as a template and the primer set in this article is used to perform an amplification reaction of the target gene based on the qPCR method. The amount of the target gene in the template (absolute amount or relative amount) is obtained according to the qPCR result. If the target gene GALV exists in the template, it indicates that there are RCR residues in the immunotherapeutic cells, otherwise it is not. If it is necessary to detect whether the immunotherapeutic cell culture supernatant contains RCR residues, the supernatant is collected and added to the culture system of the host cells of the retrovirus, and then the total RNA of the host cells is extracted in the same way, and a qPCR reaction is performed after reverse transcription.

[0050] Gamma-retroviruses are widely used in the production of preventive or therapeutic biological products. In some embodiments, the methods herein are used to detect RCR residues in CAR-T, CAR-NK, CAR-NKT, TCR-T, CAR-M and other products that use or have been exposed to gamma-retroviruses during the preparation / production process.

[0051] As used herein, the term "about" refers to the usual error range of the corresponding value that is easily known to those skilled in the art. "About" values ​​mentioned herein include embodiments for the value itself.

[0052] The present invention will be described below by way of specific examples. It should be understood that these examples are intended to illustrate the present invention only and are not intended to limit the scope of the present invention. The experimental methods in the following examples where specific conditions are not specified are generally carried out according to conventional conditions such as those described in J. Sambrook et al., Molecular Cloning Experiment Guide, 3rd edition, Science Press, 2002, or according to the conditions recommended by the manufacturer.

[0053] Example

[0054] Example 1: Development and validation of RCR detection method

[0055] This example mainly refers to the relevant guidance documents issued by the FDA to develop and validate the RCR detection method.

[0056] 1. Use ATCC#VR-1450 positive virus solution (for the production of GALV enveloped γ-retrovirus using PG13 cell line, FDA recommends using ATCC#VR-1450 as the positive virus solution for RCR detection) to infect HEK293 cell line to prepare the positive cell line HEK293-GALV (HEK293 cell line is a specialized cell line that can support the replication of retrovirus containing GALV envelope protein).

[0057] 2. Design of primers and probe sequences for amplification of the gene encoding the viral envelope protein GALV:

[0058] Forward primer GALV-FP: ACCTTCGGCACCAGATGAGT (SEQ ID NO: 1)

[0059] Reverse primer GALV-RP: CGCAGCTTAAGAGGATGATCAGT (SEQ ID NO: 2)

[0060] Probe GALV-probe: CTGGGAGCTGGAAAA (SEQ ID NO: 3)

[0061] The sequence of the amplification product of the above primers is shown in SEQ ID NO:4.

[0062] 3. We cultured and acclimated the negative cell line HEK293 and the positive cell line HEK293-GALV cells separately to adapt to co-culture with CAR-T cells. HEK293 cells and HEK293-GALV cells were co-cultured for at least 5 generations to improve the replication capacity of all potential retroviruses. After the co-culture, HEK293 cells were collected, the HEK293 cell genome was extracted, and the GALV copy number in the genome was detected by qPCR.

[0063] (1) Preparation of QPCR reaction system:

[0064]

[0065] (2) Add 23 μl of the reaction system to each well of the PCR tube, then add 2 μl of the template (gene) and load onto the machine.

[0066] (3) PCR reaction program: Use 7500 real-time quantitative PCR instrument for absolute quantification, refer to the following program (machine parameters): step 1, 95°C for 30 seconds, 1 cycle; step 2, 95°C for 5 seconds → 60°C for 34 seconds, 40 cycles. Step 3, 95°C for 15 seconds → 60°C for 1 minute → 95°C for 15 seconds.

[0067] 4. Positive virus liquid ATCC#VR-1450GALV virus liquid TCID 50 Determination

[0068] GALV virus liquid TCID 50 Plaque assay was used for detection. PG-4 cells were plated in a 96-well plate, with 2.0×10 3 100 μl of cells were used. After 48 hours, 100 μl of GALV virus solution of different dilutions were infected. The cells were cultured and the cytopathic effect in the 96-well plate was observed. The number of wells with cytopathic effect at each dilution was counted. The TCID was calculated according to the Reed-Muench formula. 50 .

[0069] 1) Number of plaque lesions in PG-4 cells infected with GALV virus solution of different dilutions

[0070] Table 1. Number of plaque lesions in PG-4 cells infected with different dilutions of GALV virus solution

[0071]

[0072]

[0073] 2) Trend of positive rate of cell plaque lesions versus dilution (GALV 10 -7 Subsequent dilutions were all negative)

[0074] The trend of the positive rate of cell plaque lesions versus dilution is shown in the figure Figure 1 shown.

[0075] 3) Calculation of TCID using the Reed-Muench formula 50

[0076] Table 2. TCID calculated by Reed-Muench formula 50

[0077]

[0078] From the above table, we can see that: TCID 50 Located at 10 -6 with 10 -7 Between, assuming 10 -(6+x) , find the value of x:

[0079] X=Log 10 Dilution factor × (infection rate of the previous dilution with an infection rate of 50% - 50) / (infection rate of the previous dilution with an infection rate of 50% - infection rate of the next dilution with an infection rate of 50%)

[0080] Based on the formula: TCID 50 For 10 -6.35 .

[0081] Based on the cytopathic effect and Reed-Muench formula, the TCID of GALV virus fluid can be calculated. 50 For 10 -6.35 , i.e. GALV virus solution diluted 10 6.35 TCID 50 According to the experiment, 100 μl / well of 96-well was infected, that is, 1 ml of GALV virus liquid was used for 10 6.35 Dilute to a volume of 100 μl containing 1 TCID 50 Virus particles, that is, 1 ml of GALV virus solution was diluted 1 / 2200000 times, and 100 μl of the volume contained 1 TCID 50 The concentration of viral particles in the GALV virus stock solution before dilution is 2.2×10 7 TCID 50 / ml. According to TCID 50 The conversion relationship between TCID and PFU (plaque-forming units): 1TCID 50 = 0.7 PFU. The concentration of virus particles in the GALV virus stock solution before dilution is 1.5×10 7 PFU / ml.

[0082] Based on the calculated viral particle concentration of the positive virus solution, the amount of virus to infect CAR-T cells in the next step can be calculated.

[0083] 5. qPCR method specificity verification

[0084] After RNA extraction from negative samples (HEK293 cells co-cultured with CAR-T) and positive samples (GALV-HEK293 cells co-cultured with CAR-T), qPCR reactions were performed to determine the gene copy number of GALV in the samples and compare the qPCR results. Each sample had 2 extractions.

[0085] The data is as follows:

[0086]

[0087]

[0088] 6. qPCR method sensitivity verification

[0089] (1) 100 positive cells were added to 1E6, 2E6, and 3E6 CAR-T cells, respectively, to prepare three samples. Each sample had two extractions. RNA was extracted simultaneously and qPCR reactions were performed to determine the gene copy number of GALV in the samples and compare the qPCR results.

[0090] The data is as follows:

[0091]

[0092]

[0093]

[0094] (2) 10, 100, and 1000 positive cells were added to 2E6 CAR-T cells, respectively, to prepare three samples. Each sample had two extractions. RNA was extracted simultaneously and qPCR reactions were performed to determine the gene copy number of GALV in the samples and compare the qPCR results.

[0095] The data is as follows:

[0096]

[0097]

[0098] 7. qPCR method robustness verification

[0099] 1000 positive cells were added to 2E6 CAR-T cells, and RNA concentration was detected after RNA extraction. Each sample had 2 extractions. The concentrations were adjusted to 50ng / μl and 100ng / μl as samples for testing, and the qPCR reaction results of different loading amounts were compared, and the back-calculation results of different loading amounts were compared.

[0100] The original data is as follows:

[0101]

[0102] Acceptance criteria RSD≤20% in conclusion Meet the verification standards

[0103] Summary: The qPCR method was tested for specificity, sensitivity, and durability, with a sensitivity of 10 positive cells per 2E6 CAR-T cells, which met the acceptable standards.

[0104] Example 2: RCR detection of three batches of anti-human CD19 T cell samples using the established RCR detection method

[0105] 1. Methods

[0106] The experimental groups were set up as follows:

[0107] Positive control: HEK293+HEK293-GALV (HEK293-GALV cells co-cultured with HEK293)

[0108] Negative control 1: HEK293+X10 (HEK293 cell single culture group) (Note: X10 is X-VIVO 15 Culture medium + 10% FBS. )

[0109] Experimental group: HEK293+CAR T (CAR T cells co-cultured with HEK293)

[0110] Detection limit group: HEK293+1 HEK293-GALV (HEK293-GALV cells (1) co-cultured with HEK293)

[0111] Detection method: Take three batches of anti-human CD19 CAR T cells (batch number: 170904 / 171002 / 171101, the CAR T cells are prepared by using γ-retrovirus with GALV envelope to mediate CAR gene transduction, illustratively, such as the CD19 CAR T cells described in patent document CN201610377871.4) with a total amount of 1%, and the number of cells is 5×10 7 , 6×10 7 and 2×10 7 , averagely divided into groups, 5×10 6 HEK293-GALV cells (positive control cells), cell number 1×10 6 The two cells were compared with HEK293 cells (cell number 5×10 6 ) were co-cultured for more than 21 days and subcultured 5 times. After the last subculture, the supernatant and HEK293 cells were collected when the cells were fully confluent. The HEK293 cell monoculture group was used as a negative control and cultured in parallel with the experimental group for 5 generations. The supernatant and cells were collected. A detection limit group was also set up in the experiment: HEK293-GALV cells (HEK293 cells that can secrete GALV virus) were taken and divided into 3 groups, with 1 cell in each group, and then compared with HEK293 cells (cell number 5×10 6 ) were co-cultured and cultured in parallel with the experimental group for 5 generations, and the co-culture supernatant and cells were collected.

[0112] 2. qPCR test results

[0113] After the co-culture, HEK293 cells were collected, the cell genome was extracted, and the copy number of GALV in the genome was detected according to the qPCR method described in Example 1. The results of each group of qPCR experiments are shown in Figure 2 , Figure 3 and Figure 4 .

[0114] The qPCR results showed that after the three batches of anti-human CD19 T cells were co-cultured with HEK293 cells and amplified, the GALV copy number in their genomes was consistent with the GALV copy number in the supernatant of the blank negative control X10 group, and no GALV was detected. However, after the positive control cells HEK293-GALV were co-cultured and amplified with HEK293, the GALV copy number in the supernatant reached an order of magnitude of 10 4 , and the GALV copy number in the supernatant of the co-culture detection limit group (only one HEK293-GALV cell) reached 10 after HEK293 cell amplification. 4 That is, the GALV copies of anti-human CD19 T cells were negative after qPCR detection after HEK293 co-culture and expansion.

[0115] Summary: All three batches of anti-human CD19 T cell replicable retrovirus tests were negative. We have developed a qPCR method for rapid detection of RCR in CAR-T cells, which can be used for rapid detection and release of CAR-T products.

[0116] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

[0117] Sequence of this article:

[0118] Forward primer GALV-FP: ACCTTCGGCACCAGATGAGT (SEQ ID NO: 1)

[0119] Reverse primer GALV-RP: CGCAGCTTAAGAGGATGATCAGT (SEQ ID NO: 2)

[0120] Probe GALV-probe: CTGGGAGCTGGAAAA (SEQ ID NO: 3)

[0121] Amplification product: accttcggcaccagatgagtcctgggagctggaaaagactgatcatcctcttaagctgc (SEQ ID NO: 4)

Claims

1. A primer set for detecting whether a replicative retrovirus is present in a sample, characterized in that: The forward primer of the primer set has no less than 90% identity with SEQ ID NO:1, and the reverse primer of the primer set has no less than 90% identity with SEQ ID NO:

2.

2. The primer set according to claim 1, characterized in that The forward primer of the primer set has or is about 90%, 90.9%, 95%, 95.2% or 100% identity with SEQ ID NO:1, and the reverse primer of the primer set has or is about 91.3%, 92%, 95.7%, 95.8% or 100% identity with SEQ ID NO:2; or the primer set also includes a probe, which has no less than 85% identity with SEQ ID NO:3, preferably, the probe has or is about 86.7%, 88.2%, 93.3%, 93.8% or 100% identity with SEQ ID NO:

3.

3. Use of the primer set of claim 1 in preparing a reagent for detecting whether a retrovirus is present in a sample, wherein the retrovirus contains a GaLV envelope or a gamma-retrovirus with a Gibbon Ape Leukemia Virus (GALV) envelope protein as an envelope.

4. A kit for detecting whether a replicative retrovirus exists in a sample, characterized in that: The kit comprises the primer set according to claim 1 or 2.

5. The kit according to claim 4, characterized in that The kit also contains conventional components of a qPCR reaction system, such as dNTPs, a PCR reaction buffer or a DNA polymerase.

6. A method for detecting whether a replicative retrovirus exists in a sample, characterized in that: The method uses the primer set according to claim 1 or 2.

7. The method according to claim 6, characterized in that The method is a method based on polymerase chain reaction (PCR); preferably, the PCR method is selected from ordinary PCR (first generation PCR), real-time fluorescence quantitative PCR (Quantitative Real-time PCR, qPCR), real-time fluorescence quantitative reverse transcription PCR (Real-time RT-PCR, RT-qPCR) and digital PCR (Digital PCR, Dig-PCR, dPCR); more preferably, the PCR method is real-time fluorescence quantitative PCR.

8. The method according to claim 7, characterized in that The real-time fluorescence quantitative PCR is a chimeric fluorescent dye method or a fluorescent probe method; preferably, the fluorescent probe method is selected from the group consisting of a TaqMan probe method, a molecular beacon probe method, an MGB probe method and a LightCycler probe method.

9. The method according to claim 6, characterized in that The retrovirus is a γ-retrovirus. Preferably, the γ-retrovirus contains a GaLV envelope or a γ-retrovirus with a Gibbon Ape Leukemia Virus (GALV) envelope protein as an envelope.

10. The method according to claim 6, characterized in that The sample is an immune cell therapy product, which has used or been in contact with a γ-retrovirus containing a GaLV envelope during the preparation or production process; preferably, the immune cell therapy product is a CAR-T, TCR-T, CAR-NK, CAR-NKT or CAR-M product.

Images